ID: 901209497

View in Genome Browser
Species Human (GRCh38)
Location 1:7516440-7516462
Sequence GGGCGTGTGTGCACTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901209497_901209501 -9 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209501 1:7516454-7516476 CACACGCCCCTCTGCTGGCTGGG 0: 1
1: 0
2: 2
3: 8
4: 162
901209497_901209505 11 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209505 1:7516474-7516496 GGGAGAAGCCTCTTCAGAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 206
901209497_901209500 -10 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209500 1:7516453-7516475 ACACACGCCCCTCTGCTGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 120
901209497_901209509 28 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209509 1:7516491-7516513 AGCTGGATGCTTTGGATGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 176
901209497_901209508 24 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209508 1:7516487-7516509 TCAGAGCTGGATGCTTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 248
901209497_901209510 29 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209510 1:7516492-7516514 GCTGGATGCTTTGGATGGCTGGG 0: 1
1: 0
2: 1
3: 64
4: 1032
901209497_901209507 20 Left 901209497 1:7516440-7516462 CCAGAGCCAGTGCACACACGCCC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 901209507 1:7516483-7516505 CTCTTCAGAGCTGGATGCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901209497 Original CRISPR GGGCGTGTGTGCACTGGCTC TGG (reversed) Intronic