ID: 901212875

View in Genome Browser
Species Human (GRCh38)
Location 1:7536417-7536439
Sequence CTGCAGCCTGCCCTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901212868_901212875 9 Left 901212868 1:7536385-7536407 CCTGCCCCTGGGTTCACTCTGCG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG 0: 1
1: 0
2: 6
3: 45
4: 365
901212869_901212875 5 Left 901212869 1:7536389-7536411 CCCCTGGGTTCACTCTGCGTCCC 0: 1
1: 0
2: 1
3: 23
4: 149
Right 901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG 0: 1
1: 0
2: 6
3: 45
4: 365
901212871_901212875 3 Left 901212871 1:7536391-7536413 CCTGGGTTCACTCTGCGTCCCTG 0: 1
1: 0
2: 1
3: 12
4: 205
Right 901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG 0: 1
1: 0
2: 6
3: 45
4: 365
901212870_901212875 4 Left 901212870 1:7536390-7536412 CCCTGGGTTCACTCTGCGTCCCT 0: 1
1: 0
2: 0
3: 8
4: 187
Right 901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG 0: 1
1: 0
2: 6
3: 45
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901212875 Original CRISPR CTGCAGCCTGCCCTTTGCTG TGG Intronic
900151381 1:1180651-1180673 CTCCAACCTGCCCTGTGCTCCGG - Intronic
900579202 1:3400142-3400164 CTGCAGCCTGCCCATGGTTTTGG - Intronic
900630384 1:3631924-3631946 CTGCAGCCCGCCTTTTGTTAAGG - Intronic
901012966 1:6211398-6211420 CTGCAGCCTCCCCTGGGGTGGGG + Intronic
901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG + Intronic
901634694 1:10665083-10665105 CTGAAGCCTGCCTGGTGCTGGGG + Exonic
901793469 1:11666855-11666877 CTGTACCCAGCCTTTTGCTGTGG - Intronic
902137920 1:14326675-14326697 CTGCATCCTTCCCTGTGCTTGGG + Intergenic
902580585 1:17405071-17405093 CCCCAGCCTGCCCCTGGCTGAGG - Intergenic
902917154 1:19645678-19645700 CTGCAGCCTCGCCTTTTCTTTGG - Intronic
903141151 1:21339889-21339911 CTGGGGCCTGCCCTTTCCTTGGG - Intronic
903325887 1:22568310-22568332 CTGCAGGGTCCCCTTTGCAGAGG + Intronic
903669227 1:25025648-25025670 GGACAGGCTGCCCTTTGCTGAGG + Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
903997702 1:27318050-27318072 CTGCAGCATGCCCCTGGCTCAGG + Intergenic
904043242 1:27596102-27596124 CAGCATCCTGGCCTTTGCTCCGG + Intronic
904046303 1:27610963-27610985 CTGTGTCCTGCCCTGTGCTGGGG - Intergenic
904274463 1:29371217-29371239 CTCCAGCCTCCCCATTGCAGGGG + Intergenic
904708349 1:32409136-32409158 CAGCAACCTGTCCTTTGCTCTGG + Intergenic
905899200 1:41569962-41569984 CTGCAGTATGCGCTGTGCTGTGG + Intronic
906316002 1:44786768-44786790 CTGGACCAGGCCCTTTGCTGGGG - Intronic
906887031 1:49659877-49659899 CTGTAGCCTTGCATTTGCTGAGG - Intronic
907457840 1:54586862-54586884 CTGCAGCCTGTCCTGGGCTGAGG - Intronic
907558119 1:55363036-55363058 CTGACTCCAGCCCTTTGCTGGGG - Intergenic
907972164 1:59393630-59393652 CTGCAGTCTGGCCTCTGCAGTGG + Intronic
910219621 1:84877204-84877226 CTGCAGCTTCCCCTTGGCTCAGG - Intronic
912414799 1:109500680-109500702 CTGCAGTCTGCCCTGTGATTTGG - Intronic
912559202 1:110538149-110538171 CTGCAGGCTGGCCTCAGCTGCGG - Intergenic
913068641 1:115280308-115280330 CTGGAGGCTGCACTTAGCTGTGG + Intergenic
915005442 1:152630680-152630702 CTGGGGCCTGCCCTGGGCTGGGG + Intergenic
915465808 1:156097271-156097293 CTGCAGCCTTCCCTTTCCTGTGG - Intronic
916578529 1:166088037-166088059 CTGCAGCCTGGGCTTTGCGTTGG - Intronic
917929540 1:179813934-179813956 CTGCAGCCAGCCCTGTGGGGTGG + Exonic
919671416 1:200341512-200341534 CTCCACCCTGCCCTCTCCTGGGG - Intergenic
919860476 1:201736635-201736657 CTGCATTCTGCCCTCTGCTTTGG + Intronic
920428426 1:205897839-205897861 CTGCAGTGTGCCCTTCTCTGGGG - Intergenic
920431981 1:205924432-205924454 CCTCAGCCTGCCCTATGGTGTGG - Exonic
921284340 1:213595494-213595516 CTCCTGCCTGCCCTTTGCAAAGG - Intergenic
922425077 1:225484922-225484944 CAGCAGCCAGCCCTTTTGTGGGG + Intergenic
922718961 1:227890677-227890699 CTGGAGCCTCCCCCTGGCTGGGG - Intergenic
922794763 1:228334599-228334621 CTGCAGCCAGCCCTAGGCTCAGG - Intronic
922865081 1:228852737-228852759 CTGGAGCATTCCCTTGGCTGGGG + Intergenic
1064033390 10:11897266-11897288 CTGCTGCATGCCCTTTGCTCCGG + Intergenic
1065811224 10:29445617-29445639 TAGAAGCCTGCCCTCTGCTGGGG - Intergenic
1066353091 10:34655606-34655628 CTGCATTCTGCCCTCTTCTGCGG - Intronic
1067031086 10:42879190-42879212 CTGCAGCCTGCTCTATGCCCAGG - Intergenic
1067805992 10:49394309-49394331 CTGCAGGCTGCCCTGAGCAGTGG - Intronic
1067958343 10:50818912-50818934 CTCCAGCCTGCTCTCTGCTCTGG + Intronic
1070337514 10:75468508-75468530 CAGTAGACTCCCCTTTGCTGTGG + Intronic
1070523667 10:77276389-77276411 CTGCAGTATGCCCTTTGCTGTGG - Intronic
1070566449 10:77606915-77606937 CTGCAGCCAGCCCTTGGTAGTGG + Intronic
1070591149 10:77802043-77802065 CTGCTGCCAAGCCTTTGCTGTGG - Intronic
1070674200 10:78400767-78400789 CTGAAGCCTGACCTTTGGTAAGG + Intergenic
1070727162 10:78800294-78800316 CTGCTGCCATCCCTGTGCTGGGG - Intergenic
1071710145 10:88042016-88042038 CTGCAGCCTGGCCTTTGATTGGG + Intergenic
1071797293 10:89020436-89020458 TTTCAGCCTCCTCTTTGCTGCGG + Intergenic
1071912261 10:90249782-90249804 CTGAATGCTGCCTTTTGCTGAGG + Intergenic
1073488814 10:103839086-103839108 CTGAAGGCGGCCCTTGGCTGTGG + Intronic
1074894320 10:117761932-117761954 CTGCTGGCTGCCTTTAGCTGTGG - Intergenic
1074935051 10:118169919-118169941 CTACAACCTGCCCTTTACTCAGG - Intergenic
1075734522 10:124655663-124655685 CAGCAGCCTGTTCTCTGCTGGGG + Intronic
1075955182 10:126517488-126517510 CTGAGTCCTGCCCTTTGCTGGGG + Intronic
1077282346 11:1751384-1751406 CTCCAGCTTCCCCTTTGCTAGGG + Intronic
1078091844 11:8268776-8268798 ATGCAGCCTTCACTCTGCTGAGG - Intergenic
1079399656 11:20095973-20095995 TTGCCGTCTGCCCTTTGCAGTGG + Intronic
1080779747 11:35419319-35419341 CTGCCACCTGTGCTTTGCTGCGG + Intronic
1080829388 11:35877203-35877225 CTGCAGCCTCAACTTTGCTGTGG + Intergenic
1081619252 11:44609335-44609357 ATGCAGTTTGCCCTTTCCTGTGG + Intronic
1081631719 11:44694071-44694093 CTGCAGCAGGCCCTGGGCTGGGG + Intergenic
1081871947 11:46387011-46387033 CTGCCTCCAGGCCTTTGCTGTGG - Intergenic
1082181560 11:49126378-49126400 CTGTATCCTGCAGTTTGCTGAGG - Intergenic
1083366391 11:62143920-62143942 CTGCTGGCTGCCCATTGCTGTGG + Intronic
1083620703 11:64048080-64048102 CTGCAGCCTGCCCTGGCCGGCGG + Intronic
1083768586 11:64854018-64854040 CTGCCCCCCGGCCTTTGCTGTGG - Exonic
1083952499 11:65964826-65964848 CTGCAGACTGCGCTGTGCGGGGG + Intronic
1084273983 11:68042685-68042707 CGGCAGCCTCCCCTTTGGCGGGG - Exonic
1085098997 11:73784439-73784461 CAGCACCCTGCCCCTTCCTGTGG + Intergenic
1086683935 11:89708467-89708489 CTGTATCCTGCAGTTTGCTGAGG + Intergenic
1087630419 11:100644372-100644394 ATACAGCTTGCCCTTTACTGAGG + Intergenic
1087920583 11:103862326-103862348 CTTCAGCTTGCCCTCTGCTGTGG + Intergenic
1088349647 11:108871354-108871376 GGGCATCCTGCCCTCTGCTGGGG + Intronic
1088652987 11:111974839-111974861 CTGACACCTTCCCTTTGCTGGGG + Intronic
1088847446 11:113680306-113680328 GTGCAGACAGCCCTTAGCTGAGG + Intergenic
1089395659 11:118135266-118135288 CTGCAGGGTGCCCGTGGCTGTGG - Exonic
1089461274 11:118655774-118655796 CTCCAGCCTGCCCTCTACAGAGG + Intronic
1089492708 11:118893847-118893869 CTTCATCTTGCCCTTTGCCGTGG + Exonic
1090445500 11:126761396-126761418 CTGGACACTGCCCTTTGCTGGGG - Intronic
1090457462 11:126862401-126862423 ATGAAGCCAGCCCTCTGCTGTGG + Intronic
1090662509 11:128891909-128891931 CTGCAGGCTGCCCTGTGCGTTGG + Intronic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1092254065 12:6916730-6916752 GTGAGGCCTGCTCTTTGCTGGGG + Intronic
1093027163 12:14255419-14255441 TTGAAGCCTGCCCTTGTCTGAGG + Intergenic
1095277760 12:40309176-40309198 CTTCAGCCTGTCCCTTGCTGAGG - Exonic
1095793136 12:46189055-46189077 CTCCAGGCTGCCCTTTTCTTGGG - Intronic
1101590361 12:106120247-106120269 CTGCAACTGGCCCTTTGCTAAGG + Intronic
1102543006 12:113635890-113635912 ATGCAGGCTCCGCTTTGCTGTGG - Intergenic
1102819339 12:115894684-115894706 CTGCTGCCTCCCCCTTGCTCTGG - Intergenic
1104933474 12:132352527-132352549 CTGCAGCCAGCCCCTTCCCGGGG - Intergenic
1105074603 12:133264630-133264652 CTGCCGCCTCACCTTGGCTGGGG - Intergenic
1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG + Intronic
1107319402 13:39169493-39169515 CTGCAGACTCCACTGTGCTGAGG - Intergenic
1109756104 13:66762221-66762243 CTAAAGCCTGCCAGTTGCTGAGG + Intronic
1110308839 13:74022935-74022957 ATGCAGCCTGCCATTTGGTTAGG - Intronic
1111986202 13:95069276-95069298 CTGCAGCATGCCATTTTCTGGGG + Intronic
1113589435 13:111488152-111488174 CTGCTGCCAGCCCCTTGCTGAGG + Intergenic
1113971545 13:114195111-114195133 CTGCAGCATGCCCAGGGCTGTGG - Intergenic
1114824334 14:26058637-26058659 CTGCTGCCTGTCCTTCGATGTGG - Intergenic
1115151849 14:30295100-30295122 CTGCTACCTGCCCTTCACTGAGG - Intergenic
1117760130 14:59018546-59018568 CTGCATCCTGTCCTCTTCTGCGG - Intergenic
1118472385 14:66086718-66086740 CTTCAGCCTTCCCTTTGATCAGG - Intergenic
1119470399 14:74894162-74894184 CTCCAGGCTTCCCTTTCCTGTGG - Intronic
1119727414 14:76930054-76930076 CTGCAGCCTGCACGGAGCTGAGG - Intergenic
1119732466 14:76959501-76959523 CTGCAGCCTGTCCTTACATGGGG + Intergenic
1120985454 14:90330961-90330983 CTGCATCCTGCCCTGGGGTGGGG - Intronic
1121305369 14:92903291-92903313 CAGCACTCTGCCTTTTGCTGTGG - Intergenic
1121520728 14:94584576-94584598 CTGCAGTCTGCCATGTGTTGTGG - Intronic
1121711449 14:96041719-96041741 CTGCAAACTGCCCCCTGCTGAGG - Intronic
1122032880 14:98926461-98926483 CTGCACCCAGCCCTCTGCAGGGG + Intergenic
1122064791 14:99165292-99165314 CTGCAGGCTGCCGTTTGCAAAGG - Intergenic
1122455495 14:101847435-101847457 CTGCAGCCTCTCCTCAGCTGTGG + Intronic
1122630530 14:103105651-103105673 CTGCACCCTGGGCTTTGCTGGGG + Intronic
1122723643 14:103736228-103736250 CTGCAGGCCACCCTCTGCTGAGG - Intronic
1122783565 14:104153826-104153848 CTGCACCCTGCCCGTGGCTGAGG + Intronic
1123041600 14:105492511-105492533 CTCCATCCTGGCCTTTTCTGGGG + Intronic
1125030483 15:35071028-35071050 AAGCAGACTGCCCTTTGCTCTGG + Intergenic
1125347358 15:38731825-38731847 CTCAAGCCTGCCCTTAGCAGTGG - Intergenic
1125507687 15:40276449-40276471 CAGCAGTCTGCCCTCTGCAGTGG - Exonic
1125524922 15:40368669-40368691 CTGGGGCCTGACCTCTGCTGCGG + Exonic
1126548518 15:49900874-49900896 TTGGAGCCTCCCCTTTACTGTGG + Intronic
1129155320 15:73713965-73713987 CTGCACCCTGCGGTTTGCAGGGG + Exonic
1129321980 15:74780589-74780611 CTGGAGCCAGCCCTTTGGAGAGG - Intergenic
1129689870 15:77707102-77707124 CTGCAGCCTGCCACCTGCTGAGG - Intronic
1130908269 15:88254767-88254789 CAGCTGCCTACCCATTGCTGAGG + Intronic
1132056827 15:98657813-98657835 CTGCAGCCTGTCCTTTTCTGGGG + Intronic
1132242191 15:100266452-100266474 CTTCTGCCTGCCCTTACCTGGGG - Intronic
1132891889 16:2208682-2208704 CTGCAGCTTCCCCTCTGCTGGGG + Intronic
1133367769 16:5224551-5224573 CTGCAACCTCCTCATTGCTGAGG + Intergenic
1133490572 16:6264119-6264141 CTACTGCCTGCCCATTGCTTTGG + Intronic
1133800132 16:9078590-9078612 CTGCAACCAGTCCTTTGTTGAGG - Intergenic
1134071627 16:11263707-11263729 GTGCAGCCTGTCCTGTGGTGGGG - Intronic
1134227859 16:12405505-12405527 CTGCAGCCTTCCTGATGCTGGGG + Intronic
1134471128 16:14526828-14526850 CTGCAGCCAGCCCATTTTTGTGG + Intronic
1136022824 16:27450799-27450821 CTGCAGTCTGACCTTTGGGGAGG - Exonic
1136122726 16:28150063-28150085 GGGCAGACAGCCCTTTGCTGGGG - Intronic
1137385262 16:48036006-48036028 CTTCAGCTTCCCCTCTGCTGGGG - Intergenic
1137614973 16:49841017-49841039 CTTTAGCCTGTCATTTGCTGGGG - Intronic
1137726591 16:50660782-50660804 CTGCAGCCTGCCCATAGCCCCGG + Intergenic
1137735387 16:50719719-50719741 CTGCCCCTTTCCCTTTGCTGGGG + Intronic
1138585965 16:57970715-57970737 CTGCTGACTGCACTTTGATGAGG + Intronic
1139328348 16:66168894-66168916 CTGTAACCTGCCCTCTGCAGCGG - Intergenic
1139391591 16:66609153-66609175 GTGCAGCCTGCCCTGCGATGCGG - Intronic
1139516292 16:67454238-67454260 CTTGCCCCTGCCCTTTGCTGTGG - Intronic
1139609993 16:68049126-68049148 TCACTGCCTGCCCTTTGCTGAGG + Intronic
1141543098 16:84741994-84742016 CTGCAGCAAGCCCTTTGCAGAGG + Intronic
1142144755 16:88488198-88488220 CCTCCACCTGCCCTTTGCTGCGG - Intronic
1142176981 16:88649996-88650018 CTGCAGCCTGTCCTGTGCCCAGG - Intronic
1142320040 16:89375956-89375978 CCGCAGCCTGTGCTCTGCTGTGG + Intronic
1142752326 17:1996410-1996432 CAGCAGCCAGCCCTCTGCAGGGG - Intronic
1144162153 17:12570166-12570188 CTGCAGCCTGACTGTTGCTCTGG + Intergenic
1145242352 17:21247428-21247450 CACGAGCCTGCCCTGTGCTGGGG - Intronic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1148218390 17:45846331-45846353 CTGCACCGTGGCCTATGCTGTGG + Exonic
1148736555 17:49868464-49868486 CAGCAGCCTGCCCTTCGCCTGGG + Intergenic
1148874754 17:50680352-50680374 GGGCAGCATGCCCTTTGTTGGGG + Intronic
1149344508 17:55720884-55720906 CTGCATCATCCCCTTTGCTGTGG - Exonic
1150284949 17:63949323-63949345 GTGTAGCCTGCCCCTTGCAGGGG + Intronic
1151353105 17:73543150-73543172 CGGCAGCCTTCCATTTACTGGGG + Intronic
1151482869 17:74380414-74380436 CCGCAGCCTTCCCTAGGCTGTGG - Intergenic
1151721370 17:75858199-75858221 ATGCTGCCTGCTCTTTGCTGGGG - Intergenic
1152433617 17:80262344-80262366 CTGCAGTCTTCTCTTTGATGAGG - Intronic
1152495571 17:80669028-80669050 CTGCAGCCAGGGCTTTGCTCGGG + Intronic
1152534746 17:80943938-80943960 CTGCCTCCTGGCCTTGGCTGCGG - Intronic
1152561552 17:81081332-81081354 GGGCAGACTGCCCTGTGCTGAGG - Intronic
1152868580 17:82738328-82738350 CTGCACCCTGCCCTCTGTGGTGG + Intronic
1155537582 18:26833002-26833024 CTGCAGCCTGGGAATTGCTGTGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157805625 18:50655540-50655562 CTGCAGCCTGCACTCCTCTGGGG + Intronic
1160040992 18:75345267-75345289 CTGCAGCCCCGCCTGTGCTGGGG - Intergenic
1160446910 18:78935103-78935125 ATTCAGCCTGCTCATTGCTGCGG + Intergenic
1160849505 19:1183612-1183634 CTGCCCCCGGCCCTTTGCTCTGG - Intronic
1160908052 19:1460960-1460982 CTGCAGACTCACATTTGCTGGGG + Intronic
1161584127 19:5095957-5095979 CGGCAGCCTGCCCCTTGGTGGGG - Intronic
1161746407 19:6063000-6063022 CTGGTGCCTGGCCCTTGCTGGGG + Intronic
1162298388 19:9828741-9828763 CTGCAGGCAGCCCTTTGCTTAGG + Intronic
1162503379 19:11067513-11067535 CTGGAGCCTGCCATTTTGTGAGG + Intergenic
1163728060 19:18933530-18933552 CTGCTGCCTGCACTGGGCTGCGG - Intronic
1163815540 19:19462597-19462619 CGCCAGCCAGCCCTCTGCTGAGG + Intronic
1164234017 19:23316466-23316488 CTGCAGCCTGCACCCTGCAGGGG + Intronic
1164463568 19:28468890-28468912 CTGCAGCCCGGCTTTTCCTGTGG - Intergenic
1164555412 19:29247244-29247266 CTTCCACCTGTCCTTTGCTGAGG + Intergenic
1164633032 19:29774079-29774101 CTCCAGCCTGGCCCTTGCAGGGG + Intergenic
1164719471 19:30421835-30421857 CTGCAGCCGGCCCTGGCCTGGGG - Intronic
1165075733 19:33278986-33279008 CTGCCTCCTGCCCTGGGCTGGGG - Intergenic
1165705196 19:37970981-37971003 GTGCAGCCTGGCCTGTGGTGGGG + Intronic
1165822504 19:38685492-38685514 AGCCTGCCTGCCCTTTGCTGAGG - Intronic
1166031797 19:40136776-40136798 CTGCATCTTTCCCTTTGCTTAGG - Intergenic
1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG + Exonic
1166820647 19:45577407-45577429 CTGCTGATTGCCCTTTGCTGTGG - Intronic
1168325177 19:55535193-55535215 CTGAGGCCAGCCCTGTGCTGGGG - Intronic
1168719403 19:58546619-58546641 CTGCACCCTGACCTTTGCCTGGG - Intronic
925157989 2:1661943-1661965 CCCCAGCCTCCCCTCTGCTGTGG - Intronic
925438809 2:3866400-3866422 CCACAGCCTTCCCCTTGCTGAGG - Intergenic
925688417 2:6495617-6495639 CTGCACCTTGCTCTTGGCTGAGG - Intergenic
926112010 2:10189509-10189531 CAGCAGCCTGCCCCTTGCTGGGG + Intronic
927114372 2:19886566-19886588 CAGCAGCCTGCCCGGGGCTGTGG + Intergenic
927131621 2:20065047-20065069 CTGAGGCCTGCCCTTCCCTGAGG + Intergenic
927204014 2:20595602-20595624 CTGCAGCCTGCTCTGTGCTGCGG + Intronic
927851604 2:26503354-26503376 CTGCAGCCTGGCCTTTGGGGAGG - Intronic
929143851 2:38689250-38689272 ATGCAGCCTGGCCTTTGCAGGGG - Intronic
929412940 2:41717340-41717362 CTGCTGTATGCCCTTTGCAGGGG + Intergenic
929471324 2:42196857-42196879 CTCCACCCTGCCCTCTACTGTGG + Intronic
931627346 2:64268654-64268676 CTCCAGCCTGCAATTTGCTGAGG + Intergenic
931748457 2:65310627-65310649 CTGCAGCCTTCCTTTCACTGAGG + Intergenic
933140158 2:78782587-78782609 ATGCACCCTTCACTTTGCTGAGG - Intergenic
934088432 2:88529638-88529660 CTACAGCATGCCCATTGCAGAGG + Intergenic
934123818 2:88866697-88866719 CTGCCGCATTCCCCTTGCTGAGG - Intergenic
934712052 2:96522746-96522768 CTGCCTCCTGCCCTTTGCTCAGG - Intergenic
934762516 2:96864435-96864457 CTGCTGCTTGCCCTTAGCTGGGG - Intronic
934941933 2:98509037-98509059 CTGAAGCCTTCCCTTGGGTGAGG - Intronic
935172420 2:100620770-100620792 ATGCATCCTGCCCTTCCCTGTGG + Intergenic
935434440 2:103014011-103014033 ATGCAGCTTGCCCTGTTCTGTGG + Intergenic
935624803 2:105163377-105163399 CTGCAGCCTGAGATTTGATGAGG - Intergenic
936066549 2:109336899-109336921 ATGCAGACTGCCCTTTGCTCTGG - Intronic
936079793 2:109424248-109424270 CTTCAGGCTGCCCTTTGAAGGGG + Intronic
936089937 2:109495005-109495027 CTGCTGCCTGCCAGCTGCTGGGG - Intronic
936722086 2:115264369-115264391 CTGGAGCCTATCCTTTGCTGGGG + Intronic
938074730 2:128325733-128325755 CTGCAGCCTGCCCTCTCCAGCGG + Intergenic
938124539 2:128662490-128662512 CTGCAGTCTGCTCTGTCCTGAGG - Intergenic
938386396 2:130870210-130870232 CTTCAGCCTACCCTGGGCTGGGG - Intronic
940618870 2:156085102-156085124 CTCCAACTTGCCCTTTTCTGAGG - Intergenic
941854899 2:170220744-170220766 CTGCATCCTGCCTGTTGCAGTGG + Intronic
942070690 2:172312918-172312940 CTGAAGTCTGCCCTTTGTTCTGG - Intergenic
942298023 2:174535986-174536008 CTGCAGCTTGCCTGTTACTGGGG - Intergenic
948088207 2:235267902-235267924 CTCCAGGCTGCTCTCTGCTGTGG + Intergenic
948542372 2:238699719-238699741 CAGGAGCCTGGCCTCTGCTGGGG + Intergenic
948794592 2:240395739-240395761 CCGCAGCCTGCCCAGTGCTCAGG - Intergenic
948879103 2:240847049-240847071 ATGCAGCCAGGCTTTTGCTGAGG - Intergenic
949049222 2:241888353-241888375 CTCCAGCCTGACCTGAGCTGTGG - Intergenic
1168829151 20:834836-834858 CTGGAGCCTGCCCCTGGCTTTGG + Intronic
1169285530 20:4304251-4304273 TTCCAGCCTGCCCTGTGCTGGGG + Intergenic
1170579460 20:17686934-17686956 CTCCAGCCTGGGCTTGGCTGGGG + Intergenic
1171868264 20:30506209-30506231 CTGCAGCCAGCCTTTGGGTGGGG + Intergenic
1172776264 20:37408943-37408965 CTCCCGCCTGCCTCTTGCTGTGG + Intergenic
1172828998 20:37815954-37815976 CAGCAGCCTGCAGGTTGCTGGGG + Intronic
1172902603 20:38346097-38346119 CTCAACCCTGCCCTCTGCTGGGG + Intergenic
1173585185 20:44176945-44176967 CTGCTGGCTGCCCATTGCTGTGG - Intronic
1174306320 20:49616547-49616569 CTGAATGCTGCACTTTGCTGGGG - Intergenic
1174306351 20:49616714-49616736 CTGGAGCTTGCCCTGTCCTGGGG + Intergenic
1174380237 20:50151540-50151562 CAGTAGTCTGACCTTTGCTGTGG - Intronic
1174402695 20:50284375-50284397 CTGCGCCCTTCCCTTTGCTTGGG + Intergenic
1175353593 20:58344467-58344489 CTGCCTCCTCCCCTTTGCTCTGG + Intronic
1175353600 20:58344504-58344526 CTGCTGCCTCCCCTTTCCTCTGG + Intronic
1175839929 20:62020234-62020256 CTGCAGCCTGTCCTGTGCGTTGG - Intronic
1176160314 20:63644179-63644201 CTGCCGCCTGCCCTTCCCTGCGG - Intronic
1176288786 21:5033611-5033633 CTGCAGCCTCCCCTTGGCATGGG + Intronic
1178417057 21:32412660-32412682 CCGCCCCCTCCCCTTTGCTGGGG + Exonic
1178663188 21:34523588-34523610 CTGGAGCCTGGCATCTGCTGCGG + Exonic
1179868398 21:44229864-44229886 CTGCAGCCTCCCCTTGGCATGGG - Intronic
1180043950 21:45294219-45294241 CTCCAGCCTGGCCTTTCCTGGGG + Intergenic
1180069759 21:45430444-45430466 CTGCTGCCTGCTGCTTGCTGGGG + Intronic
1180801435 22:18633908-18633930 CTGCAGCCTAGCCATCGCTGGGG - Intergenic
1181220286 22:21361353-21361375 CTGCAGCCTAGCCATCGCTGGGG + Intergenic
1181312016 22:21950012-21950034 CTACAGCCTGCCCTGTGAAGTGG - Intronic
1181553459 22:23654020-23654042 ATGCAGCCTGCCCTTACCCGGGG + Intergenic
1181673513 22:24437176-24437198 TTGCAGGCTGCCCCTTTCTGGGG - Intronic
1182016186 22:27041887-27041909 CTGCAGCCTGGCCTGCCCTGTGG - Intergenic
1182051099 22:27313337-27313359 AAGCTGGCTGCCCTTTGCTGGGG - Intergenic
1183508291 22:38221185-38221207 CTGCTGCCCGTCCTGTGCTGGGG - Exonic
1184019271 22:41809620-41809642 CTCCTGCCTTCCCTTTGCTGTGG - Intronic
1184190893 22:42893650-42893672 GGGCAGCCTGTCCTTGGCTGTGG + Intronic
1184709462 22:46240048-46240070 CGACAGCCTGGCCTTTGGTGGGG + Exonic
1185068138 22:48642176-48642198 GAGCGGCCTGCGCTTTGCTGAGG + Intronic
950459479 3:13112661-13112683 CTGCAGCCCACACTCTGCTGCGG - Intergenic
950902887 3:16513305-16513327 CTGCAGGTTGCTCTTTGCCGGGG - Intronic
951091404 3:18577629-18577651 CTTCAGCCTGCCCTGTGGTTGGG - Intergenic
953787089 3:45919532-45919554 CTGCAACCGGTCCTCTGCTGTGG + Exonic
954070187 3:48137454-48137476 CTGTAGCCTTTCCTATGCTGAGG - Intergenic
954462758 3:50637094-50637116 CTGCATCCTGTGCTTTGCTGAGG - Intronic
954884223 3:53857835-53857857 CTGCAGCCTCCACCGTGCTGAGG + Intronic
956752439 3:72353941-72353963 CTGCAGCCTGGGCCTCGCTGTGG + Intergenic
959108346 3:102092092-102092114 CTGCACCCTGCTCTGAGCTGCGG - Intergenic
962484774 3:135831653-135831675 TTTCAGCATGCCCTTTGCTCTGG + Intergenic
966832744 3:184024120-184024142 CTGCAGCCTGCCAGGTGCGGTGG - Intergenic
966925542 3:184642518-184642540 AGGCAGCCTGGCCTTGGCTGGGG + Intronic
967397455 3:189023848-189023870 TGGCAGCCTGCCCTTTCCTCTGG + Intronic
967448847 3:189598991-189599013 CTTCAGCCTCTGCTTTGCTGTGG - Intergenic
967994851 3:195158730-195158752 GTGCAGCCTGCACTGTCCTGCGG + Intronic
968084845 3:195869679-195869701 CTGCGGCCTCCCGTTTGCTGGGG - Intronic
968649397 4:1754458-1754480 CTACAGACAGCCCTGTGCTGGGG + Intergenic
968734120 4:2286334-2286356 CCGAGGCCTGCCCTTTGCGGGGG + Intronic
968951952 4:3699953-3699975 CTGCAGCCTGCTCCTGGCTGTGG + Intergenic
969054664 4:4394126-4394148 TGGCAGCCTGCTCTTGGCTGTGG + Intronic
969302012 4:6302622-6302644 CAGCAGCCTTCCCTTTGTCGGGG - Exonic
969312620 4:6362745-6362767 TTGCAGCCTGCCTGGTGCTGGGG - Intronic
969503831 4:7571276-7571298 CTCCAGCCAGCCCTCTGCTAAGG - Intronic
969858399 4:10018013-10018035 CTCCAACCTGCCCTTGCCTGTGG + Intronic
969870747 4:10103125-10103147 CTGCAGCCTGGGCTTTTGTGTGG - Intronic
969952540 4:10853468-10853490 TGGCAGCCTGCCCTTTCCTTTGG + Intergenic
971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG + Exonic
972431400 4:38985953-38985975 CTGGAGCCTTCCCTTAGCAGAGG - Intronic
974071422 4:57127618-57127640 CAGCAGCCTGACCTTTACGGTGG - Intergenic
974985977 4:69026552-69026574 CGGCAGCCTGCCCTTTTCTCTGG + Intronic
976407396 4:84675335-84675357 TTGCAGCCAGCCATTTCCTGTGG - Intronic
978923678 4:114217180-114217202 CTGCAGCCTCCCCTGTGCTGTGG + Intergenic
980998192 4:139801862-139801884 CAGCAGCCTGCCCTGTACTTAGG - Intronic
982265077 4:153530998-153531020 CTGCAGCCTGACTCTGGCTGAGG + Intronic
982266430 4:153542384-153542406 CTGCAACGTGGCCCTTGCTGAGG - Intronic
983186322 4:164705205-164705227 CGGCAGCCTGCACTTGTCTGGGG - Intergenic
983376517 4:166935270-166935292 AGCAAGCCTGCCCTTTGCTGAGG - Intronic
984227054 4:177047523-177047545 ATGCACACTGCCCTCTGCTGGGG + Intergenic
987981702 5:25094440-25094462 CTGCAGCCTGCCCCCTACAGTGG + Intergenic
988732130 5:33982887-33982909 TTAAAGCCTGACCTTTGCTGGGG - Intronic
990063495 5:51681971-51681993 CTAAAGCCTGACTTTTGCTGAGG - Intergenic
990198778 5:53347867-53347889 CTGCAGCCTCTCCTTTGCCTTGG - Intergenic
990302193 5:54460077-54460099 CTCCATCCTGCCCTTTGCCCTGG - Intergenic
990359926 5:55007784-55007806 TGGCAGCCTGCCCTTTCCTCTGG - Intronic
990548273 5:56845436-56845458 ATGCATCCTGCCCTTATCTGGGG - Intronic
992748032 5:79837959-79837981 CTGGATCCAGCCCTTAGCTGGGG - Intergenic
993843782 5:92914074-92914096 CTGCATCCTGCTCTCTGCTCTGG - Intergenic
994207305 5:97049738-97049760 CTGCTACATGTCCTTTGCTGTGG - Intergenic
994277485 5:97855835-97855857 TGGCAGCCTGCCCTTTCCTCGGG - Intergenic
994760009 5:103840590-103840612 TTGCAGCATGTACTTTGCTGGGG + Intergenic
998133152 5:139661098-139661120 CTGCAGCCTCCCCTTTTCAGAGG + Intronic
998804403 5:145904505-145904527 CTGCAGCCTGGACTTGGCTCTGG + Intergenic
998879670 5:146633393-146633415 CTGCAGGCTGCCGTTTGAGGAGG + Intronic
999251714 5:150186384-150186406 CTGCAGCTCACCCTTTGATGTGG - Intergenic
999372441 5:151064116-151064138 CTGCAGGCAGCCCTTTGCCCTGG - Intronic
1000463515 5:161548795-161548817 CCGCTGCCAGCGCTTTGCTGTGG + Intronic
1001759800 5:174197924-174197946 CTGCTGCGTGGCCTTGGCTGTGG - Intronic
1001926286 5:175639604-175639626 CTGCTCCCTGCCCCTTGTTGGGG - Intergenic
1002065055 5:176647716-176647738 CTGCGCCTTGCCCTGTGCTGGGG + Intronic
1004108577 6:12690620-12690642 ATGTAGCCTGCCCCTTTCTGAGG - Intergenic
1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG + Intergenic
1006980581 6:38144727-38144749 CTGCAGCCCTCCCTGGGCTGTGG + Intronic
1007409159 6:41651786-41651808 CTGCAGCCCTCCGTGTGCTGGGG - Intronic
1007429309 6:41767539-41767561 CTGGATCCTGTCCTTTCCTGAGG + Intergenic
1008130038 6:47710769-47710791 CTGCAGCCAGCCCTGTGCTAAGG + Exonic
1008386498 6:50897358-50897380 CTGCAGCCTGCCCAGTGTGGTGG - Intergenic
1010185101 6:73134785-73134807 CCGCAGCCTGTCCTGTGCTAAGG + Intronic
1012602694 6:101117455-101117477 CTGCAGCATGACCTTGGCTGTGG - Intergenic
1012985895 6:105876116-105876138 GTGCAGCCTCCCCTTTGTTCTGG + Intergenic
1013007670 6:106089027-106089049 CTGCAGCAGCTCCTTTGCTGGGG + Intronic
1013296012 6:108759057-108759079 CTACGGCCTGCCCTTATCTGAGG + Intergenic
1013586183 6:111581119-111581141 CAGCAGGCTGCCCTTCCCTGGGG - Intronic
1013831548 6:114278854-114278876 CTGCATTCTGTCGTTTGCTGTGG - Intronic
1014145080 6:117988155-117988177 CTGTACCCTGCTCTTTGCTGGGG - Intronic
1014659257 6:124147159-124147181 CCGCAGCATGCCCCATGCTGTGG - Intronic
1017125281 6:151059029-151059051 CTCCAGCCTGCCCCTCACTGAGG - Intronic
1017158842 6:151346473-151346495 TTGCAGAATGCCCTTCGCTGTGG + Intronic
1017211563 6:151862685-151862707 CTGCTGCTTGTTCTTTGCTGGGG + Intronic
1017664241 6:156703786-156703808 CAGCAGCATTCCCTGTGCTGTGG - Intergenic
1018693525 6:166370058-166370080 CTGCACCCTGGCCTGTCCTGGGG - Intronic
1018792113 6:167156910-167156932 CTGCTGCCTGCCCTTTGCCTCGG + Exonic
1018907675 6:168084895-168084917 CTGCTGCCAGCCCCCTGCTGTGG - Intergenic
1019409246 7:899474-899496 CGGAAGCCTTCCGTTTGCTGTGG + Exonic
1019883797 7:3886031-3886053 CTGCTGCCTTCCCTTCCCTGTGG - Intronic
1020097567 7:5377266-5377288 CTCCTGCCTGCCGTTTCCTGGGG - Intronic
1020570642 7:9856546-9856568 CTGCAGCTTCTCCATTGCTGCGG + Intergenic
1021520937 7:21538483-21538505 TGGCAGCCTGCCCTTTCCTCTGG + Intergenic
1023568428 7:41548209-41548231 CTGCAGCCTGTGCTTGGCTAAGG + Intergenic
1023982420 7:45077791-45077813 CTGCTGCCTGCCCTGGCCTGGGG - Intergenic
1027628650 7:80575324-80575346 CTGCATCCTGCCCTTTGGGTAGG - Intronic
1029285911 7:99466007-99466029 GAGCTGCCTGCCCTTTGCTCAGG - Intronic
1032197504 7:129797838-129797860 CGGCAGCCAGCGCTTTTCTGGGG - Intergenic
1033105604 7:138519391-138519413 TTGCAGACTGCCATTTGATGAGG - Intronic
1035067359 7:156116735-156116757 CTGCACAGTCCCCTTTGCTGTGG - Intergenic
1035073119 7:156159271-156159293 CCTCACCCTGCCCTTGGCTGGGG + Intergenic
1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG + Intergenic
1035260179 7:157656222-157656244 CTGCACCCTGCCCGCTGCAGAGG - Intronic
1035496882 7:159335626-159335648 CTGCCGCCTCACCTTGGCTGGGG - Intergenic
1036470690 8:9049915-9049937 CTGCAGGCTGCCCTTGGCATGGG - Intronic
1037116583 8:15236306-15236328 CTGCAGCCTGTCCTGTGCCCTGG - Intronic
1037198497 8:16221308-16221330 TGGCAGCCTGCCCTTTCCTCTGG - Intronic
1037536516 8:19829426-19829448 CTGTAGCCTTCTCTTTTCTGTGG + Intronic
1037582409 8:20253425-20253447 CTGAAGCCTGGCCTGTGCTCTGG - Exonic
1038327772 8:26585596-26585618 CTGCACCTTGTCATTTGCTGGGG + Intronic
1038391967 8:27210236-27210258 CTGCAGCCTGGCCTTTTTGGAGG + Intergenic
1038416037 8:27396859-27396881 GTGCAGCATGCCCTTCCCTGCGG + Intronic
1041362089 8:57065211-57065233 CTGCAGCCTGCCCCTTGCCAAGG - Intergenic
1041545581 8:59038889-59038911 CTGCAGCCTGCCCCGCGATGCGG + Intronic
1041804851 8:61838843-61838865 ATGCAGCCTGGCTTTTTCTGAGG - Intergenic
1042566488 8:70117178-70117200 CTGCAACCAGCCCTGTGGTGCGG - Intronic
1045912148 8:107423361-107423383 CTGCAGATTGCCCTTAGCTAAGG + Intronic
1048261262 8:132947080-132947102 CTCAAGCCTGCACCTTGCTGAGG + Intronic
1049305046 8:141898248-141898270 CTGCAGCCTGCCCAGAGGTGGGG + Intergenic
1049755499 8:144309669-144309691 CCCCAGCCTGCCCCTTCCTGAGG + Intronic
1049790424 8:144469855-144469877 CTGCCCACTCCCCTTTGCTGGGG + Intronic
1050378332 9:4997003-4997025 CTGCAGCCTTGCCTTCCCTGGGG + Intronic
1053431487 9:38044608-38044630 GTGCTGCCTGCCTTTTGGTGTGG - Intronic
1053508786 9:38669318-38669340 CTGCAGCCGGGGCTCTGCTGTGG - Intergenic
1054822332 9:69535582-69535604 CTGCCTCCTGCCCTTTTCTCTGG + Intronic
1056338898 9:85604032-85604054 CTGGAACCTGCCCTGGGCTGAGG + Intronic
1056800411 9:89686942-89686964 CTGTACCCTGCCCTGTGCTATGG + Intergenic
1056829770 9:89906319-89906341 CAGCAGGCTCCCCTTTTCTGAGG + Intergenic
1057478214 9:95423139-95423161 CTCCTGCCTGACCTTTTCTGTGG - Intergenic
1057479044 9:95429733-95429755 CTGCAGCCTTCCCAATCCTGAGG + Intergenic
1058753960 9:108066854-108066876 CTCCACACTGCCCTTTGCAGGGG - Intergenic
1060518848 9:124282596-124282618 CCCCAGCCTGGCCCTTGCTGTGG - Intronic
1061907060 9:133704214-133704236 CTGGAGCCTGGCCTGGGCTGTGG + Intronic
1061914279 9:133741167-133741189 CTGCAGGCTGCCCTCTGACGGGG + Intergenic
1062289565 9:135788515-135788537 CTACAGCCAGCCCTTCCCTGTGG + Intronic
1062407757 9:136404988-136405010 GTGCAGCCTGCCCTTGGGAGCGG - Intronic
1062682468 9:137789144-137789166 CCGCAGCCTCCCGTTTCCTGTGG + Intronic
1062699738 9:137892655-137892677 CGGGAGGCTGCCCTGTGCTGGGG - Intronic
1187735565 X:22300375-22300397 CACCAGACTGGCCTTTGCTGAGG + Intergenic
1189063148 X:37776241-37776263 CTGAAGCCTGTGCTCTGCTGGGG - Intronic
1189266611 X:39721548-39721570 AAGCATCCTGCCCTTTTCTGGGG + Intergenic
1190337425 X:49270601-49270623 CTTCCAGCTGCCCTTTGCTGAGG + Exonic
1191863126 X:65682173-65682195 CTGAAGCCTGCCATGTACTGTGG + Intronic
1192382688 X:70635306-70635328 CTGCCGCCAGCCCATTGTTGTGG - Intronic
1194072308 X:89340815-89340837 CAGCAGCCTGCCTCTTGCAGAGG + Intergenic
1198060630 X:133042421-133042443 CTCCCGCCTTCCCTTGGCTGAGG + Intronic
1199489988 X:148387485-148387507 CTGTGGCCACCCCTTTGCTGGGG - Intergenic
1199589196 X:149450895-149450917 CGGCAGCCTGCCCCTTCCTCTGG + Intergenic
1200065258 X:153501724-153501746 CTCCAGCCTGCCCACTGCTTGGG + Intronic
1200726550 Y:6676566-6676588 CAGCAGCCTGCCTCTTGCAGAGG + Intergenic
1200727702 Y:6692342-6692364 CAGCAGCCTGCCTCTTGCAGAGG + Intergenic