ID: 901213572

View in Genome Browser
Species Human (GRCh38)
Location 1:7540442-7540464
Sequence CCAGGAAAGCAGCTCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901213559_901213572 21 Left 901213559 1:7540398-7540420 CCATGAGCTCCTGGCTGAGTTTC 0: 1
1: 1
2: 3
3: 52
4: 306
Right 901213572 1:7540442-7540464 CCAGGAAAGCAGCTCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 291
901213562_901213572 -8 Left 901213562 1:7540427-7540449 CCTGCCACCCCCCACCCAGGAAA 0: 1
1: 0
2: 11
3: 76
4: 802
Right 901213572 1:7540442-7540464 CCAGGAAAGCAGCTCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 291
901213560_901213572 12 Left 901213560 1:7540407-7540429 CCTGGCTGAGTTTCTGAAATCCT 0: 1
1: 0
2: 1
3: 33
4: 287
Right 901213572 1:7540442-7540464 CCAGGAAAGCAGCTCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901213572 Original CRISPR CCAGGAAAGCAGCTCCTGCT GGG Intronic
900208165 1:1440302-1440324 CCAGGAGGGCAGCACCTGCTGGG + Exonic
900375119 1:2350697-2350719 CCTGGAGGGCACCTCCTGCTGGG - Intronic
900625650 1:3607388-3607410 CCCTGAAAGCAGCTCCTGGATGG + Intronic
900738827 1:4317958-4317980 CAGGGAAAGAAGCTCCTGCATGG - Intergenic
900744269 1:4350778-4350800 CCAGGAAAGGAGGTACTGCCTGG - Intergenic
901213572 1:7540442-7540464 CCAGGAAAGCAGCTCCTGCTGGG + Intronic
901455616 1:9361296-9361318 CCAAGAAAACAGATCCGGCTGGG - Intronic
901684456 1:10935861-10935883 CCATGGAAGCAGCTCCCTCTTGG - Intergenic
902690851 1:18109466-18109488 CTAGGTAGGCACCTCCTGCTGGG - Intronic
903540527 1:24093819-24093841 CCAGGGAGGCTGCACCTGCTGGG - Intronic
903734936 1:25523941-25523963 CCAGGAAAGCCAGTCCTGCCTGG - Intergenic
903743694 1:25573071-25573093 CCCGCAAAGCAGCCCCTGTTTGG - Intergenic
903839029 1:26225310-26225332 CCTGCAAAGCAGTTCCTGCCGGG + Intergenic
904627569 1:31815524-31815546 CCAGGACACCAGCTCCTGCTGGG - Intronic
904870260 1:33613188-33613210 TCAGGGAAGAAGCTACTGCTGGG - Intronic
905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG + Intergenic
905859994 1:41344039-41344061 AGAAGAAAGCAGCGCCTGCTCGG + Intergenic
906673584 1:47677445-47677467 CTTGGAAAGCTGCTCCTGCGTGG - Intergenic
906757308 1:48330604-48330626 CCAGGCAGGCAACACCTGCTAGG + Intronic
908119338 1:60971086-60971108 CCATGACAGAACCTCCTGCTTGG + Intronic
910533967 1:88275141-88275163 CCAGGAAAGAAGCTCCATTTTGG + Intergenic
912515755 1:110215645-110215667 CCAGGAAGGCAGCTCCAGCAGGG + Intronic
915523483 1:156462457-156462479 GGAGGAAAGCAGATCCGGCTTGG - Intergenic
915534800 1:156528897-156528919 ACGGGAAAGCAGCACCTACTTGG + Exonic
916022775 1:160808436-160808458 CCAGGGAGGGAGCTCCTGCTGGG - Intronic
917678264 1:177340632-177340654 CCAGGCAGGCAGCTCCCTCTGGG + Intergenic
917788768 1:178486627-178486649 CCAGGATAGCAGCACCCCCTGGG - Intergenic
919038594 1:192350521-192350543 GCAGGAAAGGAGCAGCTGCTTGG + Intronic
920336388 1:205247991-205248013 CCAGGGAAGCAGCTCAGCCTTGG + Intronic
920828349 1:209443423-209443445 CCTGGAAAGAAGCCCCTGCTGGG - Intergenic
920837202 1:209522188-209522210 ACAGAAAAGCAGCCCCTGATGGG - Intergenic
922162007 1:223084939-223084961 CCAGGAGATCAGCTCTTGCCAGG + Intergenic
922562398 1:226578741-226578763 CCAGGGAAGCAGCCGCTGCAGGG - Intronic
924813752 1:247425198-247425220 CCAGGAGAGGACCTCCTACTTGG + Exonic
1062906545 10:1183407-1183429 GCAGAAAAGGAGCTTCTGCTAGG + Intronic
1063327776 10:5122201-5122223 CCAGGACAGCAGCTTCTACCTGG + Intronic
1063342065 10:5275272-5275294 CCAGGACAGCAGCTTCTTCCTGG + Intergenic
1063964694 10:11337893-11337915 CTCAGAAAGCAGCTCCTGCCCGG - Intergenic
1064064946 10:12173769-12173791 CCCGGAGAGCAGCTGCTTCTGGG + Exonic
1064107424 10:12511772-12511794 CCAGGAGAGCCGATCCTTCTGGG - Intronic
1064229820 10:13520296-13520318 CTGGGAAAGCCCCTCCTGCTGGG - Intronic
1065774443 10:29106395-29106417 CCAGGTAAACAGAACCTGCTTGG + Intergenic
1065893328 10:30139358-30139380 CCAGGAGAGCAACTCCTCATTGG + Intergenic
1067037059 10:42928373-42928395 CCAAGAAAGGAGGTCCTGCGAGG - Intergenic
1069820424 10:71224134-71224156 CCAGGAAAGCCGGGGCTGCTGGG + Intronic
1069820445 10:71224270-71224292 CCAGGAAAGCCGGGGCTGCTGGG + Intronic
1070663769 10:78328965-78328987 CCAGAAAGACAGCTCATGCTGGG - Intergenic
1071498652 10:86188405-86188427 CCAGGAGAGCAGCCCTTGCTAGG + Intronic
1073897567 10:108181031-108181053 GCTGGAAAACAGCTCCTGGTTGG + Intergenic
1074096618 10:110318853-110318875 CAAGGCAAACAGCTCCAGCTGGG + Intergenic
1074284219 10:112082692-112082714 TCAGGAGAGCAGTTCCTTCTGGG - Intergenic
1074887537 10:117705778-117705800 CCAGGAAGCCAGCTCCTCTTTGG - Intergenic
1075155760 10:119974680-119974702 CCAGGACAGTGGCTGCTGCTGGG + Intergenic
1075219882 10:120575758-120575780 CCAGGCTTGCAGCTGCTGCTTGG - Intronic
1075724395 10:124604084-124604106 CATGGGAAGGAGCTCCTGCTCGG + Intronic
1076406270 10:130214287-130214309 TCAGGAAAACAGCTGCTGCTGGG - Intergenic
1076467114 10:130690570-130690592 CCAGGATCCCAGTTCCTGCTGGG + Intergenic
1076768124 10:132648148-132648170 GAAGGAAAGCAGCCCCTGTTGGG + Intronic
1076821786 10:132943250-132943272 GCCGGAAAGCAGCCCCGGCTGGG - Intergenic
1076842554 10:133052919-133052941 CAGGGAAGGCAGCTCATGCTTGG + Intergenic
1077330257 11:1981030-1981052 CCAGGAAAGCAGGTCTTGATGGG + Intronic
1077707897 11:4505743-4505765 CCTAGAAAGCAGCACCTTCTGGG - Intergenic
1077930633 11:6728647-6728669 CCAGGAAGCCATCTCCAGCTTGG + Intergenic
1079074642 11:17376651-17376673 CCAGGAAAGCATTTCCTCCCTGG + Exonic
1080734587 11:35000428-35000450 CCAGAATAGCAGCCCCAGCTTGG - Intronic
1081811345 11:45915807-45915829 CCATGTCAGCAGCTTCTGCTGGG + Exonic
1081837947 11:46173508-46173530 CCAGGACAGCAGTTACTTCTGGG + Intergenic
1082083865 11:48033159-48033181 CAAGGAAAGCCCCTCCTGGTGGG + Intronic
1083678707 11:64341666-64341688 CCGGGACAGCATCTCCAGCTCGG - Exonic
1083838286 11:65287169-65287191 AAAGGAAAGCAGCTGCTGTTAGG + Intronic
1084672482 11:70615502-70615524 CCTGGAAAGCAGCTCCTCCTGGG - Intronic
1084706565 11:70819385-70819407 CCACGAAAGCTGCACCTGCAGGG - Intronic
1084998973 11:73011615-73011637 CCAAGAAGGGAGCTCATGCTGGG - Intronic
1085310123 11:75511256-75511278 CCAGGAAACTAGCTCTGGCTGGG + Intronic
1085340969 11:75731316-75731338 TCAGCACAGCACCTCCTGCTGGG - Exonic
1089294564 11:117459866-117459888 CAGGGAAAGCAGCAGCTGCTGGG + Intronic
1090012435 11:123057183-123057205 CCAGGAAAGCCTCTGCTCCTAGG + Intergenic
1091075161 11:132608723-132608745 CCAGGAAACCAGCCCCTCCTGGG + Intronic
1091306396 11:134538993-134539015 GCAGGGGAGCAGCTCCTGCCTGG + Intergenic
1202813236 11_KI270721v1_random:36209-36231 CCAGGAAAGCAGGTCTTGATGGG + Intergenic
1091452406 12:581502-581524 CCAGCAAAGCAGGTCCAGCCTGG + Intronic
1091912101 12:4240877-4240899 CCAGAGAAGGAGCTCATGCTGGG - Intergenic
1092263602 12:6965033-6965055 CCAAGGAAGCAGCTCCTGTTGGG + Intergenic
1092447958 12:8575154-8575176 ACAGGAAAGCAGCTTCGGGTAGG + Intergenic
1094720930 12:33063279-33063301 CCAGGAAGGGAGCTCATCCTGGG + Intergenic
1098745440 12:74232002-74232024 TTGGGAAAGCAGCTTCTGCTGGG - Intergenic
1100103797 12:91143420-91143442 CCAGGAATGCTGCTGCTTCTTGG - Exonic
1104888540 12:132126872-132126894 AGAGGCAAGCAGCTCTTGCTGGG - Intronic
1104949663 12:132433744-132433766 CCTGGTAAGCAGCGCCTGCCTGG - Intergenic
1107664284 13:42673058-42673080 CCAGGAAGGCAGTTTCTGCAAGG - Intergenic
1112693307 13:101918675-101918697 CCATGGAAGCAGCCACTGCTGGG + Intronic
1116371713 14:44143139-44143161 CCAGGAAAGCAGCTGCATATTGG - Intergenic
1117242568 14:53849634-53849656 CCAGGGGAGCATCTCCTGGTGGG + Intergenic
1117643834 14:57829671-57829693 CCAGGAAAGGAGCCACAGCTTGG - Intronic
1118760075 14:68875544-68875566 CCATGCAAGCAGCTCCAGCCTGG + Intronic
1118770708 14:68940902-68940924 CCAGGACAGAAGCTCCTGCTGGG - Intronic
1120782283 14:88495701-88495723 CCAGGACACCACCCCCTGCTCGG - Intronic
1120926636 14:89803710-89803732 CCAAGCAAGGAGCCCCTGCTGGG + Intronic
1121445776 14:93977927-93977949 CCAGGAAAGCAGCCCGGCCTCGG - Intergenic
1121799603 14:96763652-96763674 CCAGGAAAGTGTCTCCTTCTAGG - Intergenic
1123028538 14:105439847-105439869 CCAGGAAGGCAGCTTCTCCCAGG - Intronic
1125592181 15:40861655-40861677 CCAGGCAAGCACCTAATGCTGGG - Intergenic
1125791637 15:42371286-42371308 ACAAGACAGCAGCTCCTCCTGGG + Intronic
1125825840 15:42675710-42675732 GCAGGACAGCAGCCTCTGCTGGG - Exonic
1127327169 15:57906973-57906995 CCAGGTAAGAAGCTCCTGGAAGG - Intergenic
1128284542 15:66425545-66425567 GCAGGAAATCAGCTGCTTCTGGG + Intronic
1129016529 15:72474160-72474182 CCAGGAAAGCAATTCCCGCTCGG + Intergenic
1129113780 15:73353676-73353698 CCAGAGAGGCAGCTCCTTCTAGG - Intronic
1129513239 15:76140141-76140163 CCAGGAAAGCTGTTCCCGTTGGG + Intronic
1130536715 15:84790669-84790691 CCAAGAAAGCAGATCATGCAGGG - Intronic
1131035827 15:89221538-89221560 CCAGGTCGGCAGCTCCTCCTTGG + Exonic
1131377843 15:91940155-91940177 CAATGACAGCAGCTCCTGCCTGG + Intronic
1131575292 15:93583729-93583751 CCAGGGAAACAGCTCTGGCTGGG + Intergenic
1135727137 16:24863923-24863945 CCTGGAAAGCCCCACCTGCTGGG + Intronic
1136025446 16:27465448-27465470 CCAGGAAAACACCTGCAGCTTGG - Exonic
1136607503 16:31346335-31346357 CCAGGCCAGCAGCTTCTACTTGG + Intergenic
1137637892 16:50002923-50002945 CCAGGAAAGCAGCAACAGCCAGG - Intergenic
1137687123 16:50393802-50393824 CCTGGCAAGCAGCTTCTGCCAGG - Intergenic
1138738434 16:59279769-59279791 CCAGAGAAGGAGCTCATGCTGGG + Intergenic
1139346025 16:66304417-66304439 CCATGTAGTCAGCTCCTGCTCGG - Intergenic
1140432574 16:74917155-74917177 CCACCAAAGCAGCTCATGCCAGG + Intronic
1141622265 16:85242578-85242600 CCAGGACAGCCGTGCCTGCTGGG + Intergenic
1141629274 16:85277846-85277868 CCAGGACACCAGCTGCTGCTGGG + Intergenic
1141890945 16:86926135-86926157 GCAGGACAGCAGCTCCTGCAGGG - Intergenic
1143025913 17:3941971-3941993 CCAGGGAAGCAGGGCCTGCAGGG - Intronic
1146401467 17:32503291-32503313 CCAGGAAAGCGGGTCCTGGGAGG + Intronic
1146406356 17:32542047-32542069 CCAGGTTTGCAGCTCCTTCTAGG + Intronic
1151511180 17:74561148-74561170 GCAGGAACTCAGCTCTTGCTGGG + Intergenic
1151568968 17:74916528-74916550 CTTGGGAAGCAGCTCCTGCTGGG - Exonic
1152361346 17:79834529-79834551 CCAGGCAAGCAGGTCGGGCTTGG + Exonic
1152518486 17:80840171-80840193 GCAGGAAAGCGGCCACTGCTGGG - Intronic
1154376973 18:13818714-13818736 CCAGGCCCGTAGCTCCTGCTGGG - Intergenic
1157411406 18:47466044-47466066 TCATGTATGCAGCTCCTGCTTGG + Intergenic
1157804973 18:50651125-50651147 CAAGGAACGCAGGTGCTGCTGGG + Intronic
1159632347 18:70763642-70763664 CCAGCAAAGCTGCTCCCTCTGGG - Intergenic
1159721802 18:71899745-71899767 CCAGGCAGGCAACGCCTGCTTGG - Intergenic
1160087938 18:75796709-75796731 CCAGGAAAGCTGATTCTACTCGG + Intergenic
1160517496 18:79486643-79486665 CCAGGGGGGCAGCTACTGCTTGG - Exonic
1161146820 19:2683859-2683881 ACAAGAAAGGAGCTCCTGCAGGG + Intronic
1164438291 19:28251403-28251425 CCAGGAGAGCAGACCCTGGTGGG - Intergenic
1165136957 19:33675582-33675604 CCAGGAAACCAGCTCTTGCGTGG - Intronic
1165719812 19:38071096-38071118 CAAGGCAAGCAGGGCCTGCTTGG - Intronic
1166500751 19:43339417-43339439 CCAGGAAAGCAGAAACTTCTTGG - Intergenic
1166505212 19:43367100-43367122 CCAGGAAAGCAGAAACTTCTTGG - Intergenic
1166509345 19:43393995-43394017 CCAGGAAAGCAGAAACTTCTTGG + Intergenic
1166930300 19:46297991-46298013 CCAGCAGAGCTGCACCTGCTGGG - Intronic
1167203867 19:48086703-48086725 CCATGACAGCATCTCCTGGTAGG + Intronic
1167366823 19:49058789-49058811 GCAACAAACCAGCTCCTGCTTGG - Exonic
1167773477 19:51538506-51538528 CCGGGAAGGGAACTCCTGCTGGG - Intergenic
1168331114 19:55569503-55569525 TCAGGAAAGCAGGGCCTACTGGG + Intergenic
925022798 2:585100-585122 CCAGCAAAGCAGCACATCCTCGG + Intergenic
925421920 2:3719470-3719492 GAAAGAAAGCAGCTCCAGCTCGG - Intronic
925612001 2:5709380-5709402 CCAGGAAGGCAGCCCCGGCTGGG + Intergenic
925864524 2:8214939-8214961 CCAGAAAAGTAGCTCCTCATGGG - Intergenic
926238972 2:11070346-11070368 CCAGGAAAGGGGCTCCTGAATGG - Intergenic
927233540 2:20849126-20849148 CCTGGACAGCAGCTCTGGCTAGG - Intergenic
927707921 2:25308302-25308324 GCAGGAAAACAGCTCCTAGTTGG - Intronic
929094531 2:38250936-38250958 CCAGGCAGGCAGCTTCTGCATGG - Intergenic
930160899 2:48155501-48155523 CCAGAAAGGGAGCTCATGCTGGG + Intergenic
930420996 2:51152638-51152660 ACAGGAAAGCAGCTGGTGTTAGG + Intergenic
931873714 2:66489106-66489128 ACAGGAAAGCAGCTACTGGCTGG - Intronic
932320529 2:70819273-70819295 CCAGGAGAGAAGCTCATCCTAGG + Intronic
933463545 2:82620764-82620786 CCATGGAATCAGCTTCTGCTAGG - Intergenic
935025037 2:99268695-99268717 CAAGGATACCAGCACCTGCTTGG + Intronic
935193766 2:100798843-100798865 CCAGGAAGCCACCTGCTGCTGGG + Intergenic
935872543 2:107466912-107466934 CTGGGAAAGCAGCTCCTCGTGGG + Intergenic
936544929 2:113383226-113383248 GCAAGAAAACAGATCCTGCTGGG - Intergenic
937082444 2:119150026-119150048 CCAGGAACTCAGCTCCCACTTGG - Intergenic
937220972 2:120343305-120343327 CCTGGGAAGCACCTCCTGCATGG - Intergenic
937462442 2:122101203-122101225 CCTGGTTAGCAGCTCCAGCTGGG - Intergenic
938610676 2:132944845-132944867 CCAGGAAAGCAGTGACTTCTTGG - Intronic
939055383 2:137359226-137359248 CCTGGAAAGGAGCTACTTCTAGG + Intronic
940863225 2:158791347-158791369 ACAGGAGAGCAGTTCATGCTAGG - Intergenic
947997223 2:234538262-234538284 CTAAGGAAGCAGCTCCTTCTCGG + Intergenic
948131202 2:235601819-235601841 CCAGAAAAACAGGGCCTGCTGGG - Intronic
948237068 2:236399363-236399385 CCAAGACAGCAGCACGTGCTGGG - Intronic
948300304 2:236901326-236901348 CCAGGACAGCAGCTCCTGTGGGG + Intergenic
948778101 2:240300442-240300464 CCAGGAATGCAGCTGGTGTTGGG - Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1170435507 20:16323801-16323823 ACAGGACAGCAGCTTCTGTTAGG - Intronic
1173425761 20:42942117-42942139 ACAGGACAGCAGCTCCCCCTGGG - Intronic
1174100262 20:48121825-48121847 CTAGGACAGCAGCACCAGCTTGG - Intergenic
1174172979 20:48628522-48628544 CCAGGACAGCCCCTCCAGCTGGG - Intronic
1174421160 20:50399950-50399972 CCAGGAAGGAGGCTCCTGCAGGG - Intergenic
1175258652 20:57661764-57661786 GCAGGAAAGCAGCCCATCCTAGG + Intronic
1175548860 20:59802620-59802642 CGTGGAAGGCAGTTCCTGCTTGG + Intronic
1175895086 20:62332574-62332596 CAGGGAGAGCAGCCCCTGCTGGG + Exonic
1176164176 20:63664276-63664298 CCAGGACAGGAGTGCCTGCTGGG + Intronic
1176233298 20:64042624-64042646 CCAGGTGAGCAGGTCCTGCCCGG + Intronic
1177207149 21:18023256-18023278 CCTTGAGAGCAGCTCCAGCTGGG - Intronic
1178263585 21:31121954-31121976 TCAGGAAAGCAGCTCCCAGTTGG - Intronic
1178453615 21:32727604-32727626 CCGGGAAAGCGGCTCCTTCTCGG + Intronic
1179449783 21:41460508-41460530 CCAGGTCAGCAGCTGCCGCTGGG + Intergenic
1179652199 21:42818764-42818786 CCAGGAAAGGAGCCCTTACTGGG + Intergenic
1181068049 22:20315875-20315897 CCTGGATAGCAGCTCCTCGTGGG - Intronic
1182188903 22:28438595-28438617 TCAGGAAAGCTGCTGCTGATTGG - Intronic
1182748077 22:32621159-32621181 CCAGGAGAGCAGCTCCAGTCAGG + Intronic
1183498573 22:38164482-38164504 CCAGGCATGCAGGACCTGCTGGG + Intronic
1184428619 22:44428135-44428157 CCAGAAAGCCAGCGCCTGCTTGG - Intergenic
1184815106 22:46863050-46863072 CCAGGAGGGCAGCTCCTGCTGGG - Intronic
950704611 3:14772133-14772155 CCAAGGAAGCAGCTCCTCATTGG + Exonic
951628012 3:24687917-24687939 TGAGGAGAGCAGCTCTTGCTTGG - Intergenic
952246259 3:31595896-31595918 GCAGGAAAGCAGTTCTGGCTGGG - Intronic
953410711 3:42689113-42689135 CAGGGACTGCAGCTCCTGCTGGG - Intronic
953867370 3:46595926-46595948 TCAGATAAGCAGTTCCTGCTTGG - Intronic
954304979 3:49720873-49720895 CCAGGGAGGCAGCTGCTGCCTGG - Exonic
954328099 3:49874628-49874650 CAAGGGAAGCTGCTCCTCCTGGG + Intergenic
955722942 3:61902950-61902972 CAAGTAAAGCAGCCCCTGGTGGG - Intronic
956369592 3:68544149-68544171 CCTGGAAAGAGCCTCCTGCTTGG - Intronic
957504827 3:81106247-81106269 CCAGGCCATGAGCTCCTGCTGGG - Intergenic
957531286 3:81443381-81443403 CCAGGAAAGCAGCCCACCCTGGG - Intergenic
959767379 3:110047821-110047843 CCTGAAAAGCAGCTCCTGTTGGG - Intergenic
959778374 3:110199109-110199131 CCATGCAAGCAGATGCTGCTGGG - Intergenic
961049588 3:123735030-123735052 ACAGGAAAGAGGCTCCTGCTGGG + Intronic
961641815 3:128369486-128369508 CCTGGAAAGTAGCCCCTGCCAGG + Intronic
962084208 3:132173566-132173588 CCAGCACAGCTGCCCCTGCTTGG + Intronic
962085368 3:132185823-132185845 CCAAGAAAGAAGCAGCTGCTGGG + Intronic
964861314 3:161205158-161205180 TCAGGATAGCAGCTCCTCTTGGG + Intronic
965127502 3:164649505-164649527 CCAGGAAACCATTTCCTTCTAGG - Intergenic
966651015 3:182301161-182301183 CCTGGAAAGCAGCCCCAGGTAGG + Intergenic
966807818 3:183820114-183820136 CCAGCAAGGCAGGTCCTGCAGGG + Intronic
966934398 3:184696277-184696299 CCAGGAAAGGACCCTCTGCTGGG - Intergenic
967703285 3:192619824-192619846 TCAGGAAACCATCTCCTGCTGGG + Intronic
967993581 3:195150156-195150178 CCAGGAGTGCTGCTCGTGCTAGG + Intronic
970318776 4:14855287-14855309 CCATGAAGGCACCTCCTTCTAGG + Intergenic
971372299 4:26028884-26028906 CCAGGCACGCAGCACCTGCCGGG + Intergenic
972466465 4:39361751-39361773 TTAGGAAAGCAGTTCCAGCTGGG + Intronic
974776708 4:66492757-66492779 CCAGGAAAGCAGCTTGCTCTTGG - Intergenic
975362073 4:73482439-73482461 CAAAGAAAGGAGCTCCTTCTAGG - Intronic
975425199 4:74217098-74217120 CCAGGAAAGCAGATATGGCTAGG - Intronic
978960952 4:114677876-114677898 GCAGGAGAGCAGCTCCTGGTGGG - Exonic
978994046 4:115127863-115127885 CAAAGAAAGCACATCCTGCTAGG - Intergenic
979671016 4:123360237-123360259 CCAAGAATGCAGCTGCTGGTGGG + Intergenic
981424777 4:144590713-144590735 CCAGGAAGGCATCTCCTGAGAGG + Intergenic
983855452 4:172638375-172638397 CCAGGAAATAAGCTCCTGTAAGG + Intronic
985715607 5:1458024-1458046 CCAGCACAGCAGCCCCTCCTGGG - Intronic
986259860 5:6134754-6134776 CCAGGAAGGCAGCTGCTGGTGGG + Intergenic
986712675 5:10499325-10499347 CCTGGAGGGCAGCTCCTCCTAGG + Intergenic
987025334 5:13921283-13921305 CCAGGAATGCTGATCCTGCTGGG - Intronic
987879311 5:23721168-23721190 ACAGTAAAGCAACTCTTGCTGGG + Intergenic
989170196 5:38466005-38466027 CCAGGTCACCAGCTCCTCCTGGG - Intergenic
989383805 5:40835260-40835282 CCAGGGAAGCACTTCCTGCGGGG + Exonic
990730852 5:58807552-58807574 CCAGGAAGACAGCTCGTGCCAGG - Intronic
990740636 5:58908923-58908945 CCAGCAAAGCAGCTGCTGTGGGG + Intergenic
992027204 5:72681864-72681886 CCAGGGAGGGAGCTCGTGCTGGG - Intergenic
994444260 5:99853917-99853939 CCAGGAGAGCAAATACTGCTAGG + Intergenic
995434584 5:112120934-112120956 CCAGGAAAGCAGCCCTCACTAGG - Intergenic
996286188 5:121795785-121795807 AAAGGAAAACAGCTCCTCCTAGG + Intergenic
997781818 5:136667214-136667236 CCGGGAAGGAAGCTCCTGCTGGG + Intergenic
999961463 5:156760627-156760649 ACAGGGAAGCAGGTACTGCTGGG - Intronic
1000305782 5:159993381-159993403 CTTGGAAAGCAGCTCATCCTGGG + Intergenic
1001018780 5:168165364-168165386 CCAGGAGAGCAGCTCCTTTCTGG - Intronic
1001085405 5:168696727-168696749 CCAGGAAACCACTTCCAGCTGGG - Intronic
1001225117 5:169937723-169937745 CCAGGAGAGCAGTTACTACTGGG - Intronic
1002281045 5:178130450-178130472 CCTGGACAGCAGCGCCTACTGGG + Intergenic
1002281315 5:178131470-178131492 CCTGGACAGCAGCGCCTACTGGG - Intronic
1003223285 6:4180913-4180935 CCCTGAAACCAGATCCTGCTTGG + Intergenic
1004376778 6:15097324-15097346 CCAGGATAGCAGCCCCTCCCTGG - Intergenic
1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG + Intronic
1006839704 6:37020711-37020733 CCAGGAAATCATTTCCTCCTGGG - Exonic
1007407315 6:41642489-41642511 ACTGAGAAGCAGCTCCTGCTTGG - Intronic
1007839132 6:44701326-44701348 TCAGGCAAGCAGCCCCTTCTCGG + Intergenic
1013306487 6:108851474-108851496 CCAGGAAGGCTGCTCCTGTTGGG + Intronic
1013367907 6:109448845-109448867 CCAGCGTAGCAGCTCCTCCTGGG + Exonic
1015739014 6:136433523-136433545 CCAGGAAAGCAAAGCCTCCTTGG - Intronic
1016001178 6:139042841-139042863 CCAGGAGAGCTGCTTCTGCAAGG + Exonic
1017182047 6:151563460-151563482 CCAGGGATGCAGCTGCTCCTTGG + Intronic
1017190972 6:151652293-151652315 GCAGGGCAGCAGCTTCTGCTTGG + Intergenic
1017887747 6:158612869-158612891 CCAGTAAAGCAGTTCCCGCAAGG + Intronic
1017940767 6:159050927-159050949 CTAGGCACGCAGCTCCTGCCAGG + Intergenic
1018647685 6:165963370-165963392 TGAGGATAGCAGCTCCTACTAGG - Intronic
1018891361 6:167985618-167985640 CCACGAAACCAGCCCCTGATGGG + Intergenic
1019079646 6:169421648-169421670 CCAAGGAAGCAGCTCATCCTGGG + Intergenic
1019121914 6:169810789-169810811 CCGGGAAAGCATATCCTGCAGGG + Intergenic
1019633822 7:2064824-2064846 CCAGGACAGCGGCTTCTCCTAGG + Intronic
1019670977 7:2278178-2278200 CCTGGCCAGCAGCTCCTGCAGGG + Exonic
1020101469 7:5396641-5396663 GCAGCAAAGCACCTCCAGCTGGG + Intronic
1020462280 7:8439339-8439361 CCAGGAAAGCATCTCCCACAGGG + Intronic
1021160862 7:17271488-17271510 GCAGGAAAGTGGCTCCTTCTTGG + Intergenic
1022106190 7:27199606-27199628 CAAGCAATGCAGCCCCTGCTCGG - Exonic
1024098560 7:46006073-46006095 CCAGGAAAGGAGCCCCCACTAGG + Intergenic
1025249667 7:57343518-57343540 CCAGGAAGGAGGCTCCTGCAGGG + Intergenic
1028088580 7:86668910-86668932 CCAGAGAATAAGCTCCTGCTAGG + Intronic
1028343080 7:89746487-89746509 CCAGGGAAGAAGCTTCTTCTTGG + Intergenic
1029179043 7:98686052-98686074 CAAGGTGAGTAGCTCCTGCTGGG + Intergenic
1029903338 7:104065891-104065913 AGAGGAAAGCAGTACCTGCTTGG + Intergenic
1032075774 7:128835455-128835477 CCAGCCAAGCAGCCGCTGCTTGG - Exonic
1033042820 7:137933781-137933803 CCAGCAAATTAGCTCCAGCTGGG + Intronic
1034278895 7:149838275-149838297 CCCGGAACGCAGGTCCTGATTGG - Intergenic
1034821042 7:154216448-154216470 CCAGGAATAGAGCTCATGCTTGG + Intronic
1034989995 7:155542260-155542282 CAGGGAAAGCAAGTCCTGCTTGG + Intergenic
1036676543 8:10839015-10839037 CCTGAAAAGCGGGTCCTGCTTGG - Intronic
1037776571 8:21839471-21839493 CCAGGAAACCAGCTCCAGTGGGG - Intergenic
1039451110 8:37675678-37675700 CAAGGAAGGCAGCCCCTGCTCGG + Intergenic
1039809747 8:41035963-41035985 TCAGGAAAGCATTTCCTGATAGG + Intergenic
1040385637 8:46913263-46913285 CATGGAAAGCTGCTCATGCTGGG - Intergenic
1041119150 8:54569117-54569139 CCAGGAGAGCAAGTCCTGGTTGG + Intergenic
1042745072 8:72098444-72098466 CCTGCAAAGAAGCTCCTGCTGGG - Intronic
1044698267 8:94944414-94944436 CCAGGAAGGCAGCTTCTGCCTGG + Intronic
1049240415 8:141535034-141535056 CCAGGAAGCCAGCTCCAGATAGG - Intergenic
1049368536 8:142252521-142252543 CCATGCAGGTAGCTCCTGCTGGG - Intronic
1049720617 8:144113844-144113866 CCAGGAATCCAGCTGCTGGTTGG - Exonic
1049802660 8:144525372-144525394 CCAGGCAAGTGGCTGCTGCTTGG + Intronic
1050710634 9:8458630-8458652 AAAGGACACCAGCTCCTGCTTGG + Intronic
1052553920 9:29988192-29988214 CCAGGAGTTCAGCTCCTGCAGGG - Intergenic
1053507065 9:38652065-38652087 GGAGGATAGCAGCTGCTGCTAGG + Intergenic
1053593599 9:39536296-39536318 CCAGGAAGACAGGTCTTGCTGGG - Intergenic
1053851384 9:42291343-42291365 CCAGGAAGACAGGTCTTGCTGGG - Intergenic
1054572706 9:66828985-66829007 CCAGGAAGACAGGTCTTGCTGGG + Intergenic
1057253965 9:93528016-93528038 GCAGGAAACCGGCTCCTTCTTGG - Intronic
1057270087 9:93645654-93645676 CCAGGAAGTCAGCTCACGCTGGG + Exonic
1058444055 9:105038503-105038525 CCAGGAAAACAGCTCAGGGTAGG - Intergenic
1060015257 9:120081214-120081236 GCAGGAAGGCAGTTGCTGCTGGG - Intergenic
1060051852 9:120383605-120383627 CCAGAAAATGAGCTCCTACTCGG - Intergenic
1060538826 9:124415430-124415452 CCAAGAAAGCAGTTCCGGGTCGG + Exonic
1062059697 9:134488465-134488487 CCAGGGCAGCCGCCCCTGCTCGG + Intergenic
1062376198 9:136262960-136262982 CCAAGGATGCAGCTGCTGCTTGG + Intergenic
1062573452 9:137195859-137195881 CCAGGAAAGCAGCCCGGGCGTGG + Intronic
1189103227 X:38212187-38212209 CCAGGAATACAGCCCCTGCCTGG - Intronic
1189304209 X:39974437-39974459 ACAGGAAAGCAGCTGCTGGGGGG - Intergenic
1191762988 X:64664311-64664333 CCAGGCAGGCAACACCTGCTAGG + Intergenic
1193191074 X:78572115-78572137 CCAGGAAAGCAAGTTCTTCTAGG + Intergenic
1193990102 X:88296390-88296412 CCTGGAAAGCAGCCCATTCTGGG - Intergenic
1194827336 X:98578992-98579014 CCAGAGGAGCAGATCCTGCTAGG + Intergenic
1196998957 X:121416674-121416696 CCAGGGAGGAAGCTCATGCTTGG - Intergenic