ID: 901215213

View in Genome Browser
Species Human (GRCh38)
Location 1:7551137-7551159
Sequence AGACTGGGGTGGAGACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 413}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901215213_901215230 15 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215230 1:7551175-7551197 TGGGGCTTCCCTGCCCAGAGGGG 0: 1
1: 1
2: 4
3: 40
4: 454
901215213_901215228 13 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215228 1:7551173-7551195 CCTGGGGCTTCCCTGCCCAGAGG 0: 1
1: 0
2: 6
3: 55
4: 439
901215213_901215220 -4 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215220 1:7551156-7551178 GTCTCCACCCTAGCCACCCTGGG 0: 1
1: 0
2: 2
3: 14
4: 163
901215213_901215229 14 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215229 1:7551174-7551196 CTGGGGCTTCCCTGCCCAGAGGG 0: 1
1: 1
2: 4
3: 41
4: 377
901215213_901215236 29 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215236 1:7551189-7551211 CCAGAGGGGAGAAGCAAGGAAGG 0: 1
1: 1
2: 8
3: 85
4: 775
901215213_901215237 30 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215237 1:7551190-7551212 CAGAGGGGAGAAGCAAGGAAGGG 0: 1
1: 2
2: 9
3: 113
4: 1172
901215213_901215219 -5 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215219 1:7551155-7551177 AGTCTCCACCCTAGCCACCCTGG 0: 1
1: 0
2: 2
3: 26
4: 190
901215213_901215221 -3 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215221 1:7551157-7551179 TCTCCACCCTAGCCACCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 352
901215213_901215233 25 Left 901215213 1:7551137-7551159 CCTCCTGGTCTCCACCCCAGTCT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 901215233 1:7551185-7551207 CTGCCCAGAGGGGAGAAGCAAGG 0: 1
1: 2
2: 9
3: 53
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901215213 Original CRISPR AGACTGGGGTGGAGACCAGG AGG (reversed) Intronic
900407668 1:2499567-2499589 AGAATGGGGGGCAGAGCAGGTGG + Intronic
901215213 1:7551137-7551159 AGACTGGGGTGGAGACCAGGAGG - Intronic
901552764 1:10008268-10008290 AAAATGTGGTGGATACCAGGTGG - Exonic
901929809 1:12589947-12589969 AGATGGAGGTGGAGACCAGATGG - Intronic
902164550 1:14559713-14559735 AGAGTGGGGTGGAGACAGTGGGG - Intergenic
902171610 1:14616023-14616045 AAGCTGGGGTGGAGAGAAGGTGG + Intronic
902213122 1:14917779-14917801 AAACTGAGGTGGATACCAGGAGG - Intronic
902899612 1:19505648-19505670 AGCCTGGTGTGGAGTCCAAGCGG + Intergenic
903127897 1:21260196-21260218 AGGCTGGAGTGGAAGCCAGGGGG + Intronic
903176727 1:21585969-21585991 GCTCTGGGGTGGAGAGCAGGAGG + Intergenic
904250906 1:29223652-29223674 AGACTGGGGAGGACCACAGGAGG - Intronic
906040625 1:42785501-42785523 AGACGGGGGTGGGGGCGAGGAGG - Intronic
906523244 1:46479429-46479451 AGCCTGGGGTGGGGAACTGGGGG + Intergenic
906784163 1:48599710-48599732 AGACTGGGTTGGAGCCCAGCTGG + Intronic
908179813 1:61592543-61592565 TTACTGGGGTGGAGAGGAGGAGG + Intergenic
908633511 1:66136606-66136628 AGGCTGGGGTTGAACCCAGGAGG + Intronic
908724305 1:67158286-67158308 AAACTGGGGTTTAGCCCAGGAGG + Intronic
910160281 1:84265016-84265038 ATAGTGGGGTGGAGATGAGGAGG + Intergenic
911413937 1:97546879-97546901 AGAGGGGGATGAAGACCAGGAGG + Intronic
912452661 1:109776922-109776944 AGGCTGGGGTGGATCCCATGGGG + Intergenic
912802274 1:112727618-112727640 AGAGTAGAGTGGAGACCAGATGG - Intergenic
913253329 1:116930746-116930768 AGACTGGAGAGGAGACATGGAGG - Intronic
914331124 1:146671562-146671584 AGACTGGGGAGGGTACCAGCAGG + Intergenic
915282049 1:154829454-154829476 TGACTGGGCTGGAGAAAAGGTGG - Intronic
916078044 1:161214509-161214531 AGAAGGGGGTGGAGACGAGCAGG - Intergenic
916895864 1:169161214-169161236 AGACTGGGGCTTTGACCAGGAGG - Intronic
918645469 1:186899311-186899333 AGACTGGGAGGGAGACCGGGAGG + Intronic
920008751 1:202852625-202852647 GAACTGGGCTGGAGACAAGGGGG + Intergenic
920409856 1:205750438-205750460 ACTCTGGAGTGGAAACCAGGGGG - Intergenic
920660472 1:207910635-207910657 AGACTGGGGAGGAGAGAAGCAGG - Intronic
920747010 1:208638387-208638409 GGACTGGGTTGGAATCCAGGTGG - Intergenic
921584741 1:216933874-216933896 AGATGGGGGAGCAGACCAGGAGG - Intronic
923273395 1:232377027-232377049 GAGCTGGGGTGGAGACCAGGAGG + Intergenic
923542601 1:234899282-234899304 AGGCTGACGTGGAGGCCAGGCGG - Intergenic
923761049 1:236844408-236844430 AAAATAGGGTGGAAACCAGGGGG + Intronic
924451923 1:244186556-244186578 TGAGTGGGGTGGAGGCCAGGAGG - Intergenic
924814585 1:247430581-247430603 AGAATGGGTTGGAGGCCAGCTGG + Intronic
1062822530 10:545559-545581 AGAATGGGGTGAGGACCCGGAGG + Intronic
1063351870 10:5363744-5363766 AGACAGGAGAGGAGAGCAGGAGG - Intergenic
1063556793 10:7087977-7087999 GGACTTGGGCCGAGACCAGGAGG + Intergenic
1064384326 10:14877909-14877931 GGAGGGGGGTGGAGACCAGGTGG + Intergenic
1064557999 10:16566700-16566722 AGAATGGGGAGGAGACAACGGGG + Intergenic
1065925170 10:30428586-30428608 AGACTGATATGGAGAACAGGAGG + Intergenic
1066323289 10:34327395-34327417 AGACTGGGGTGGGATCCATGTGG - Intronic
1067053321 10:43037597-43037619 AGGGTGAGCTGGAGACCAGGGGG + Intergenic
1067309136 10:45095753-45095775 AGACTGATATGGAGAACAGGAGG - Intergenic
1067728333 10:48790566-48790588 AGGCTGGGGGGAAGAGCAGGAGG - Intronic
1069049600 10:63778549-63778571 AAACTGGGCTGCAGAGCAGGAGG + Intergenic
1069514960 10:69070134-69070156 AAGCTGGGGTGGACTCCAGGAGG - Intergenic
1069893670 10:71667305-71667327 AGACTGGGCTGGAGACAAGTAGG + Intronic
1070681727 10:78453586-78453608 ACCCTGGGATGGAGACCTGGAGG - Intergenic
1071488913 10:86122845-86122867 AGGGAGGGGTGGAGACAAGGGGG + Intronic
1072102607 10:92243627-92243649 AGACTGGGGTGGAGAGGAATAGG + Intronic
1073042155 10:100615128-100615150 AGTCAGGGGTTGAGATCAGGAGG - Intergenic
1073150879 10:101310633-101310655 AGCCTGGGGTGGAGCCGAGCGGG - Intergenic
1073632979 10:105167290-105167312 AGACTGGGGTGGTGCCCTCGTGG + Exonic
1075003409 10:118814058-118814080 AGACTGGGGAGGAAAGGAGGAGG - Intergenic
1075083251 10:119397631-119397653 AGCCTGGGATGGGCACCAGGAGG - Intronic
1075623606 10:123946235-123946257 AGACCATGATGGAGACCAGGAGG + Intergenic
1075652457 10:124137842-124137864 ATACTGGGGGGTAAACCAGGAGG + Intergenic
1076047030 10:127302303-127302325 AGAGTCGTGTGCAGACCAGGTGG + Intronic
1077122674 11:917526-917548 AGCCTGGGCTGGAGGCCAGGTGG + Intergenic
1077872103 11:6270949-6270971 GGACTGGGCTGGAGACTGGGGGG + Intronic
1078436919 11:11332933-11332955 AGACTGGGGAAGGGACCATGTGG + Intronic
1079224096 11:18589960-18589982 AGATGGGAGTGGAGACAAGGAGG + Intergenic
1079954905 11:26850395-26850417 AGCATGGGGTGGAGAGGAGGTGG - Intergenic
1079962041 11:26936404-26936426 AGACTGGAGAGGAGAGGAGGTGG + Intergenic
1081476135 11:43433440-43433462 AGAATCGGGAGGAGAACAGGAGG - Intronic
1081865154 11:46355669-46355691 AGAGTGGGGTGGGGCCCTGGGGG + Intronic
1082180157 11:49107062-49107084 AGAGTGGGGTGGGGGACAGGTGG + Intergenic
1083828309 11:65215523-65215545 AGTGTGGGGTGGAGTCCGGGAGG - Intergenic
1083955581 11:65981233-65981255 AGCCTGGGCTAGAGCCCAGGTGG + Intergenic
1083995141 11:66267906-66267928 AGACTGGGGTGGAGCCGGGAAGG + Intergenic
1084030154 11:66476336-66476358 TGACTGGGGTGGAGATCTTGGGG - Exonic
1084203221 11:67576161-67576183 AGCCGTGGCTGGAGACCAGGCGG - Intergenic
1084393022 11:68890920-68890942 AGGCTGGGGTTCAGAGCAGGTGG - Intergenic
1084461432 11:69298698-69298720 AGCAGGGCGTGGAGACCAGGAGG + Intronic
1084479966 11:69414402-69414424 AGAGAGAGGTGGAGAACAGGGGG - Intergenic
1084590272 11:70086134-70086156 AAACTGAGGTGGAAACCAGGCGG + Intronic
1084596031 11:70117592-70117614 AGGCTGACGTGGAGACCTGGGGG - Intronic
1085405028 11:76256654-76256676 AGGCGGGGGTTGAGCCCAGGGGG - Intergenic
1085772438 11:79337506-79337528 AGACTGGGGTAGTTACCAGAGGG + Intronic
1086177859 11:83913933-83913955 AGACTGTGGTGAAAACCAGTGGG + Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1089461384 11:118656247-118656269 GGACTGGGGTGGGCACCAGAGGG - Intronic
1089698062 11:120227858-120227880 AGTCTGGGGTGCAGGCCATGGGG - Intronic
1090732243 11:129581799-129581821 AGACTGAGGTGGAGAGCAGGAGG + Intergenic
1092279445 12:7088729-7088751 TGACTGTTGGGGAGACCAGGGGG + Exonic
1092680452 12:10974257-10974279 AGACTGGGGTGGGGTGCAGGTGG - Intronic
1092879571 12:12877553-12877575 GAACTGGGGAGGAGAGCAGGAGG + Intergenic
1092926951 12:13280060-13280082 AGAGTGGGGTGGGGAGCTGGGGG + Intergenic
1096218182 12:49809815-49809837 TGAATGGGGAGGAGACCAGTTGG - Intronic
1096465008 12:51843613-51843635 ACACTGGGCTGGGGACCATGTGG + Intergenic
1097263781 12:57734502-57734524 AGGCAGGTGTGGAGACCAGGGGG - Intronic
1097634174 12:62102054-62102076 AAGCTGAGGTGGAGAGCAGGTGG + Intronic
1099004360 12:77218587-77218609 AGACAGGGGTGGTGAGGAGGAGG - Intergenic
1100436154 12:94573286-94573308 AGATTGGGGTGCTGACCGGGTGG - Intronic
1100873037 12:98932110-98932132 AGACCAGGGAAGAGACCAGGGGG + Intronic
1101668361 12:106841905-106841927 AGACTGGGATGCACACCAGTAGG - Intronic
1102063314 12:109951977-109951999 GGACTGGGCAGGAGGCCAGGCGG + Intronic
1103156424 12:118689001-118689023 AGGCTGGGGAGGTGGCCAGGTGG + Intergenic
1103795378 12:123499633-123499655 AGGCTGGGGAGGAGGCCGGGGGG - Intronic
1104386125 12:128353143-128353165 GAAGTGGGGTTGAGACCAGGAGG + Intronic
1104803572 12:131570916-131570938 AGCCTGGGTGGGAGCCCAGGAGG + Intergenic
1105784305 13:23733456-23733478 AGACTGGGCTGGAATCCAGGAGG + Intronic
1106009081 13:25800743-25800765 AGGCATGGGTGGAGACAAGGAGG - Intronic
1106243562 13:27928378-27928400 AGGCTTGGGTGGAGCCCAGAGGG - Intergenic
1107938243 13:45363021-45363043 TGATTGGGGTGGAGACAGGGAGG - Intergenic
1107991511 13:45822844-45822866 AGGCTGGGGAGGAGGCCATGGGG - Intronic
1108241019 13:48464564-48464586 AGATTGGGGGGGATACCGGGAGG + Intronic
1108373222 13:49791901-49791923 AGAGGGGGGTGGGGACCAGCCGG - Intronic
1109182628 13:59231836-59231858 TGACAGAGGTGGAGATCAGGTGG + Intergenic
1112257702 13:97850022-97850044 ATACTGTTGTGGTGACCAGGTGG - Intergenic
1112700202 13:101999321-101999343 AGACTGGGTTAAAGACCAGAGGG + Intronic
1113636060 13:111919923-111919945 GGGCTGGGGCGAAGACCAGGTGG - Intergenic
1113676050 13:112208783-112208805 AGGCTGGGGTGGACACTTGGAGG + Intergenic
1113961736 13:114130154-114130176 AGTCTGGGCTGGAGACCCTGAGG - Intronic
1114593847 14:23894279-23894301 AGACTTGGTCAGAGACCAGGGGG - Intergenic
1116822093 14:49635544-49635566 AGAATGGGGTGAAACCCAGGAGG + Intergenic
1118561735 14:67092354-67092376 AGACAGGGGTAGAGAGAAGGAGG - Intronic
1119439107 14:74616418-74616440 AGCCCGGGGTGGAGGCAAGGCGG - Intergenic
1119843160 14:77808387-77808409 ATAGTGGGGTGGTCACCAGGAGG + Intronic
1120871343 14:89339814-89339836 AGCCTGGGCTGGAGGCCTGGGGG + Intronic
1120899942 14:89566958-89566980 AGAGTGGGGAGGAGAAAAGGAGG + Intronic
1122109562 14:99487929-99487951 AGACTGAATAGGAGACCAGGAGG - Intronic
1122289708 14:100673866-100673888 AGGTTGGGGTGGAGGCCTGGAGG - Intergenic
1122861736 14:104585535-104585557 ACACGGGGGTGGAGGCGAGGAGG + Intronic
1123129780 14:105975617-105975639 CGTCTGAGGTGGAGACCACGGGG - Intergenic
1202892806 14_KI270722v1_random:175604-175626 AGACTGATATGGAGAACAGGAGG - Intergenic
1123983456 15:25623818-25623840 AGAGCTGGGTGGAGGCCAGGGGG - Intergenic
1124153741 15:27207636-27207658 AAACTGTGGGGGACACCAGGGGG + Intronic
1124707967 15:31981256-31981278 AAACAGGGGTGGAGAGCAGATGG + Intergenic
1125027386 15:35044510-35044532 AGACTGGAGTAGAGACTATGCGG + Intergenic
1125444989 15:39744878-39744900 AGACTGGGGTCGTGATGAGGGGG + Intronic
1127260376 15:57322995-57323017 AGTCTGGAGGGGAGGCCAGGGGG - Intergenic
1127652651 15:61024186-61024208 AAACTGGGGTGGAAATCAGTTGG + Intronic
1127836918 15:62797576-62797598 AGACTGTGGTGGTGGCCATGGGG + Intronic
1128934387 15:71732907-71732929 AGACTGGGGAGGACAACAGCTGG + Intronic
1129109819 15:73330804-73330826 AGACTGGAGTGGGGACCAGGAGG + Intronic
1129375026 15:75124496-75124518 AGACTGAAGTGGTGCCCAGGAGG + Intergenic
1129801071 15:78414783-78414805 AGCCTGGGGAGCAGAGCAGGAGG + Intergenic
1129862268 15:78872302-78872324 AGGCTGGGCTGGAGAAGAGGAGG + Intronic
1130096571 15:80860716-80860738 AAACTGGGGTGCAGGCAAGGTGG - Intronic
1130549973 15:84884236-84884258 AGATTGGGGTGGAGACCCCAGGG - Intergenic
1130938154 15:88487499-88487521 AGGCTGGGGTGGACTGCAGGTGG + Intergenic
1131338076 15:91569875-91569897 AGACTGGGGTAAAGACCTAGAGG - Intergenic
1131990509 15:98088661-98088683 AGACTTGGGTGGTGACCCTGGGG - Intergenic
1132089170 15:98933824-98933846 AGACTGAGGGAGAGACCCGGTGG - Intronic
1132868700 16:2106033-2106055 AGAGGGGGGTGGTGAGCAGGTGG + Intronic
1133396071 16:5448561-5448583 AGACTGGGGTGAAGACCCCATGG + Intergenic
1134110861 16:11514667-11514689 AGGCTGGGGAGGAGACCCTGAGG + Intronic
1134522885 16:14926626-14926648 AGAGGGGGGTGGTGAGCAGGTGG - Intronic
1134549742 16:15133432-15133454 AGAGGGGGGTGGTGAGCAGGTGG + Intronic
1134651316 16:15911151-15911173 AGGCTGAGGTGGAGCCCAGAAGG + Intergenic
1134710553 16:16325277-16325299 AGAGGGGGGTGGTGAGCAGGTGG - Intergenic
1134718723 16:16369565-16369587 AGAGGGGGGTGGTGAGCAGGTGG - Intergenic
1135015930 16:18925678-18925700 GGCCTGGGGTCGGGACCAGGAGG - Intronic
1135759571 16:25126306-25126328 AAACTGGGGAGGAGGCCAGAGGG - Intronic
1136007607 16:27341706-27341728 AGAAAGGGGTGGAGACAAAGAGG + Intronic
1136043601 16:27599193-27599215 AGCCTGGGATGGAGGCCAGCAGG + Intronic
1137821489 16:51449662-51449684 AGACTGTGGGGGAGGCCTGGGGG - Intergenic
1139354819 16:66361212-66361234 TGGCTGGGGAGGAGGCCAGGTGG - Intergenic
1139369122 16:66454890-66454912 AGACTGGGGAGCAGAGCTGGTGG + Intronic
1139710850 16:68774735-68774757 GCACTGGGGAGGACACCAGGAGG + Intronic
1140002430 16:71039342-71039364 AGACTGGGGAGGGTACCAGCAGG - Intronic
1140437472 16:74959346-74959368 AGACGGTGGAGGAGATCAGGTGG - Intronic
1141284392 16:82658193-82658215 AGCCTGGGATGATGACCAGGAGG - Intronic
1141524772 16:84604242-84604264 AGTGTGGGGTGGGGAGCAGGGGG - Intronic
1141568389 16:84918902-84918924 AGACTGGGGTGGTGGCCACTGGG + Intronic
1141899810 16:86983794-86983816 AGGCTGGGGTGGAGGCTGGGAGG + Intergenic
1142714941 17:1742252-1742274 AGACTGGGATGGAAGGCAGGGGG - Intergenic
1142861311 17:2763750-2763772 AGATGGGGGTGGAGAGCGGGAGG + Intergenic
1143359087 17:6352922-6352944 AGACTGGGGTGATGAACATGGGG - Intergenic
1143386703 17:6535221-6535243 AGCCTGGGCTGGAGAGCAGAGGG + Intronic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1143908567 17:10228890-10228912 GGACTAGGGTGGAGTGCAGGAGG - Intergenic
1144764408 17:17724925-17724947 AGACTGGGGCGCAGGGCAGGGGG - Intronic
1146055702 17:29579961-29579983 AGACTGGGATAGAGACGAGCTGG - Intronic
1146263016 17:31433870-31433892 AGGCAGGGATGGAGCCCAGGCGG - Intronic
1146373821 17:32281276-32281298 AGATTGAGGGGGAGAGCAGGTGG + Intronic
1147198054 17:38780812-38780834 AGACTGGGATGAAGAGCAGGTGG - Intronic
1147261449 17:39211725-39211747 TGACAGAGGTGGAGACCAGGAGG + Exonic
1147582972 17:41637181-41637203 AGACTGAGGGGGAGTCAAGGTGG - Intergenic
1148041056 17:44707670-44707692 AGACCTGGGGGGAGAACAGGTGG + Intergenic
1148863761 17:50618154-50618176 AGCCAGGGCTGGAGACCAGGGGG + Intronic
1149232582 17:54553002-54553024 AACCTGGGGTGGAAACCAGGTGG - Intergenic
1149586349 17:57790183-57790205 ATACCTGGGTGGATACCAGGCGG + Intergenic
1149710936 17:58741491-58741513 AAACTGGGTTGCAGAGCAGGAGG + Intergenic
1151583042 17:74990918-74990940 AGACAGGAGGGAAGACCAGGTGG - Intronic
1152291551 17:79442757-79442779 AGACTGGGGTGGGGGTGAGGAGG + Intronic
1152516696 17:80829301-80829323 AGACGGGGCTGGTGTCCAGGAGG + Intronic
1152523666 17:80875265-80875287 ACAATGGGGCAGAGACCAGGAGG - Intronic
1152557192 17:81059237-81059259 AGACTGGGGAGGAGAGGAGGAGG + Intronic
1152657358 17:81526194-81526216 AGGCTGAGGAGGAGCCCAGGCGG - Intergenic
1152781871 17:82230351-82230373 AGTCTGGGGTGGGCACCTGGAGG + Intronic
1153678378 18:7476674-7476696 AGACGGGAGGGGAGAGCAGGGGG - Intergenic
1154160400 18:11977037-11977059 AGACTGTGGTGGAGGCCAGCTGG + Intergenic
1156444560 18:37225805-37225827 AGCCTGGGTTGGGGAACAGGGGG - Intronic
1156470287 18:37373551-37373573 TGACTGGGGTGAAGATCAAGTGG - Intronic
1156528195 18:37788449-37788471 AGACTGGAATGGAGAACAAGAGG + Intergenic
1156911136 18:42412379-42412401 AGACTGGGATGGAGGGCAGAAGG - Intergenic
1157134032 18:45036694-45036716 AGACTGGAATGGAGAATAGGAGG + Intronic
1157161987 18:45321962-45321984 AGAATGGGGTGGAGACATGCTGG + Intronic
1160200468 18:76791862-76791884 AGACTGACATGGAGAACAGGAGG - Intergenic
1160808091 19:1001242-1001264 AGAGCCGGGTGGGGACCAGGAGG - Intronic
1161328323 19:3673818-3673840 AGGCTGGGGTGGGGACCCGGAGG + Intronic
1161392516 19:4028739-4028761 AGCCCGGGGTGGAGCCCAAGAGG + Exonic
1161518905 19:4712834-4712856 TGACCGAGGTGGACACCAGGTGG - Intronic
1162381903 19:10336037-10336059 GGACTGGGGAGGAGACAGGGTGG + Intronic
1163163479 19:15479656-15479678 AGAGGGGCCTGGAGACCAGGTGG + Exonic
1164207908 19:23073241-23073263 AGGCTGGAGGGAAGACCAGGTGG + Intergenic
1164297559 19:23926522-23926544 AGGCTGGAGTGCAGCCCAGGTGG - Intronic
1164417246 19:28057510-28057532 AAACTGGGTTGGACACAAGGAGG + Intergenic
1164456767 19:28414171-28414193 AGAATGGGATGGTGAGCAGGTGG - Intergenic
1164589270 19:29497388-29497410 ATTCTGGGGTGGAAAGCAGGAGG + Intergenic
1165317440 19:35065461-35065483 GGAATGGGGTGGGCACCAGGAGG + Intronic
1165810158 19:38607205-38607227 GCTCTGGGGTGGAGAGCAGGTGG + Intronic
1166253552 19:41586934-41586956 AGACTGGGGTTGAGATAAGGTGG - Intronic
1166257819 19:41618903-41618925 AGACTGTGGTTGAGACAAGGTGG + Intronic
1166380146 19:42351409-42351431 CGCCTGGGGTGGGGAGCAGGGGG - Exonic
1166410477 19:42553052-42553074 AGACTGGGGTTGAGAAAAGGTGG + Intronic
1166641358 19:44497747-44497769 AGGATGGGGTGAACACCAGGGGG - Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166809262 19:45506207-45506229 AGAGTGGGGTGGAGAAGGGGAGG + Intergenic
1166939088 19:46352125-46352147 ACACTGGGGCTGAGACCTGGAGG - Intronic
1167112615 19:47471097-47471119 AGACAGAGATGGAGACGAGGGGG + Intronic
1167286505 19:48601400-48601422 AGGCTGGGGTGGGGCCCTGGGGG + Intronic
1167498077 19:49830801-49830823 AGACTGGGCTGGGAAGCAGGTGG - Exonic
1167527314 19:49993005-49993027 AGGCTATGGTGCAGACCAGGAGG + Intronic
1167649928 19:50723618-50723640 AGGCTGGGGAGGTGCCCAGGAGG + Exonic
1168044794 19:53786862-53786884 GGCTTGGGGCGGAGACCAGGGGG + Intergenic
1168102219 19:54147344-54147366 AGGCTGGTGTGGAGACTAAGGGG + Intronic
1168414404 19:56159542-56159564 AGGCTGGGGTGGAGGCAGGGAGG - Intronic
1168573354 19:57488356-57488378 AGACTGGGGTGGGGGTGAGGCGG + Intronic
1168574771 19:57500486-57500508 AGACTGGGGTGGGGGTGAGGCGG + Intronic
925420047 2:3704115-3704137 AGCCTGGGGAGGACACCTGGGGG - Intronic
925741456 2:7008823-7008845 GACCTGGGGTGGAGGCCAGGAGG - Intronic
926727106 2:16007205-16007227 AGGCTGGAGTGGACACCAGGAGG - Intergenic
927111046 2:19863931-19863953 AGCCTGGCCTGGAGCCCAGGTGG - Intergenic
927860459 2:26557303-26557325 AGAGTGGGATGGGGACGAGGTGG - Intronic
928023252 2:27720471-27720493 AGACAGGGGTAGTGACAAGGGGG - Intergenic
928308846 2:30193506-30193528 AGGCAGGGCTGGAGACCAGGAGG - Intergenic
929050511 2:37832776-37832798 CCAGTGGGGTGGACACCAGGGGG - Intergenic
929520599 2:42647065-42647087 AGAATGGCGTGGAACCCAGGAGG + Intronic
930287926 2:49456990-49457012 AGCCTGAGGTGGAGAAGAGGTGG - Intergenic
932134267 2:69214638-69214660 AGACTTGGGTGGGGACTAGGAGG - Intronic
932361367 2:71109987-71110009 AGACTGTGGTGGAGTCCTTGTGG - Exonic
933869612 2:86553004-86553026 AGCCGGGGGTGGAGATCGGGTGG + Intronic
933897339 2:86823911-86823933 AGACTGAGGAGGAGCCCTGGGGG + Intronic
933997427 2:87680056-87680078 AAGCTGGGGTGGGGGCCAGGTGG + Intergenic
935345289 2:102102328-102102350 AGGCAGGGGTAGAGCCCAGGTGG - Intronic
935417512 2:102834465-102834487 AAAGTGGGTTGGAGACCATGGGG - Intronic
936023585 2:109014286-109014308 ACGCTGTGGTGAAGACCAGGTGG + Intergenic
936296424 2:111270856-111270878 AAGCTGGGGTGGGGGCCAGGTGG - Intergenic
936593246 2:113823543-113823565 AGGCTGAGGTGGGGCCCAGGAGG + Intergenic
937278391 2:120701213-120701235 AGCCTGGTGGGGAGAGCAGGGGG + Intergenic
937952338 2:127398201-127398223 AGATTGTGGTGGAGGCCAGCAGG + Intergenic
938452760 2:131437193-131437215 ACACTGGTGAGGGGACCAGGTGG - Intergenic
938658531 2:133461628-133461650 ACACTCGGCTGGAGCCCAGGAGG - Intronic
941771288 2:169348812-169348834 GCACTGGGGTGGAGAAAAGGGGG + Intronic
944802884 2:203253475-203253497 AGACTGATATGGAGAACAGGAGG + Intronic
944968389 2:204962246-204962268 AGACTGGAGGGCAGACCAGAAGG + Intronic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
946353434 2:219170064-219170086 AGCCTGGGGTGGGGAGAAGGTGG + Intronic
946385813 2:219383887-219383909 TGACTAGGGTGGAGAGAAGGTGG + Intronic
946451452 2:219783580-219783602 AGACTGGGCTGCAGACCTGTGGG + Intergenic
946952966 2:224897541-224897563 AGGCTGGGGTGGAGGGGAGGTGG - Intronic
947634362 2:231672715-231672737 AGACTGGGGAGGCCACAAGGAGG + Intergenic
948077185 2:235174045-235174067 GGACTGGGGAGGAGGTCAGGAGG + Intergenic
948453656 2:238093953-238093975 AGCGTGGGGTGGGCACCAGGAGG + Intronic
948855432 2:240728108-240728130 AGACCGCGGTGGAGCACAGGTGG + Intronic
1170036807 20:11998167-11998189 AGACAGGGGTGAAAACCAGGGGG + Intergenic
1170840721 20:19922812-19922834 AGTATGGGGTGGGGTCCAGGTGG - Intronic
1171326062 20:24294309-24294331 GGATTGGGGTGGAAAGCAGGAGG - Intergenic
1171948419 20:31399223-31399245 AGACTAGGGTGAGGAGCAGGAGG - Intergenic
1172609605 20:36240182-36240204 AGTCTGAGGTGGAGGCCATGAGG + Exonic
1173650872 20:44663258-44663280 AGACTGGGGTGCAGGTTAGGGGG + Intergenic
1174209628 20:48867121-48867143 AGGCTGGGCTGGGGAGCAGGAGG - Intergenic
1174379635 20:50148358-50148380 AGACTGAGGTGGGGACAGGGAGG + Intronic
1175324350 20:58112323-58112345 AGACTGAGGAGGACTCCAGGAGG - Intergenic
1175915918 20:62425716-62425738 TGGCTGGGGTGGAGAGCAGCCGG - Intronic
1175921174 20:62451251-62451273 GGGCTGGGGTGGGGAGCAGGTGG - Intergenic
1175953101 20:62593854-62593876 AGGCTGGGCAGGAGACCAGGTGG - Intergenic
1176255412 20:64149498-64149520 AGAAGGAGGTGGAGACCAGCGGG + Intergenic
1179270572 21:39847650-39847672 AGACTGGGGAGGAGACCCTTTGG + Intergenic
1180086175 21:45508930-45508952 GGACTGGGGTGCAGGCCTGGGGG + Intronic
1180192406 21:46172254-46172276 AGATGGGGGTGGAGAGCATGAGG + Intronic
1180680194 22:17620493-17620515 AGACTGGAAAGGAGAACAGGAGG - Intronic
1180979624 22:19872458-19872480 AGCCTGGGACCGAGACCAGGAGG + Intergenic
1181011741 22:20044852-20044874 AGGGTGGGATGGAGCCCAGGAGG - Intronic
1181042443 22:20198481-20198503 AGAGAGGGAGGGAGACCAGGCGG - Intergenic
1181335523 22:22125289-22125311 ACACTGTGGTGGAGGGCAGGGGG + Intergenic
1181964611 22:26647759-26647781 AGACTGGGGGGAAGCCCAGTAGG + Intergenic
1182242042 22:28923876-28923898 GGTCTGGGGTGGAGCCCAAGTGG + Intronic
1182520450 22:30881784-30881806 AGTCAGGGATGGACACCAGGTGG + Intronic
1182550069 22:31096156-31096178 AGACTGGGGTGGCCATCAGTGGG - Intronic
1182622124 22:31624010-31624032 AGAATGGGGTTGGGACGAGGGGG - Intronic
1184786752 22:46675777-46675799 GGGCTGGGTTGGAGCCCAGGAGG + Intronic
1184887715 22:47356627-47356649 AGAAAGGGGTGGAGAAAAGGGGG - Intergenic
1185414149 22:50700631-50700653 AGGCTGGTGTGGGGACCACGGGG + Intergenic
949362942 3:3251046-3251068 ATTCTGGGGTGTAGTCCAGGAGG - Intergenic
950578502 3:13847295-13847317 AGGCTGAGGTAGGGACCAGGAGG - Intronic
950826645 3:15830358-15830380 AAACTGGGCTGGATAGCAGGAGG + Intronic
952146945 3:30543359-30543381 AGCCTGAGGAGGAGATCAGGAGG + Intergenic
952646298 3:35663360-35663382 AGACTGGGCTTCAGTCCAGGTGG - Intronic
952968762 3:38637512-38637534 AGAGTGGGGAGGAGAGCAGGAGG - Intronic
953016536 3:39082201-39082223 AGACTAGGGTGGGAACAAGGGGG + Intronic
953460429 3:43077613-43077635 AGACTGGGATGGACACAAGGGGG - Intergenic
953741831 3:45545067-45545089 TGCCTGGGGTGGAGCCTAGGTGG + Intronic
954150036 3:48652717-48652739 AGACTGGGGCAGAGACTAGAAGG + Intronic
954150481 3:48654790-48654812 AGACTGGGGTGGGGAGGTGGAGG + Intronic
954619095 3:51985642-51985664 AGAGTGGGGTGGGGACTGGGGGG + Intronic
954743673 3:52774462-52774484 TGACTGGAGTGGACAACAGGGGG + Intergenic
955275033 3:57539162-57539184 AGACTGAGGTGGAGAGGAAGAGG - Intronic
956331153 3:68110596-68110618 AGGCAAGGGTGGAAACCAGGAGG + Intronic
957787196 3:84898661-84898683 AGTCAGGGGTGGAGGCCTGGGGG - Intergenic
958973460 3:100638647-100638669 AGACAAGGGTGGATCCCAGGGGG - Intronic
961368518 3:126415860-126415882 GGAGTGGGGTGGAGAGCAGGTGG + Intronic
961464162 3:127071426-127071448 AGTGTGGGGTGAGGACCAGGTGG + Intergenic
961520244 3:127463278-127463300 AAATTGGGGTGGTGAACAGGGGG - Intergenic
962740192 3:138357677-138357699 AAAGTGGAGTGGAGGCCAGGCGG - Intronic
963835944 3:150057866-150057888 TGGCTGGGGAAGAGACCAGGAGG + Intergenic
963857068 3:150265816-150265838 AGAGTGGGGTGAAGGCAAGGAGG + Intergenic
966486922 3:180481489-180481511 AGACTTGGGTGGAGACACAGAGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966871463 3:184292616-184292638 AGCCTGGGGAGAAGTCCAGGAGG - Exonic
968726926 4:2252114-2252136 AGACTGGGATGGAGAGGAGGAGG - Intronic
969250460 4:5964854-5964876 AGACTGAGGGTGAAACCAGGGGG + Intronic
969655782 4:8497748-8497770 AGACTGATATGGAGAACAGGAGG - Intergenic
970516949 4:16841777-16841799 AGAGTTGGGAGGAAACCAGGAGG + Intronic
971459017 4:26873997-26874019 AGACTCAGGTGAAGGCCAGGAGG - Intronic
971626755 4:28930796-28930818 ACACAGGGGTGGAGACAAGCTGG - Intergenic
972792677 4:42387789-42387811 ACTCAGGGGTGAAGACCAGGGGG + Intergenic
973811652 4:54576222-54576244 AGAGTGGGGTGGGGATGAGGAGG + Intergenic
974876759 4:67711886-67711908 AGGCTGGGAGGGAGAACAGGAGG + Intergenic
975807442 4:78127496-78127518 GCACTGGGGTGGAGAAGAGGAGG + Intronic
980988505 4:139718392-139718414 AGGCTGGTGTGGAGGCAAGGAGG + Exonic
981179803 4:141727267-141727289 AAACTGGGGTGGAGAACAAAGGG + Intronic
981881439 4:149617559-149617581 GTACTGGAGTGGACACCAGGTGG - Intergenic
984039913 4:174719050-174719072 AGAATGGGGTGAACCCCAGGGGG - Intronic
985172609 4:187167976-187167998 AGAATGGGCTGGAAACAAGGCGG + Intergenic
985209468 4:187576904-187576926 AGGCTGTGCTGGGGACCAGGAGG + Intergenic
985239931 4:187919353-187919375 GGAATGGGGTGGAGAGGAGGAGG + Intergenic
986125245 5:4878337-4878359 TGAGTGGAGTGGAGACCAGGAGG - Intergenic
987619258 5:20319023-20319045 AGACTGGGGTCCAGACCGTGGGG - Intronic
989582867 5:43049764-43049786 AGACTGATATGGAGAACAGGAGG - Intergenic
989660398 5:43791634-43791656 AGACAGGGGTGGAGCCAAGATGG + Intergenic
989794705 5:45452999-45453021 AGACTGGGGTATAAAGCAGGAGG + Intronic
990637321 5:57743537-57743559 AGAGTGGGATGGAGAAGAGGAGG + Intergenic
992227730 5:74635258-74635280 AGACTGAGGGGGAGGCCGGGAGG + Exonic
992662618 5:78976415-78976437 AGACTGAGGTTGAGACCCGGGGG - Intronic
993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG + Intergenic
995320101 5:110824400-110824422 AGACTGGATTGGAGGCCAGGTGG - Intergenic
995610938 5:113909629-113909651 AGACAGGGTGGAAGACCAGGAGG - Intergenic
997361601 5:133298842-133298864 AACCGGGGCTGGAGACCAGGAGG + Intronic
997614450 5:135236980-135237002 AGAGTGGTGGGGAGACAAGGAGG - Intronic
998400985 5:141849125-141849147 AGTCAGGGGTGGAGACAATGCGG + Intergenic
998607083 5:143646618-143646640 GGGCTGGAGTAGAGACCAGGTGG - Intergenic
1000285331 5:159821512-159821534 AGACTGGGGTGGACAGTAGGAGG + Intergenic
1001244785 5:170098075-170098097 AGAGTGGCCTGGAAACCAGGAGG + Intergenic
1002399654 5:178984554-178984576 AGGCTGGGGAGGAGAGCTGGGGG + Intronic
1002717199 5:181234945-181234967 AGGCTGAGCTGGAGGCCAGGAGG - Exonic
1003324950 6:5084631-5084653 AGACTGGGGCGGGGACCGTGTGG - Exonic
1004503891 6:16231784-16231806 AGACTGATATGGAGAACAGGAGG - Intergenic
1005999436 6:30953889-30953911 GGTCTGGGGTGGAGATCAGTGGG - Exonic
1006401702 6:33821570-33821592 AGCCTGGGGTGGGGGTCAGGAGG - Intergenic
1006710480 6:36064928-36064950 TGACTGGGGTGGAGACAGAGTGG - Intronic
1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG + Intergenic
1007210000 6:40185759-40185781 AGAAGGGGCTGGAGCCCAGGAGG + Intergenic
1007270183 6:40630398-40630420 AGGCTGGGGTGGATAGGAGGGGG + Intergenic
1008985928 6:57543026-57543048 AGAATGGCGTGAAGCCCAGGGGG - Intronic
1010843921 6:80681281-80681303 AAACTGGGATGTGGACCAGGAGG - Intergenic
1011557898 6:88588383-88588405 AACCTGGGAAGGAGACCAGGTGG - Intergenic
1012089612 6:94874427-94874449 AGACTTGGGTGGAGCCAAGATGG - Intergenic
1012425386 6:99108506-99108528 TGACGGGGGTGGAGCTCAGGCGG + Intergenic
1013198877 6:107871766-107871788 AGAGGGGGATGAAGACCAGGAGG - Exonic
1013662283 6:112309661-112309683 AGACTGGGGTGGGATCGAGGTGG - Intergenic
1016411706 6:143790107-143790129 AGCCTGTGGTGGAGACAACGAGG + Intronic
1017078211 6:150639755-150639777 AGACTGGGAGGCAGACCAGAGGG + Intronic
1017609657 6:156171876-156171898 AGCCTGGAGTGGGGACCGGGAGG - Intergenic
1018638483 6:165885500-165885522 AGATTTGGGTGGAGACACGGAGG + Intronic
1019261866 7:86355-86377 AGGCTGGGGAGGAGCTCAGGAGG - Intergenic
1019767919 7:2865128-2865150 AGAGTGGGATGGGGTCCAGGTGG + Intergenic
1019779585 7:2931424-2931446 ACAGAGGTGTGGAGACCAGGAGG - Intronic
1020590889 7:10135579-10135601 TGATTGGTGTGGAGAGCAGGAGG - Intergenic
1020785450 7:12567954-12567976 AGGCTTGGTTGGAGACCAGAGGG - Intergenic
1022520926 7:31006518-31006540 AGGGTGGGGTGGAGAGAAGGGGG - Intergenic
1022619028 7:31963964-31963986 AAAGTGGGGTGGAGGCAAGGTGG + Intronic
1022807492 7:33837455-33837477 AGCCTGCGATGGCGACCAGGAGG + Intergenic
1023936838 7:44746586-44746608 AGAAAGGAGTGGACACCAGGTGG + Intergenic
1029207392 7:98878121-98878143 AGAATGGAGAGGAGGCCAGGAGG - Intronic
1029220292 7:98983361-98983383 AGACGGTGGTGAAGACCTGGAGG + Exonic
1030613843 7:111717265-111717287 TGCCTGGGGAGGAGATCAGGAGG - Intergenic
1031247228 7:119329901-119329923 AGGCTGAGGTTGAGCCCAGGAGG + Intergenic
1031431147 7:121671156-121671178 AGTCTGGAGTGGCGGCCAGGGGG - Intergenic
1032095240 7:128935009-128935031 TGGCTGGGGTGGGGAGCAGGGGG - Intergenic
1032433303 7:131880347-131880369 AAGCTGGAGTGGAGCCCAGGAGG - Intergenic
1034967313 7:155399255-155399277 AGGCAGGGCTGGAGAACAGGAGG - Intergenic
1034999812 7:155603724-155603746 AGACTGGGGTGGATTCCCGTTGG - Intergenic
1036217124 8:6889915-6889937 AGACTGGGGAGGGGACGGGGAGG - Intergenic
1036634162 8:10537452-10537474 AGGCTGGGGAGGAAAGCAGGTGG + Intronic
1036977241 8:13427369-13427391 AGAAATGGGTGGAGACTAGGGGG - Intronic
1037097619 8:15004363-15004385 AGCCTAGGGTGGATACTAGGTGG + Intronic
1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG + Intergenic
1040383939 8:46900659-46900681 AACCTGTGGAGGAGACCAGGAGG + Intergenic
1040549341 8:48426686-48426708 AGCCTGGGATGGGGAGCAGGTGG - Intergenic
1040625858 8:49149347-49149369 AGCCTGGGCTGGAGGGCAGGGGG + Intergenic
1041022104 8:53648382-53648404 AAGCTGGTGTGGAGGCCAGGAGG - Intergenic
1042188784 8:66164787-66164809 AGCCTGGGTTGGAGACTAAGAGG - Intronic
1044698583 8:94947660-94947682 AGACAGGGGTGGATCCCTGGGGG - Intronic
1044820415 8:96152493-96152515 AGTCTGGGGTGGGGATAAGGAGG + Intronic
1045703735 8:104896615-104896637 AAACTGGGGTGCAGAGCAGTGGG - Intronic
1047504846 8:125470882-125470904 TGACTCGGGAGAAGACCAGGAGG - Intergenic
1049154836 8:141060106-141060128 AGACCGGGGCAGAGACCAGAGGG - Intergenic
1056800382 9:89686809-89686831 GCACTGGGGTGCAGTCCAGGAGG + Intergenic
1056932491 9:90890541-90890563 GGACTGGGGTGGGAACCAAGGGG - Intronic
1057299553 9:93870027-93870049 AGACGGGGGTGGGGACCTGCTGG - Intergenic
1057430580 9:94990061-94990083 ACTCTGGGGTGGAGACCTGTTGG - Intronic
1057930423 9:99188646-99188668 AGACTGGGTTGTGGACGAGGGGG - Intergenic
1058107425 9:100988572-100988594 AGACTAGGGAGGAGGCCAGTGGG + Intergenic
1060470377 9:123943282-123943304 AGACAGAGGTGCAGACCTGGGGG + Intergenic
1060821190 9:126662495-126662517 AGACTGGGCTGGGAGCCAGGAGG - Intronic
1062034217 9:134375640-134375662 AGCCTGGGGTGGCCAGCAGGTGG + Intronic
1062285609 9:135771271-135771293 AGGCAGGGCGGGAGACCAGGTGG + Intronic
1062390379 9:136331413-136331435 AGGCTGGGGAGGGGGCCAGGTGG + Intronic
1062713275 9:137988289-137988311 TGTCTGGGGTGGCGACAAGGTGG + Intronic
1203760962 EBV:12889-12911 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203761228 EBV:13647-13669 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203761891 EBV:15961-15983 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203762157 EBV:16719-16741 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203762820 EBV:19033-19055 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203763086 EBV:19791-19813 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203763749 EBV:22105-22127 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203764015 EBV:22863-22885 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203764678 EBV:25177-25199 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203764944 EBV:25935-25957 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203765607 EBV:28249-28271 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203765873 EBV:29007-29029 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203766536 EBV:31321-31343 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203766802 EBV:32079-32101 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203767465 EBV:34393-34415 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203767731 EBV:35151-35173 GGACTGGGGTGGACACAGGGGGG - Intergenic
1203490007 Un_GL000224v1:95914-95936 AGACTGATATGGAGAACAGGAGG - Intergenic
1203502630 Un_KI270741v1:37797-37819 AGACTGATATGGAGAACAGGAGG - Intergenic
1185586663 X:1246287-1246309 AGACAGGGGAGGAGGCCACGTGG + Intergenic
1186837960 X:13456917-13456939 AGACTGAGGCTGGGACCAGGGGG - Intergenic
1190361758 X:49656205-49656227 AGACTATGGTCAAGACCAGGTGG - Intergenic
1193278503 X:79620456-79620478 GGACTGGGCTGCAGAGCAGGAGG + Intergenic
1193901422 X:87182817-87182839 TGACTCTGGTGGAGACCAGTAGG + Intergenic
1198683734 X:139206276-139206298 GGACTGGGGTGGTGACTAGCAGG + Intronic
1199899613 X:152160144-152160166 AGAGTGGGGTGAGGACAAGGAGG - Intergenic