ID: 901216178

View in Genome Browser
Species Human (GRCh38)
Location 1:7556614-7556636
Sequence TGGGGCACAAGGTTTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901216178_901216189 10 Left 901216178 1:7556614-7556636 CCCATCTCAAACCTTGTGCCCCA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 901216189 1:7556647-7556669 CAGACACACTGGCCTCTTGCAGG 0: 1
1: 1
2: 4
3: 29
4: 259
901216178_901216184 -1 Left 901216178 1:7556614-7556636 CCCATCTCAAACCTTGTGCCCCA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 901216184 1:7556636-7556658 ACCCCACGCTCCAGACACACTGG 0: 1
1: 0
2: 4
3: 21
4: 256
901216178_901216190 15 Left 901216178 1:7556614-7556636 CCCATCTCAAACCTTGTGCCCCA 0: 1
1: 0
2: 1
3: 12
4: 143
Right 901216190 1:7556652-7556674 ACACTGGCCTCTTGCAGGTGTGG 0: 1
1: 1
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901216178 Original CRISPR TGGGGCACAAGGTTTGAGAT GGG (reversed) Intronic
900922800 1:5684381-5684403 AGGAGCACAAGGTTGGAGACAGG - Intergenic
901216178 1:7556614-7556636 TGGGGCACAAGGTTTGAGATGGG - Intronic
902543593 1:17172108-17172130 TTGGGGACAAGGGTTGAGAAAGG + Intergenic
902963292 1:19979679-19979701 TGAGGCACAAGGCTGGGGATGGG + Exonic
904358534 1:29957358-29957380 GTGGGTACAAGGTTTGAGCTGGG + Intergenic
905477350 1:38238444-38238466 TGGGGCAGGAGGCTTGGGATGGG - Intergenic
908112151 1:60908511-60908533 TGGGGCACAGGGTCAGGGATAGG + Intronic
908278097 1:62498045-62498067 TGAGGCCCAAAGTTTGAGACCGG + Intronic
915973510 1:160370473-160370495 TGGGAAAGCAGGTTTGAGATGGG - Intronic
916103427 1:161412475-161412497 TGGGGCACAGGGTTGGGGCTAGG - Intergenic
917408494 1:174734605-174734627 TGAGGCACAAGATCAGAGATAGG + Intronic
920434050 1:205936777-205936799 TTTGGCAAAAGATTTGAGATGGG + Intronic
921125474 1:212173998-212174020 GGGGGCACAAGGAATGTGATGGG - Intergenic
923489246 1:234468796-234468818 TGGGACACAAGCCCTGAGATGGG - Intronic
924581605 1:245328771-245328793 AGGGACACAGGGTTTGAGACAGG + Intronic
924665502 1:246067455-246067477 TGCGGGACAAGGTATGAGTTGGG + Intronic
1062820688 10:532349-532371 TGGGCCTCATGGTTTGAGAAGGG - Intronic
1063840338 10:10064682-10064704 TGGGGAAAATGGTTTGAGGTGGG - Intergenic
1063886825 10:10588338-10588360 TGTGGGACAAGGTTGGAGCTAGG - Intergenic
1068671125 10:59724601-59724623 TGGGGGGCAAGGTTTGAGAGAGG - Intronic
1070693957 10:78548032-78548054 CAGGGCAGAAGGTTTGAGGTAGG - Intergenic
1077476368 11:2792270-2792292 AGGGGCTCCAGGTTTGAGAAGGG - Intronic
1079979262 11:27131986-27132008 TGGGTCACAAGACTGGAGATGGG - Intergenic
1081722930 11:45303356-45303378 TGGGGCAGTAGGTGTGTGATAGG + Intergenic
1083433390 11:62626718-62626740 TGGGGCCCAAGGTTGGACAAGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084092715 11:66889171-66889193 TGTGGGGCAGGGTTTGAGATGGG + Intronic
1084125848 11:67098542-67098564 TGGAGGACCAGGTTTGGGATGGG + Intergenic
1087359865 11:97144651-97144673 TGGGGCAGAAGATATGACATAGG + Intergenic
1096547668 12:52351986-52352008 TGGGGAAAAAGGTTTGAAGTGGG + Intergenic
1096592672 12:52671667-52671689 TGGGTCACAAGTTCTCAGATGGG - Intergenic
1097037973 12:56136623-56136645 TGGAGCAGGAGGTTTGTGATTGG + Intronic
1099723594 12:86396618-86396640 TGGGGGAGAAGGAGTGAGATAGG + Intronic
1099893600 12:88618459-88618481 TGGTGCAAAATGTTTGGGATTGG + Intergenic
1106430771 13:29678408-29678430 TGAGGCACCAGGATGGAGATTGG - Intergenic
1107269937 13:38603265-38603287 TGAGACACAATGTATGAGATAGG - Intergenic
1109172820 13:59117613-59117635 TGGAGGACAAGGTGTGTGATGGG + Intergenic
1112936411 13:104805242-104805264 TGAGGTACAAAGTTTGTGATCGG + Intergenic
1115282944 14:31685244-31685266 GGGAGAACAAGGATTGAGATAGG + Intronic
1115789907 14:36867060-36867082 TGTGGAACAAGCTTTGAGATGGG - Intronic
1118571996 14:67203203-67203225 TTGGGCACCAGGTGTCAGATGGG - Exonic
1119387475 14:74266669-74266691 TGAGGCACAAGACTTGAGCTTGG + Intergenic
1125524118 15:40364600-40364622 TGGGGCAGAAAGTTGGAGGTAGG + Intronic
1126344006 15:47674115-47674137 TGGGGCACTTGATCTGAGATGGG - Intronic
1127610645 15:60632726-60632748 TGAGGCACAAGTTTTGGGAGGGG + Intronic
1128016698 15:64354638-64354660 TGTGAAACGAGGTTTGAGATAGG - Intronic
1128475685 15:67995257-67995279 TGGGGCACAGGATTAGAGACTGG + Intergenic
1130363621 15:83212664-83212686 TGGGGCACATGGAGAGAGATAGG + Intergenic
1131838792 15:96415528-96415550 TGGGGCCCAAGGCTGGAGGTGGG + Intergenic
1133427159 16:5702563-5702585 AGAGGAACAAGGTTTGAGAGAGG + Intergenic
1133638227 16:7690743-7690765 TGGGGCAAATGGCTTGAGAGAGG + Intronic
1133912779 16:10080909-10080931 TGGGGCAGAACATTTGAGACGGG - Intronic
1134686162 16:16160029-16160051 TGGGAGACAAGGTTGGGGATGGG - Intronic
1138123873 16:54422846-54422868 TTGGGCACAAGGTATCACATGGG + Intergenic
1139594472 16:67949955-67949977 TGGGGCCCAAGGTGTGGAATGGG - Intronic
1142220122 16:88850152-88850174 GGGGGCACAAGGCCTGGGATGGG + Intronic
1144810134 17:17993745-17993767 TGGGGCACATGGAGTGAGCTGGG + Intronic
1148793653 17:50187129-50187151 TGGGGGAAATGGTTTGAGAAAGG + Intronic
1149681312 17:58509190-58509212 TGAAGCAGAAGGTTTGAGTTAGG - Intronic
1151365638 17:73614552-73614574 TGGGGGACAAGGATTGAAAAGGG + Intronic
1151365690 17:73614709-73614731 AGGGGCACAAGGATTGAAAAGGG + Intronic
1151453962 17:74215206-74215228 TGGGGCACAGGGTTTGGGATGGG - Intronic
1155522768 18:26685655-26685677 TGGGGCAAGAGCTTTGAGGTTGG - Intergenic
1158666238 18:59435332-59435354 TGGGAAACAAGGTTTGACAAAGG + Exonic
1158932465 18:62335019-62335041 TGGGTCACAAGGTTTAAAAGTGG + Intronic
1166312189 19:41969251-41969273 TGGGACACAAGGCTCCAGATGGG + Intronic
1166417339 19:42605656-42605678 GTGGGCAACAGGTTTGAGATTGG + Intronic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
1167978398 19:53252146-53252168 CGGGGCATAGGGTTAGAGATAGG - Intronic
925109179 2:1319182-1319204 TGGGACACAGGCTTTGAGACCGG + Intronic
926439219 2:12870168-12870190 TGGGGCACAAGGACTGAGGATGG - Intergenic
926806667 2:16717465-16717487 TGGGGCACAGTGTTAGAGATAGG + Intergenic
927365361 2:22289297-22289319 TGGGGCATAAGTTGTGAAATGGG - Intergenic
930870699 2:56167880-56167902 GGAGGCAGAAGCTTTGAGATTGG - Intergenic
933027744 2:77282918-77282940 TGGGGCATCAGCTTTGAGAAAGG + Intronic
936397695 2:112141634-112141656 TTGGGCTCAAGGTCTGAGGTGGG - Intronic
938999552 2:136718363-136718385 TGATCCCCAAGGTTTGAGATAGG + Intergenic
941737691 2:168997455-168997477 TGCTGCACAGGGTTTGGGATTGG + Intronic
942176040 2:173335540-173335562 TGGTGCACAAGGGTGGAGAGAGG - Intergenic
944836664 2:203587145-203587167 TTGGGCCCAAGAGTTGAGATAGG + Intergenic
946084135 2:217154237-217154259 TGGGGTAAAAGGAGTGAGATGGG - Intergenic
1173646529 20:44636661-44636683 TGGAGCACAAGCTTTGGAATTGG - Intronic
1173655005 20:44693969-44693991 TGGGACAGGAGGTTTGAGAAGGG + Intergenic
1174150175 20:48480813-48480835 TGGGGCATAGGGTTTGAGAATGG - Intergenic
1174351406 20:49970920-49970942 TGGAGCTCAAGGACTGAGATAGG - Intergenic
1175763217 20:61575013-61575035 TGCGGCACAGGGTCTGAGCTCGG + Intronic
949238723 3:1843446-1843468 GGGAACACAAGGTTTGTGATGGG - Intergenic
951465800 3:22999447-22999469 TGGGGCACTAGGCTTGGGAATGG + Intergenic
952352716 3:32556048-32556070 TGGGGGACATGGTGAGAGATGGG - Intronic
952533907 3:34290230-34290252 TGGTTCAAAAGGTTTTAGATGGG - Intergenic
954659457 3:52219194-52219216 TGGGGCACAGGGCTTCCGATTGG + Intergenic
956585535 3:70860667-70860689 TCAGGCAGAAGGTTGGAGATGGG - Intergenic
957298809 3:78364527-78364549 TGGGGAACATGGTCTGAGAAAGG - Intergenic
963987132 3:151609253-151609275 TGGGGCACAATGAGTGAGGTTGG + Intergenic
964712185 3:159683012-159683034 TGAGTCAATAGGTTTGAGATGGG - Intronic
967687498 3:192434767-192434789 TGGGGGAAATGCTTTGAGATTGG - Intronic
970065395 4:12087924-12087946 TTGAGAACAAGGTTTGAGAGAGG - Intergenic
970548586 4:17155749-17155771 TCTGGCACAAAGTTTGAGAGTGG - Intergenic
971160000 4:24123975-24123997 TGGAGCAAAAGTATTGAGATTGG + Intergenic
973696049 4:53492351-53492373 TGGGGCACATGGTTAAACATGGG + Intronic
973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG + Intergenic
975091510 4:70409734-70409756 TGGGGCTCAGGGTTAGAGATAGG - Exonic
975139515 4:70905000-70905022 TGGGGCACAATTTTTCAGTTAGG + Intronic
976890807 4:90045219-90045241 AAGGGCAGAAGGTTTGAGATTGG - Intergenic
976894931 4:90097742-90097764 TGATGCACAAGGTCTGACATAGG - Intergenic
977328113 4:95602995-95603017 TGCGTCACAAAGTTTGAGTTTGG + Intergenic
978324479 4:107537014-107537036 TGGGGCTCAACCTCTGAGATTGG - Intergenic
979411296 4:120383151-120383173 TTAGGCATAATGTTTGAGATTGG - Intergenic
979681272 4:123462643-123462665 TGGGACATGAGGTTTGAGGTAGG - Intergenic
981549734 4:145931872-145931894 TGCAGCACAAGGTGTGAGAGAGG - Intronic
984912727 4:184689408-184689430 TGGAGAACAAGGTATGAGTTGGG - Intronic
985952756 5:3236136-3236158 TGGGGCATAAGGTTTCAGAAGGG - Intergenic
990207211 5:53442368-53442390 TGTGGCACAAGGTTTGGGTTGGG - Intergenic
992061955 5:73060543-73060565 TGGGGGACAAAGTTTAAGACTGG - Intronic
1003340348 6:5214344-5214366 TGGTGCACAAGCATTGAGATGGG + Intronic
1007653338 6:43436768-43436790 TGGGGCACAGGGTTGGACAAAGG - Intronic
1018351645 6:162965913-162965935 TTGTGCAGAAGGTTTGGGATGGG + Intronic
1020140218 7:5607703-5607725 TGGGGCGCAAGTCTTGAGATTGG + Intergenic
1022478579 7:30728026-30728048 TGGGGCACAGGCCCTGAGATGGG - Intronic
1022827343 7:34029341-34029363 TGGGGGACCAGGCTAGAGATGGG + Intronic
1023532502 7:41172973-41172995 TTGGAGACAAGGTTTGATATTGG - Intergenic
1027193776 7:76013875-76013897 TGAGGCACAAGATCTGAGAGTGG + Exonic
1031356967 7:120798735-120798757 TGGAGCACAGGGTGTGAGAAGGG - Intronic
1031919262 7:127589049-127589071 AGGGGCACAGGGATGGAGATGGG - Intronic
1031942478 7:127803639-127803661 TGGGGTACAATGTTTAAGAATGG + Intronic
1032076084 7:128836860-128836882 TGGGGTTCAAGGTCTGAGCTGGG + Intronic
1032076242 7:128837477-128837499 AGGGGCACCAGGTTTGAGCTTGG - Exonic
1032285028 7:130533302-130533324 TGGGGCACAAGGGTGGGGGTGGG + Intronic
1032311186 7:130788867-130788889 TGGGAGACAAGGCTTGAGTTGGG + Intergenic
1032345653 7:131114000-131114022 TGGGGCTAACAGTTTGAGATGGG + Intronic
1034514537 7:151564639-151564661 TGGGGAACAAGGTTTCTGCTGGG + Intronic
1037156683 8:15709325-15709347 TGGGGTAAAAGCTTTCAGATTGG - Intronic
1037537153 8:19835404-19835426 AGGGGCACATGGTTTGAGTTAGG + Intronic
1038918249 8:32051732-32051754 TGGGCCACAAGATGTGAGAGGGG + Intronic
1039050505 8:33488336-33488358 TGGGGCAGAGGATTTGAAATGGG + Intronic
1041114756 8:54524694-54524716 TGGTACACCTGGTTTGAGATGGG - Intergenic
1042865737 8:73355515-73355537 GGGGCCACAAGGCTTGAGTTGGG + Intergenic
1044607209 8:94057772-94057794 TGGGGCACATCGTGGGAGATGGG + Intergenic
1045438458 8:102187427-102187449 TGAGGTACAAAGTTAGAGATGGG + Intergenic
1045548742 8:103151527-103151549 GGTGACCCAAGGTTTGAGATTGG - Intronic
1046840458 8:118850476-118850498 TGGGGCTGAAGATTTGAGAGAGG + Intergenic
1047210650 8:122837380-122837402 TGGGGCTCACGATTAGAGATGGG - Intronic
1048898463 8:139015868-139015890 TGGCGCACACAGTTTGGGATGGG + Intergenic
1052819068 9:33124624-33124646 TGGGGCCCCATTTTTGAGATGGG - Intronic
1056586043 9:87927900-87927922 TGTGGGACAAGGTTTCAGAAAGG - Intergenic
1056610839 9:88125043-88125065 TGTGGGACAAGGTTTCAGAAAGG + Intergenic
1057669637 9:97076830-97076852 TTGGGCGCAAGGATGGAGATGGG - Intergenic
1061296896 9:129681746-129681768 TGGGGCAGATGGTGTGGGATGGG + Intronic
1062324335 9:136005038-136005060 TGGGGGACAAGGGATGGGATGGG + Intergenic
1189744742 X:44158011-44158033 TGGTCCACAAGACTTGAGATTGG - Intronic
1190363267 X:49668503-49668525 TGGGGGAGAAGGTTTTGGATGGG + Intergenic
1192486442 X:71531135-71531157 TGGGTGACAAAGTTTGGGATTGG + Intronic
1197467460 X:126821697-126821719 TAGGGTACAAGGTTTCAAATAGG - Exonic
1197889950 X:131259629-131259651 TGGGGAACAAGGAGTGAGAGGGG - Intergenic
1199321675 X:146446974-146446996 TAGGCCACAAGGTATGAAATTGG - Intergenic
1199937683 X:152591542-152591564 TGGGGCACTGGATTTGAAATTGG - Intergenic
1200413013 Y:2879966-2879988 TGGGGCAAAAGGTACAAGATGGG + Intronic