ID: 901217448

View in Genome Browser
Species Human (GRCh38)
Location 1:7562773-7562795
Sequence GGACCATGAGAACAAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901217448_901217457 4 Left 901217448 1:7562773-7562795 CCCACTTCTTGTTCTCATGGTCC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 901217457 1:7562800-7562822 GACCCCCAAGCAAGGCGGACGGG 0: 1
1: 0
2: 1
3: 4
4: 84
901217448_901217462 12 Left 901217448 1:7562773-7562795 CCCACTTCTTGTTCTCATGGTCC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 901217462 1:7562808-7562830 AGCAAGGCGGACGGGATGACAGG 0: 1
1: 0
2: 0
3: 4
4: 93
901217448_901217454 -1 Left 901217448 1:7562773-7562795 CCCACTTCTTGTTCTCATGGTCC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 901217454 1:7562795-7562817 CCCAGGACCCCCAAGCAAGGCGG 0: 1
1: 0
2: 3
3: 33
4: 227
901217448_901217451 -4 Left 901217448 1:7562773-7562795 CCCACTTCTTGTTCTCATGGTCC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 901217451 1:7562792-7562814 GTCCCCAGGACCCCCAAGCAAGG 0: 1
1: 1
2: 2
3: 29
4: 272
901217448_901217456 3 Left 901217448 1:7562773-7562795 CCCACTTCTTGTTCTCATGGTCC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 901217456 1:7562799-7562821 GGACCCCCAAGCAAGGCGGACGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901217448 Original CRISPR GGACCATGAGAACAAGAAGT GGG (reversed) Intronic