ID: 901218495

View in Genome Browser
Species Human (GRCh38)
Location 1:7568315-7568337
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3259
Summary {0: 1, 1: 0, 2: 25, 3: 550, 4: 2683}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901218495 Original CRISPR GATGCTGGTGATCCTGATGA GGG (reversed) Intronic
Too many off-targets to display for this crispr