ID: 901219333

View in Genome Browser
Species Human (GRCh38)
Location 1:7574274-7574296
Sequence CCTTCCAAGCAGACACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901219329_901219333 -2 Left 901219329 1:7574253-7574275 CCTGTGCACCTGCCAAACAGACC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 226
901219330_901219333 -10 Left 901219330 1:7574261-7574283 CCTGCCAAACAGACCTTCCAAGC 0: 1
1: 0
2: 0
3: 12
4: 110
Right 901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901219333 Original CRISPR CCTTCCAAGCAGACACTGCC AGG Intronic
900956743 1:5890781-5890803 CCTTCCAAGCAGACAGACGCTGG + Intronic
901056086 1:6449164-6449186 CCTCCCCAGCTGTCACTGCCCGG + Intronic
901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG + Intronic
901242153 1:7701714-7701736 CCTTTAAAGCAGATACAGCCGGG - Intronic
902337333 1:15760999-15761021 CCTCCCAAGCAGTGACTGCAGGG - Intronic
902478268 1:16699331-16699353 CCTCCCCAGCTGTCACTGCCCGG - Intergenic
902852442 1:19170815-19170837 CCTTCCAAGGAGAAACTGCAAGG - Exonic
903439793 1:23379103-23379125 CCTTCCAGGAAGTCACAGCCTGG - Intergenic
904534607 1:31190822-31190844 CCTTCCACCCTGACTCTGCCTGG + Intronic
905970146 1:42135656-42135678 CCCTCCAAGCAGGCACTGCTGGG + Intergenic
906785354 1:48610858-48610880 CCTTCCACACACACACAGCCTGG + Intronic
907319657 1:53594535-53594557 CCTTCCAAGCGGGCCCGGCCTGG - Exonic
911125162 1:94334555-94334577 CCTACCCAGCAGAAACTGCCTGG - Intergenic
912226435 1:107739735-107739757 GTTTCCAAACAGACACTGACGGG + Intronic
917091502 1:171358054-171358076 AGTTCAAAGCAGACTCTGCCAGG - Intergenic
917431966 1:174979309-174979331 CCTTTGAAGCAGACACTGGTTGG + Intronic
922679454 1:227579715-227579737 CCCTGCAAGCAGACATGGCCAGG + Intronic
924631810 1:245747903-245747925 TCTTCCAAACGGACACTGTCTGG - Intergenic
1063819583 10:9819346-9819368 CCATGCAAGCAGACACGGCCAGG - Intergenic
1067277145 10:44845970-44845992 CCTGGTAAGCAGACAGTGCCAGG - Intergenic
1067554235 10:47256945-47256967 ACTGAGAAGCAGACACTGCCTGG + Intergenic
1067919527 10:50439332-50439354 CTTTCCAAGCAGAAACTGGTAGG + Intronic
1069878445 10:71577308-71577330 CATTCCAAGCAGGAATTGCCAGG + Intronic
1072626989 10:97119048-97119070 CCATTCAGGCAGGCACTGCCTGG + Intronic
1073470445 10:103718826-103718848 CTTTCCAAGAACACACTGCTAGG + Intronic
1076435715 10:130439996-130440018 ATTTCCAAGGAGACACTCCCTGG - Intergenic
1076579390 10:131496512-131496534 CTTTCCAAGCAGGCTTTGCCAGG + Intergenic
1076730021 10:132433796-132433818 CCGTCCTTGCAGGCACTGCCAGG - Intergenic
1076991613 11:278874-278896 CTTTGGCAGCAGACACTGCCAGG - Intronic
1077221630 11:1420591-1420613 CCCTCCATGCAGGCCCTGCCTGG + Intronic
1077225558 11:1437742-1437764 CCTTCCAGGCAGGCTGTGCCTGG - Intronic
1078157912 11:8814518-8814540 CCTACCAAGCAGTCTTTGCCTGG + Intronic
1082803697 11:57432855-57432877 GCTTCCAAGCAGAGGCTCCCAGG - Intergenic
1085444061 11:76589134-76589156 CCTGCCCTGCAGCCACTGCCAGG - Intergenic
1089388761 11:118085825-118085847 CCTTCCTATCAGACCCTTCCAGG + Intronic
1090162555 11:124510652-124510674 CCTTGCAGGCAGGCACAGCCAGG + Intergenic
1090617720 11:128531063-128531085 CTTGCCAAGCAGAAACTACCAGG + Intronic
1091387988 12:107240-107262 CCCTCCCAGCTGCCACTGCCGGG - Intronic
1091582776 12:1799136-1799158 CTTTCAAAGCACTCACTGCCCGG - Intronic
1094827837 12:34286501-34286523 CCTTCCCAGCAGCCACTGTGTGG + Intergenic
1094828193 12:34287987-34288009 CCTTCCCAGCAGCCACTACTTGG + Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1094828761 12:34290304-34290326 CCTTCCCAGCAGCCCCTGCGAGG - Intergenic
1094828948 12:34291096-34291118 CCTTCCCAGCAGCCCCTGCGTGG - Intergenic
1094829400 12:34293072-34293094 CCTTCCCAGCAGTCCCTGCGTGG - Intergenic
1094829444 12:34293265-34293287 CCTTCCCAGCAGCCCCTGCGTGG - Intergenic
1094829661 12:34294284-34294306 CCTTCCCAGCAGCCCCTGCGTGG - Intergenic
1094829811 12:34294919-34294941 CCTTCCCAGCAGGCCCTGCGTGG - Intergenic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094830320 12:34297252-34297274 CCTTCCCAGCAGCCCCTGCCTGG + Intergenic
1094830648 12:34298656-34298678 CCTTCCCAGCAGCCCCTGCGTGG + Intergenic
1094830930 12:34299933-34299955 CCTTCCCAGCAGCCCCTGCGTGG + Intergenic
1094831688 12:34303224-34303246 CCTTCCCAGCAGTCCCTGCACGG + Intergenic
1094832359 12:34306201-34306223 CCTTCCCAGCAGCCCCTGCGCGG + Intergenic
1094832453 12:34306620-34306642 CCTTCCCAGCAGCCCCTGCGCGG + Intergenic
1094832940 12:34308714-34308736 CCTTCCCAGCAGACCCTGCGCGG + Intergenic
1094833660 12:34312262-34312284 CCTTCCCAGCAGTCCCTGCACGG - Intergenic
1094833850 12:34313092-34313114 CCTTCCCAGCAGCCATTGCGTGG - Intergenic
1094834378 12:34315420-34315442 CCTTCCCAGCAGCTCCTGCCTGG - Intergenic
1094835255 12:34319202-34319224 CGTTCCCAGCAGCCACTGCATGG - Intergenic
1094835310 12:34319415-34319437 CCTTCCCAGCAGCCCCTGCACGG - Intergenic
1094835752 12:34321279-34321301 CCTTCCTAGCAGCCCCTGCGTGG - Intergenic
1094835996 12:34322351-34322373 CCTTCCCAGCAGCCCCTGCGGGG - Intergenic
1094836096 12:34322770-34322792 CCTTCCCAGCAGCCCCTGCTTGG - Intergenic
1094836611 12:34325066-34325088 CCTTCCCAGCAGCCCCTGCACGG - Intergenic
1094837347 12:34328318-34328340 CCTTCCCAGCAGCCACTGCATGG - Intergenic
1094837581 12:34329343-34329365 CCTTCCCAGCAGCCACTGCGCGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094837909 12:34330811-34330833 CCTTCCCAGCAGCCCCTGCGCGG - Intergenic
1096094611 12:48925933-48925955 TCTGCCAGCCAGACACTGCCAGG - Intronic
1098546724 12:71719596-71719618 CCTTCCAAACAGAAATTACCAGG - Intergenic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1099736424 12:86572267-86572289 TTTTCTGAGCAGACACTGCCTGG - Intronic
1102856705 12:116300372-116300394 CCTTCCTAACAGACCCTCCCAGG - Intergenic
1103562065 12:121798026-121798048 ACTTCCAACCAGACAGTCCCGGG + Intronic
1104897280 12:132170594-132170616 CCATCCTGGCAGACACTCCCAGG + Intergenic
1106370950 13:29132025-29132047 CCTCCCAAGATGACACTGCTGGG + Intronic
1108485226 13:50917022-50917044 CCCTCCCAGCAGACACTGGGGGG - Intronic
1109506633 13:63311040-63311062 CTTTCCACGCGGCCACTGCCAGG - Intergenic
1110553923 13:76837134-76837156 CCTTCCAAGCAGCCACATTCTGG + Intergenic
1113015218 13:105821579-105821601 CCTGGCAAGCAGACAATGCTGGG + Intergenic
1113561720 13:111286829-111286851 CCTTCCCAGCAGTCACCCCCAGG - Intronic
1113798818 13:113075886-113075908 CTGTCCAGGCACACACTGCCGGG - Intronic
1114766299 14:25374419-25374441 CTTTCCAAGCAGAGGCTACCAGG - Intergenic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1119936322 14:78595459-78595481 CCTTGCTACAAGACACTGCCAGG - Intronic
1120673631 14:87393246-87393268 CCTGCCGAGCAGCCACAGCCTGG + Intergenic
1122408780 14:101515504-101515526 CCTAACTAGCAGAGACTGCCAGG - Intergenic
1122717075 14:103702243-103702265 GCTTCCCTGCAGACACTGGCTGG - Intronic
1122783399 14:104153247-104153269 CCAGCCCAGCAGCCACTGCCAGG - Intronic
1122967324 14:105137477-105137499 GCTTTCAAGCAGACGCTTCCTGG + Intergenic
1123023540 14:105413063-105413085 CCTTCCAAGATTACACAGCCAGG + Exonic
1124030263 15:26004216-26004238 CCTTCTAGGCAATCACTGCCAGG - Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1127029672 15:54848150-54848172 CCTTCAGAGAAGTCACTGCCTGG - Intergenic
1127777399 15:62276437-62276459 CATTCCAAGCAGAGACCACCAGG - Intergenic
1130441268 15:83956265-83956287 CGTGCCATGCAGCCACTGCCAGG + Intronic
1132654267 16:1035332-1035354 GGTTCCAAGCGGACGCTGCCTGG + Intergenic
1132887849 16:2190272-2190294 CCTTCCAGGCAGGCACCACCCGG + Intronic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140208607 16:72953377-72953399 CAGTCAAAGCAGAAACTGCCCGG + Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1141581839 16:85004600-85004622 CCTTCCTAGCAGCCTCTCCCTGG + Intronic
1141887986 16:86905958-86905980 TCTGCCTAGCAGACACTGGCTGG - Intergenic
1142668116 17:1473956-1473978 CATTTATAGCAGACACTGCCAGG - Intronic
1148436864 17:47692340-47692362 CCCTCTAAGCACACACTGTCTGG - Intergenic
1148846510 17:50533010-50533032 CCTTCCATGCCGCCACTGCCAGG - Intronic
1150832206 17:68533629-68533651 CCATCTAAACATACACTGCCAGG - Intronic
1151655103 17:75492136-75492158 CCTTCCAAATATACACAGCCCGG + Intronic
1152568127 17:81109230-81109252 CCTTTTGAGCAGAAACTGCCAGG + Intronic
1153497300 18:5712537-5712559 CCATCCTAGCAAACTCTGCCTGG - Intergenic
1155146435 18:23087756-23087778 CCCAGAAAGCAGACACTGCCAGG + Intergenic
1155166575 18:23237072-23237094 CCTCCCCAGCAGAGACAGCCAGG - Intronic
1157818802 18:50750588-50750610 CCTTGCAGGCAGACAGTCCCAGG - Intergenic
1158335757 18:56414021-56414043 CCTTCAAAGCAGCCCCTCCCAGG + Intergenic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1160239206 18:77111106-77111128 CCTCCCAGGCAAACATTGCCAGG - Intronic
1161136776 19:2624731-2624753 CCTTCCCAGAAGGCACTGCTGGG - Intronic
1161456208 19:4370840-4370862 CCTTCCCAGAGGCCACTGCCAGG - Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1166895263 19:46018552-46018574 CCCTCCCAGCATGCACTGCCTGG - Exonic
1167655106 19:50758684-50758706 CTCTCCAAGGAGCCACTGCCTGG - Intergenic
1202712291 1_KI270714v1_random:25159-25181 CCTCCCCAGCTGTCACTGCCCGG - Intergenic
925680153 2:6411885-6411907 CCTCCCAAGCAGGAACAGCCAGG - Intergenic
929037382 2:37707230-37707252 CCTCCCAAGCAGGCAGGGCCGGG - Intronic
941372054 2:164677753-164677775 CCTTCCAAGAACACAGTGCAGGG + Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
945740007 2:213647789-213647811 CCTTCAGAGAAGACAGTGCCTGG - Intronic
948295339 2:236856402-236856424 CCGCCCAAGCAGACAGTGCGGGG - Intergenic
1169143048 20:3236859-3236881 CCTGCCCAGCTGACACTACCAGG + Intronic
1171335263 20:24379783-24379805 CCTGCCCAGCAGCCACTCCCAGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173135996 20:40439670-40439692 GCTTCAGAGCAGACACTTCCAGG + Intergenic
1173362958 20:42360815-42360837 CCTTTCTGGCAGACACCGCCTGG + Intronic
1173938577 20:46890545-46890567 GCTTCCAGGCAGCCACTGCAAGG - Intergenic
1174352667 20:49979553-49979575 ACTTGCAGGCAGCCACTGCCTGG - Intergenic
1175279286 20:57792549-57792571 CCTCCCAAGCAAACCCCGCCGGG - Intergenic
1176430063 21:6569955-6569977 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1179294176 21:40045851-40045873 CCTGCCCTGGAGACACTGCCAGG - Intronic
1179705457 21:43177417-43177439 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1179716486 21:43291277-43291299 CTTTCCAGGGGGACACTGCCTGG - Intergenic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1181496231 22:23288814-23288836 CCTTCCCCACCGACACTGCCAGG - Intronic
1182067171 22:27438853-27438875 CCTCCCAAGCAGACACCTCAGGG - Intergenic
1184864832 22:47196298-47196320 CCTTCCACCCAGACACTGAGAGG - Intergenic
1184985954 22:48134311-48134333 CCATCCAAGCAGGGGCTGCCAGG + Intergenic
950027350 3:9829274-9829296 CCTCCACAGCAGTCACTGCCCGG + Exonic
950642680 3:14358685-14358707 CCTTCCAGGTAGGCCCTGCCAGG - Intergenic
951258789 3:20482221-20482243 CACTGCAAGCAGACACAGCCAGG - Intergenic
953348663 3:42197866-42197888 GCTTCCCAGCAGATACCGCCTGG - Intronic
953389393 3:42525813-42525835 TGTTCCAAGCAGAGACAGCCAGG + Intronic
953531500 3:43744270-43744292 CTGTCCAAGCAGACTCAGCCTGG + Intergenic
953934140 3:47025113-47025135 CCTGCCTAGCAGCCACTGCAGGG + Intronic
954351116 3:50044664-50044686 CTTTCCTAGGAGACACTGACAGG + Intronic
954435646 3:50494462-50494484 CCCTCCAAGCCCACACTGCCTGG + Intronic
955393080 3:58535322-58535344 CCTACCATGCACACAGTGCCTGG - Intronic
962356197 3:134696159-134696181 CCTTGGAACCAGACATTGCCAGG - Intronic
963863583 3:150335886-150335908 TCTTCAAAGCAGAGGCTGCCTGG + Intergenic
965545533 3:169912031-169912053 CCTACCAAATAAACACTGCCTGG + Intronic
967121598 3:186387177-186387199 CCATCCAGGCAGGGACTGCCTGG - Intergenic
968091266 3:195899817-195899839 CCTTCTCAGCAGACACACCCAGG - Intronic
968443026 4:634081-634103 CCTCCCAGGCACACACTCCCAGG - Intronic
968626132 4:1627522-1627544 GCTCCCCAGCAGACCCTGCCAGG + Intronic
979669108 4:123343581-123343603 CCTTCCAAGCACACAGGGCACGG + Intergenic
979952536 4:126911670-126911692 CCTTCCAAACAGAAAGTGCAAGG + Intergenic
980084736 4:128379648-128379670 CCTACAAAGCAGACAATGTCAGG + Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
983137110 4:164098395-164098417 CCTTCCAAACAAGCACTTCCTGG - Intronic
985065688 4:186118816-186118838 CCAGCCAAGCACCCACTGCCTGG + Intronic
985164430 4:187077859-187077881 CCTTCAAAGCAGAACCTGACAGG + Intergenic
985185777 4:187313831-187313853 GTTCCCAAGCAGACAATGCCAGG - Intergenic
985490430 5:175616-175638 CCCTCCAGGCAGACACGACCAGG + Intronic
985490447 5:175675-175697 CCCTCCAGGCAGACACGACCAGG + Intronic
985490464 5:175734-175756 CCCTCCAGGCAGACACGACCAGG + Intronic
985490481 5:175793-175815 CCCTCCAGGCAGACACGACCAGG + Intronic
985490498 5:175852-175874 CCCTCCAGGCAGACACGACCAGG + Intronic
985490514 5:175910-175932 CCCTCCAGGCAGACACGACCAGG + Intronic
985490530 5:175968-175990 CCCTCCAGGCAGACACGACCAGG + Intronic
985550532 5:531322-531344 TGTCCCCAGCAGACACTGCCTGG + Intergenic
985654255 5:1121787-1121809 CCTTCCTAGGAGAAACTGCGCGG - Intergenic
987348975 5:17004487-17004509 CCCTCCAATGAGACACTGGCTGG + Intergenic
988348356 5:30069619-30069641 CCCTGCAAGCAGGCACAGCCAGG - Intergenic
988967387 5:36432661-36432683 CCTTGCAAGCAGGCACATCCAGG + Intergenic
993975720 5:94477118-94477140 CCTTCCGAGCAATCACTACCAGG - Intronic
996505586 5:124264486-124264508 TTTTACAAGCAGACACTGCCTGG - Intergenic
996924286 5:128805373-128805395 CCTTCCAAACAGAAAGTGCCAGG - Intronic
996954284 5:129164460-129164482 CCCTGCAAGCAGGCACAGCCAGG + Intergenic
998761698 5:145439463-145439485 CCTGTAAAGCAGACACTGACTGG - Intergenic
999189207 5:149733644-149733666 CCTGCCAAGCAGAAGCTCCCAGG + Intronic
999194221 5:149771203-149771225 CCCTGCAGGCAGCCACTGCCTGG + Intronic
1000125828 5:158243002-158243024 CCTTACTAGCAGGCACTGCCAGG + Intergenic
1001021422 5:168186111-168186133 CTTTCCAAGCTCACACAGCCAGG + Intronic
1001421774 5:171593036-171593058 CCTGCCAAGCACACATTGCAAGG - Intergenic
1002300428 5:178254614-178254636 CCTTCCCAGAGGACACTGGCTGG - Intronic
1002308156 5:178296493-178296515 CCTTCCCAGCAGCCCCTGCGTGG - Intronic
1002575417 5:180171238-180171260 CCTCCCAAGCAGAAAGTCCCGGG - Intronic
1005103131 6:22195342-22195364 ACTTACATGCAGAGACTGCCTGG - Intergenic
1007591014 6:43021008-43021030 CCTTCCCAGCAGAACCTGGCTGG - Exonic
1010742581 6:79526205-79526227 CCTTCCCAATAGCCACTGCCAGG + Intronic
1016396051 6:143624634-143624656 CCATCCAAGCAGACACAGGCTGG - Intronic
1016453691 6:144209845-144209867 CCCTGCAAGCAGACATTGCCAGG + Intergenic
1016913908 6:149226823-149226845 CATTCCAAACAGACAATGCTGGG + Intronic
1018577666 6:165276554-165276576 CCTATCAAGAAGACACTGTCGGG + Intergenic
1018787721 6:167121360-167121382 CTTTCCAGGCAGGCATTGCCAGG + Intergenic
1020564749 7:9780945-9780967 CCTTACAAGCAAACTGTGCCTGG - Intergenic
1021474319 7:21043421-21043443 CCTTCCAAGAAGACACATCAAGG - Intergenic
1023766588 7:43517371-43517393 CTTCCCAAGCAGATACTACCTGG + Intronic
1024630221 7:51241009-51241031 CCTTTAAAGCACTCACTGCCTGG - Intronic
1026107907 7:67435536-67435558 TCTTGCAAACAGACACTGGCAGG - Intergenic
1027604758 7:80287256-80287278 CATGCCATGCAGCCACTGCCAGG - Intergenic
1028550557 7:92057721-92057743 CCTTCAAAGCAGAACCTGGCAGG - Intronic
1032871647 7:135992049-135992071 CCTGCCCAGCAGACATTGCAAGG - Intergenic
1034366239 7:150551100-150551122 CACTGCAAGCAGACACAGCCAGG - Intergenic
1035114866 7:156516150-156516172 GGTTCCACGCAGACAATGCCAGG + Intergenic
1035371031 7:158379096-158379118 CCTTCCATGCACACAGGGCCAGG - Intronic
1037415128 8:18641343-18641365 ACTGCCTAGCACACACTGCCTGG - Intronic
1040107461 8:43548786-43548808 CCTTCCCAGCAGGCCCTGCGTGG - Intergenic
1040275803 8:46013061-46013083 CCTTCCCAGCAGCCCCTGCATGG - Intergenic
1040275944 8:46013716-46013738 CCTTCCCGGCAGGCACTGCGTGG - Intergenic
1041314258 8:56545100-56545122 CCTTCCAAGGTGACACATCCGGG + Intergenic
1043698425 8:83251604-83251626 CCTTGCAAGCAGGCATGGCCAGG + Intergenic
1049297959 8:141853269-141853291 CCATGCATGCAGGCACTGCCTGG - Intergenic
1049818406 8:144619214-144619236 CTTTCCCAGCAGACCCTGTCTGG - Intergenic
1050475308 9:6034661-6034683 CCCTGCAAGCAGGCACAGCCAGG - Intergenic
1051906860 9:22105412-22105434 CAGTCCCAGCAGACACTGCATGG - Intergenic
1053874992 9:42535064-42535086 CCTTCCAAGAAGTGACTGGCAGG - Intergenic
1053897638 9:42759545-42759567 CCTTCCAAGAAGTGACTGGCAGG + Intergenic
1054191608 9:61988950-61988972 CCTGCCCTGCAGACCCTGCCTGG + Intergenic
1054646763 9:67598762-67598784 CCTGCCCTGCAGACCCTGCCTGG - Intergenic
1055482843 9:76726875-76726897 CCTTCCAGGCAGAGAATACCTGG + Intronic
1056579600 9:87881157-87881179 CCTCCCAACAAGCCACTGCCAGG - Intergenic
1058635154 9:107031438-107031460 CCTCCCAAGCAACCACTGCTAGG + Intergenic
1059595407 9:115714884-115714906 CATTCCAATTAGACACTGTCTGG - Intergenic
1059948491 9:119437726-119437748 CCTTCCAAGCCTACAGTGTCAGG + Intergenic
1061880275 9:133565500-133565522 CATTCCAAGCAGACCTGGCCGGG + Intronic
1062065088 9:134522376-134522398 CCTCCTAAGCAGCCTCTGCCAGG - Intergenic
1186230621 X:7449836-7449858 CCTTCCAGGCATACCCAGCCTGG + Intergenic
1191253452 X:58269933-58269955 CCTTCCCAGCAGCCCCTGCATGG - Intergenic
1192916603 X:75658028-75658050 CCTTCCAAATGGAGACTGCCAGG + Intergenic
1197133778 X:123037000-123037022 CCTGCCAAGCAGAAAATGCAGGG - Intergenic
1197892235 X:131279044-131279066 CCTCCCAACCAGCCACTCCCTGG + Intronic
1199606501 X:149583546-149583568 CCTTCACTGCTGACACTGCCTGG + Exonic
1199632621 X:149785822-149785844 CCTTCACTGCTGACACTGCCTGG - Exonic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic