ID: 901221674

View in Genome Browser
Species Human (GRCh38)
Location 1:7587033-7587055
Sequence CACCACCAGCTCCCCCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 265}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901221666_901221674 -4 Left 901221666 1:7587014-7587036 CCCCATGACCACCTGCACCCACC 0: 1
1: 0
2: 0
3: 38
4: 428
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221661_901221674 3 Left 901221661 1:7587007-7587029 CCCCCGCCCCCATGACCACCTGC 0: 1
1: 0
2: 5
3: 57
4: 692
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221659_901221674 10 Left 901221659 1:7587000-7587022 CCAACCACCCCCGCCCCCATGAC 0: 1
1: 1
2: 7
3: 111
4: 1150
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221667_901221674 -5 Left 901221667 1:7587015-7587037 CCCATGACCACCTGCACCCACCA 0: 1
1: 0
2: 2
3: 37
4: 371
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221668_901221674 -6 Left 901221668 1:7587016-7587038 CCATGACCACCTGCACCCACCAC 0: 1
1: 0
2: 7
3: 70
4: 588
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221665_901221674 -3 Left 901221665 1:7587013-7587035 CCCCCATGACCACCTGCACCCAC 0: 1
1: 0
2: 4
3: 62
4: 604
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221664_901221674 0 Left 901221664 1:7587010-7587032 CCGCCCCCATGACCACCTGCACC 0: 1
1: 1
2: 2
3: 114
4: 1639
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221657_901221674 12 Left 901221657 1:7586998-7587020 CCCCAACCACCCCCGCCCCCATG 0: 1
1: 0
2: 9
3: 100
4: 1146
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221658_901221674 11 Left 901221658 1:7586999-7587021 CCCAACCACCCCCGCCCCCATGA 0: 1
1: 0
2: 1
3: 25
4: 392
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221662_901221674 2 Left 901221662 1:7587008-7587030 CCCCGCCCCCATGACCACCTGCA 0: 1
1: 0
2: 0
3: 23
4: 345
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221660_901221674 6 Left 901221660 1:7587004-7587026 CCACCCCCGCCCCCATGACCACC 0: 1
1: 0
2: 5
3: 176
4: 2095
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265
901221663_901221674 1 Left 901221663 1:7587009-7587031 CCCGCCCCCATGACCACCTGCAC 0: 1
1: 0
2: 4
3: 46
4: 457
Right 901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG 0: 1
1: 0
2: 2
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901221674 Original CRISPR CACCACCAGCTCCCCCAGAA GGG Intronic
900099332 1:954481-954503 CACCACCAACTGCCGCAGACTGG + Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
900628146 1:3618897-3618919 CGGCACCAGCTCCCCCAGGTTGG - Intergenic
900639982 1:3684018-3684040 CCCCACCAGCTCCCACAGCCTGG - Intronic
901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG + Intronic
901688450 1:10957715-10957737 AGCCACCAGCTCCCCTCGAAGGG + Exonic
902097490 1:13958695-13958717 CACCACCAGTTCTCCCAGGCTGG - Intergenic
902783911 1:18720998-18721020 CACCACCTGCTCCCCCATGTTGG + Intronic
903842610 1:26254702-26254724 CTCCAAAAGCTCCCCCAGGAAGG - Intronic
904642370 1:31939996-31940018 CACCACCAGGTGGCCCAGGAGGG + Intronic
905340405 1:37273924-37273946 CACCACTAGCTCCCACAGTTGGG + Intergenic
905926524 1:41753915-41753937 CACCACCCGCTGACCCACAACGG - Intronic
906064900 1:42973641-42973663 CAGCACCAGGTCCTCCAGACTGG - Intergenic
906206921 1:43991895-43991917 CTCCACCAGCTCCCACAGCGAGG - Exonic
907333842 1:53687885-53687907 CGCCACCAGCTCCCCGAGTTGGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
910232193 1:84997770-84997792 CACCACCACCCCCCCGAAAAAGG - Intergenic
911246283 1:95521771-95521793 CATCTCCAGCTCACTCAGAAGGG + Intergenic
911617590 1:100031835-100031857 CACCACCACCTGCCCCTCAATGG + Intergenic
911764890 1:101662003-101662025 CACCACCACTCCCCCCAGCATGG - Intergenic
913283018 1:117203304-117203326 CAGCACCTCCACCCCCAGAATGG - Intronic
914490640 1:148148486-148148508 CACCACCAGCTCCCACCCAGGGG - Intronic
914705419 1:150166173-150166195 CACCACCTGCTGCCCAGGAAAGG + Intergenic
915319095 1:155046385-155046407 CACCACCAGCAGCAGCAGAATGG - Exonic
916382895 1:164233069-164233091 CACAAACAGCTCCCTTAGAAAGG + Intergenic
917751920 1:178061230-178061252 CACCTCCAGCTCCCCGGGGAAGG - Intergenic
918316706 1:183328494-183328516 GATCACCATCTCCCTCAGAAAGG - Intronic
920676687 1:208043058-208043080 TACCTCCAGCTCCCGCAGGACGG + Exonic
921298638 1:213728406-213728428 CACCATGAGCTCCACGAGAAGGG - Intergenic
921496312 1:215846180-215846202 CACCACCAGCACCACCAAAAAGG - Intronic
922774643 1:228209016-228209038 CCCCACGAGCTTCCCCAGGAGGG - Intronic
924819791 1:247478250-247478272 CATCACCAGCTCCCCCATGGTGG - Intergenic
1063149160 10:3321189-3321211 CACCACCACCTTCTCCAGAAAGG - Intergenic
1067571731 10:47376698-47376720 GACCACCAGATCCAGCAGAATGG + Intronic
1067710831 10:48649793-48649815 CACCACCAGCTCCTGCTGGAGGG + Intronic
1068042688 10:51846046-51846068 AAGAACCAGCTCCCCCAAAATGG + Intronic
1068096567 10:52499169-52499191 CCCCACCATCTACACCAGAATGG - Intergenic
1069369383 10:67730466-67730488 CCCCAGCAGCTTCCTCAGAAAGG - Intergenic
1069602632 10:69717790-69717812 TTCCTCCAGCTCCCCCAGGATGG + Intergenic
1069871903 10:71538276-71538298 CGCCACCAGGTCCCCCAGTGAGG + Intronic
1070438012 10:76412546-76412568 CACCATCATCTCACCTAGAAAGG - Intronic
1073057643 10:100712601-100712623 CTCCACCAGGCCCCCCAGAGGGG + Intergenic
1073266726 10:102231986-102232008 CACCCCCAGCTCCCAGAGCACGG - Exonic
1073741709 10:106414996-106415018 CCCTACCACCTCCACCAGAACGG + Intergenic
1074559891 10:114526221-114526243 CACCACCAAATCCCCCAAACAGG + Intronic
1076188747 10:128468366-128468388 CACAACCACATGCCCCAGAATGG + Intergenic
1076352419 10:129826147-129826169 CACCACCTGCTCCCCAGGAGGGG - Intergenic
1076410083 10:130242777-130242799 CACCACAGGCTTCCCCAGGAGGG - Intergenic
1076596681 10:131626588-131626610 CACCAGCAGCTCTTCCAGAGTGG + Intergenic
1076692939 10:132233037-132233059 CACCAGAAGCTCCCCCAGGAAGG - Intronic
1076801622 10:132833660-132833682 CTCCTCCAGATGCCCCAGAACGG + Intronic
1076887632 10:133269832-133269854 CAGCACCGGCTCCCTCAGAGCGG + Intronic
1076979402 11:196632-196654 CACCACCAGGTCCCCCCAACAGG - Intronic
1077191114 11:1256275-1256297 CTCCTCCTGCTCCCCCAGACCGG - Intronic
1077389587 11:2293923-2293945 CACCAACGGCTCCACCAGACTGG - Intergenic
1077551074 11:3200585-3200607 CTCCACCACCTCCTCCAGGAAGG + Intergenic
1077614603 11:3666054-3666076 CAGCCACAGCTCCTCCAGAAAGG - Exonic
1077800035 11:5528025-5528047 GACCACCAGCCCCACTAGAAGGG + Intronic
1077827500 11:5826739-5826761 GTCCTCCAGATCCCCCAGAATGG + Intronic
1083173322 11:60935274-60935296 CAGCGCCTGCTCCCCCAGGATGG - Exonic
1083306370 11:61764110-61764132 CACCCCCAGCTCGCCCAGCTAGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083763516 11:64831491-64831513 CTCCACCAGCTCACCGAGGATGG + Exonic
1084149562 11:67281833-67281855 CACTACCACCTCTCCCAGCACGG + Exonic
1084679695 11:70659715-70659737 CTCCACAAGCACCCCCAGACTGG + Intronic
1085051871 11:73384110-73384132 CACCTCCATCTCCCCCAGTGCGG + Intronic
1087068870 11:94055021-94055043 CCCCTCCAGCTGCCCCAGTAAGG - Intronic
1089551817 11:119285253-119285275 CACCACCACCGCCTCCAGACCGG + Exonic
1089968296 11:122671964-122671986 CACCAGCCGCTGCCCCAGAATGG + Intronic
1090802394 11:130181050-130181072 CACCACCATCTCACCCAAGAGGG - Intronic
1090802420 11:130181145-130181167 CACCACCATCCCACCCAGCAGGG - Intronic
1090802434 11:130181212-130181234 CACCACTATCTCACCCAGCAGGG - Intronic
1092933901 12:13342242-13342264 CACCACTCTTTCCCCCAGAAAGG - Intergenic
1093079271 12:14790499-14790521 CACCACCTGCTCCACCATTACGG - Exonic
1093547912 12:20369496-20369518 CACCAGCAGCGCCAGCAGAAAGG - Exonic
1094821559 12:34230249-34230271 AACCATCAGCTCTCCAAGAATGG - Intergenic
1096234023 12:49913659-49913681 CACCATCACCTCTCCCATAATGG - Intergenic
1096595569 12:52692920-52692942 CACCACAAGCCCCTCCAGGAGGG + Intronic
1096607503 12:52777168-52777190 CTCCACCAGCTCCCCCAGAGCGG + Exonic
1096610203 12:52795922-52795944 CTCCGCCAGCTCCCCCAGAGTGG + Exonic
1096878063 12:54645757-54645779 CACCACCTGCTCCCCGACCAGGG - Intronic
1097189533 12:57212836-57212858 CACCACCAGCTCTCCCAGTGGGG - Exonic
1097521765 12:60679329-60679351 GACTACCAGCTCCCAGAGAAGGG + Intergenic
1097971759 12:65640497-65640519 CACCATCACCACCCCCAGACAGG + Intergenic
1098808156 12:75048262-75048284 CGCCACTATCACCCCCAGAAAGG - Exonic
1102231292 12:111264209-111264231 CTCCAGTACCTCCCCCAGAATGG + Intronic
1103252849 12:119515774-119515796 GACCTCCAGCTTCCCTAGAAAGG - Intronic
1103946213 12:124528129-124528151 CACCACCACCTCCACCACCAAGG + Intronic
1104711230 12:130988158-130988180 TATCAACACCTCCCCCAGAAAGG - Intronic
1105307382 13:19178642-19178664 CACGACCAGCTCCCAGTGAAGGG + Intronic
1105613276 13:21988005-21988027 CAACCCCAGATCCTCCAGAAAGG + Intergenic
1107287783 13:38815059-38815081 CAGCACCAGCTCTGCCACAATGG - Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1112337326 13:98525954-98525976 AACCCCGAGGTCCCCCAGAAGGG - Intronic
1113235726 13:108270476-108270498 CACCTCCAGCTCCCCCAGACTGG - Intronic
1113933680 13:113981962-113981984 CAACGCAAGCTCCTCCAGAAAGG + Intronic
1114282182 14:21203550-21203572 CCTCACCAACTCCCCCAGCATGG - Intergenic
1114615686 14:24067093-24067115 CACCCTCAGCTCACGCAGAAAGG + Intronic
1114616498 14:24071477-24071499 CAGCACCAGCTCCCCCCGCGTGG - Intronic
1115912929 14:38276567-38276589 CACCACCAGCACCCCTGAAAAGG - Intergenic
1116870715 14:50067056-50067078 CATCACCAGCCCTCACAGAAGGG - Intergenic
1118749457 14:68795538-68795560 CACCATCAGGCGCCCCAGAATGG + Intronic
1119648025 14:76362587-76362609 CAGCACCAGAGCCTCCAGAAGGG + Intronic
1120163772 14:81172461-81172483 CACCATCAGATTCACCAGAAGGG + Intergenic
1121735064 14:96212736-96212758 TTCCATCAGCACCCCCAGAAAGG + Intronic
1122209602 14:100166064-100166086 CTCCCCCAACTCCCCCAGACAGG - Intergenic
1122782964 14:104151366-104151388 CTCCACCAGCTCCCCCACCCAGG - Intronic
1122929787 14:104927963-104927985 CTCTACCAGCTCCTCCAGGAAGG + Intronic
1126783039 15:52154844-52154866 CAGCACCACCTACACCAGAAAGG + Intronic
1129205694 15:74035884-74035906 CACCACCCTGTGCCCCAGAAAGG + Intronic
1131550507 15:93353028-93353050 CACCACCACAACCCCCAGACTGG - Intergenic
1131622768 15:94084619-94084641 CACCACCAACTCTCTCAGTATGG - Intergenic
1136016378 16:27403621-27403643 CACAACTAGCTCCACCAGGATGG - Intronic
1136366756 16:29812516-29812538 GATAACCAGGTCCCCCAGAAAGG + Intronic
1136470190 16:30474420-30474442 CACCACAGGCTCCTCCAGACGGG - Intronic
1136791068 16:32968520-32968542 CCCCCCCACCTCCCCCACAAAGG + Intergenic
1137666056 16:50249751-50249773 GCCCACCACCTCCCCCAGCAGGG - Intronic
1137753983 16:50887055-50887077 CCCCACCACCTCCCCCAGGGAGG - Intergenic
1138950715 16:61909176-61909198 CACCAGCAGCTGACACAGAATGG - Intronic
1139103946 16:63802814-63802836 CACCCCCAGCAACCCCAGCATGG - Intergenic
1139227829 16:65250110-65250132 AACCACCTCCTCCCCCAGTAAGG + Intergenic
1139912889 16:70409031-70409053 CACCACCTGCTACCTCAGGAGGG + Intronic
1141193216 16:81840086-81840108 CACCACTAACACCCCCAGCATGG - Intronic
1141503807 16:84462052-84462074 GACCGCCAGCTGCCCCAGGATGG - Exonic
1141961664 16:87413147-87413169 CATCACCAGCTGCCCCGGGAAGG - Exonic
1142009568 16:87706944-87706966 CAGCACCGGCTCCGCCAGGAGGG + Intronic
1142466979 17:141657-141679 CACCACCAGGTCCCCCCAACAGG - Intergenic
1143732009 17:8886709-8886731 CCTCACCAGCTCCCCCTGACTGG - Intronic
1146579063 17:34020811-34020833 CTCCACCAGCTCCTCCAGTAAGG - Intronic
1146977803 17:37130663-37130685 CTCCACCAGCTGCCACAGATAGG + Intronic
1147153340 17:38531096-38531118 CCCCCCCACCTCCCCCACAAAGG + Exonic
1147767207 17:42845021-42845043 CACCACCAGCTCACTCACATTGG - Exonic
1147833676 17:43315120-43315142 TCCCACAAGCTTCCCCAGAAGGG - Intergenic
1148105514 17:45116680-45116702 CACCAGCATGTCCCCCAGGATGG + Exonic
1149639673 17:58194688-58194710 CCTCACCAGCTCTCCCAGAGGGG - Intronic
1150945626 17:69742913-69742935 CACTGCCACCTCCACCAGAACGG - Intergenic
1151826081 17:76525178-76525200 CAGCAGCAGCTCCCTGAGAAGGG - Intergenic
1152526619 17:80891709-80891731 CACCACCAGCTCCTGCCGAGAGG - Exonic
1152726374 17:81948794-81948816 CTCCCCCAGCTCCCACAGCACGG + Intergenic
1152728196 17:81957955-81957977 AACCACCTCCTACCCCAGAATGG + Intronic
1152878302 17:82800918-82800940 CACCCCCAGCTTCCGCAGCAGGG - Exonic
1155872133 18:31042251-31042273 CACCACCAGCTCCACCACCTGGG + Intronic
1156095815 18:33530863-33530885 CATCACCAGATCCCCCACAAAGG + Intergenic
1157563343 18:48663734-48663756 CACCCCCATCTCTTCCAGAATGG + Exonic
1158070395 18:53463135-53463157 CACCTCCACCTCCCACTGAAAGG + Intronic
1159433986 18:68392038-68392060 GACATCCAGCTCCCCCTGAAAGG - Intergenic
1160249656 18:77190507-77190529 AACCACCAGCCCCCCAAAAAAGG - Intergenic
1160988315 19:1850250-1850272 CACCATCACCTCCACCAGAGTGG - Intergenic
1160994978 19:1878340-1878362 CACCACCAGCTCCCACCCAGGGG + Intronic
1162040352 19:7967403-7967425 CACCACAACCTCCATCAGAAAGG - Intronic
1162499591 19:11044594-11044616 CACCAGCACCCGCCCCAGAACGG + Intronic
1163655468 19:18542998-18543020 AACCACCACCGCCCCCAGCACGG + Intronic
1165342589 19:35223629-35223651 CACCTCCAGCTCCCATACAATGG + Intergenic
925207403 2:2018750-2018772 GATCAACAACTCCCCCAGAAAGG + Intronic
926133307 2:10319121-10319143 CACCTCCTGCTGCCCCAGCACGG + Intronic
927154503 2:20213707-20213729 CCCCACCAGGTCCCCTGGAATGG + Intronic
927195199 2:20542042-20542064 CCCCATCAGCTCCCACAAAATGG - Intergenic
927878191 2:26672847-26672869 CACCACCGTCACCCCCAGTAAGG + Intergenic
929821880 2:45280818-45280840 CACCACCACCACCACCAGGAGGG + Intergenic
931981224 2:67695784-67695806 CACATCCAGTTCCCCCAGAAAGG + Intergenic
932578147 2:72973947-72973969 CACCACCGCCACTCCCAGAAAGG + Intronic
936348587 2:111694886-111694908 AATCACCAGAGCCCCCAGAAAGG - Intergenic
936998260 2:118437634-118437656 AACCACTAGCTCCTCCAGTAGGG - Intergenic
937274632 2:120675799-120675821 CTCCTCCAGCTCCCGCAGATTGG + Intergenic
937936386 2:127249104-127249126 CACCACCTGCTCCACCATTATGG + Intergenic
938540434 2:132280322-132280344 CACCACCAGCACCCCCTCACGGG + Intergenic
938895147 2:135742173-135742195 CGCCGCCAGATCCCCCAGAGGGG + Intronic
939568132 2:143808868-143808890 CACAACCACCTCTCTCAGAAAGG - Intergenic
940203360 2:151175652-151175674 CACAACCAGCTCCCTGAGGAGGG + Intergenic
940292426 2:152090259-152090281 CTCCACCTGCTGCCCCAGACAGG - Intronic
945047630 2:205795890-205795912 CACCACCAGAAGCCCCACAAGGG - Exonic
945434516 2:209803344-209803366 GACCACCAGCACCTCCACAAGGG + Intronic
945482960 2:210364050-210364072 CAGCACCAGCTCACCTAGATTGG - Intergenic
946999446 2:225436911-225436933 CACCACCAGCTCCCACTTGAAGG - Intronic
1169023847 20:2350614-2350636 CATCACCATTGCCCCCAGAATGG + Intergenic
1171382791 20:24746123-24746145 CACCACCTGGCCCCCAAGAATGG - Intergenic
1171869357 20:30513327-30513349 CACCACCAGCTCCCCCTCACGGG + Intergenic
1171970419 20:31561550-31561572 CTTCCCCAGCTCCCTCAGAAGGG + Intronic
1172783029 20:37448425-37448447 CACCTCCAATTCCCCCAAAAAGG + Intergenic
1173341163 20:42154203-42154225 CACCACAGGCAACCCCAGAAAGG - Intronic
1173497413 20:43529577-43529599 CTCCTCAAGCTCCCCCAGAGTGG - Intronic
1173675943 20:44835804-44835826 CACCACCTGCTTCCCAGGAAGGG + Intergenic
1174786379 20:53437002-53437024 AAACACCACCTCCTCCAGAAAGG + Intronic
1175994742 20:62807044-62807066 CACCACCTGTAGCCCCAGAAGGG - Intronic
1176272874 20:64245524-64245546 CACCCCCTGCCCCCCCAGCAAGG - Intergenic
1176294000 21:5060918-5060940 CACCAGCCTCTCCCCCAGGAAGG - Intergenic
1176876059 21:14130428-14130450 CACCACCACCTCGCCAAGGAAGG + Intronic
1177940134 21:27399867-27399889 CACAACCAGCGTCCCCAAAATGG - Intergenic
1179574107 21:42296262-42296284 CACGTCCAGCTCCCGCAGGATGG - Exonic
1179863259 21:44202730-44202752 CACCAGCCTCTCCCCCAGGAAGG + Intergenic
1179967095 21:44813610-44813632 CGCCACCTGCAGCCCCAGAATGG + Intronic
1180963851 22:19775700-19775722 CACCACTAGCTCCTTCAGACAGG - Intronic
1181121034 22:20668874-20668896 CACCACCAGCTCCCACCCAGGGG + Intergenic
1181334000 22:22115900-22115922 CACCACCAGCTCCCACCCAGGGG + Intergenic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1183001111 22:34859898-34859920 CACCACCATCTCCCCCACCAAGG - Intergenic
1183107913 22:35627900-35627922 AAACCCCAGCTCCCCCAGGAAGG + Intronic
1184191838 22:42900138-42900160 CACCACCTGCACCCACAGACAGG + Intronic
1184248836 22:43249008-43249030 CTCCACCAGCACCCCCTGACTGG - Intronic
1184279359 22:43428257-43428279 CACCACCACCTCCGGCAGAGGGG + Intronic
1184333895 22:43842000-43842022 CAACACCTGCTGCCCAAGAAGGG + Intronic
1184632089 22:45789666-45789688 CACCACCACCACCACCACAAAGG - Intronic
1184837465 22:47032394-47032416 CCACACCAGGTCCCCCAGACTGG + Intronic
1185096052 22:48806634-48806656 CACCACCACCTGCCCCAGTCAGG - Intronic
1203247496 22_KI270733v1_random:85032-85054 CACCTCCCTCCCCCCCAGAAGGG + Intergenic
949938780 3:9137436-9137458 CACTACCAGCTCCTCCAAAAAGG + Intronic
950080725 3:10220191-10220213 CACCAACAGCTACACAAGAAGGG - Intronic
952385198 3:32836111-32836133 CCCCGACAGCTCCCCCAGCAAGG + Intronic
953298581 3:41748915-41748937 AACCACCACCATCCCCAGAATGG - Intronic
954138315 3:48592454-48592476 CTCCCCCAGCTGCCCTAGAAGGG - Exonic
954748557 3:52800825-52800847 CTCCACCACCTGCCCCACAAGGG + Intronic
955347016 3:58168689-58168711 CACAACCAGCTCCCCAGGAAGGG - Intronic
956084864 3:65597948-65597970 CGCCCCCAGCTCTCCCAGGAAGG - Intronic
959257439 3:104032340-104032362 TAGCACCAGCTCCCTCAGATAGG + Intergenic
960142247 3:114162448-114162470 CACCCCCAGCTCCCAGAGCAGGG + Intronic
961755834 3:129126912-129126934 GCCCACCTGCTCCACCAGAAAGG - Intronic
963296099 3:143548286-143548308 CACCCCCACCACCCCCAGACAGG - Intronic
966157428 3:176932208-176932230 CACCACCATCTTCCACAGACTGG + Intergenic
968879032 4:3289098-3289120 CACAACCAGGTCCCCAAGTAAGG + Intergenic
972165735 4:36281857-36281879 CCCCACCAGCCCCCTCACAAAGG - Intronic
972623732 4:40775279-40775301 CACTAGCATCTTCCCCAGAAAGG - Intronic
974081686 4:57220400-57220422 CTCCACCAGCTCCCATAGCAGGG + Intergenic
974081807 4:57221708-57221730 CTCCACCAGCTCCCATAGCAGGG - Intergenic
975328902 4:73091466-73091488 CACCACCAGCCCAGCCAGGAGGG - Exonic
976186580 4:82448552-82448574 CACCCCCAGCCCACCCAAAAAGG + Intronic
978419501 4:108515063-108515085 AAGCACCAGCTTCCACAGAATGG - Intergenic
980342409 4:131567595-131567617 CACAACCATGTCCCCCAAAAAGG - Intergenic
981450138 4:144887439-144887461 CCCCACCAGCTACCCCAGGATGG + Intergenic
981664601 4:147208827-147208849 CCCCACCAGCTCTCTCAAAACGG + Intergenic
985531094 5:434205-434227 CAGCACCAGCTCCCTCAGCCTGG + Exonic
985936791 5:3103459-3103481 CCCCAGCAGGTCCCCCAGGATGG + Intergenic
986346150 5:6837206-6837228 CACCTCCATCTCCCCCAGATTGG + Intergenic
990890431 5:60643250-60643272 CACCACCAGCCCCTCAAAAAGGG + Intronic
993047854 5:82888739-82888761 TGCCACCAGCACCTCCAGAATGG - Intergenic
994729644 5:103476728-103476750 CACCACCCCCTTCCCCAGGATGG + Intergenic
997962542 5:138333430-138333452 CAGAACCTGCTTCCCCAGAAAGG + Intronic
999879130 5:155841556-155841578 GACCACCAACCCCCCCAAAATGG - Intergenic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1002575726 5:180172690-180172712 CACGCCCAGCTCCCCAAGAGGGG + Intronic
1002837609 6:878396-878418 CACCACTAGCTCAACCAGAGAGG + Intergenic
1002952068 6:1823899-1823921 CACCACTTGCTACACCAGAATGG + Intronic
1006054054 6:31367492-31367514 CAGCCCCAGGACCCCCAGAAGGG - Intergenic
1006162955 6:32048598-32048620 CACCGCCAGCTCCCCCAGGCGGG + Intronic
1007492268 6:42232691-42232713 CACCACCATCTTCCCCTGCAAGG - Exonic
1015989013 6:138915922-138915944 CACCACCACCTCCCCCTCCAAGG - Exonic
1024435055 7:49342337-49342359 CACCACCAGCTCACCCTTGAGGG + Intergenic
1024536791 7:50441664-50441686 CACCACCAGCTCCCCAACTAAGG + Intergenic
1024623993 7:51188562-51188584 CACCACGAGCTTCCCCACCATGG - Intronic
1026359688 7:69591756-69591778 CACCCTCAGGCCCCCCAGAAAGG - Intergenic
1028527648 7:91803044-91803066 CACCTCTAGAGCCCCCAGAAAGG - Intronic
1028985583 7:97006245-97006267 CACCACCAGCACCACCACCACGG + Exonic
1029604725 7:101591466-101591488 CAGCACCAGGTGGCCCAGAATGG + Intergenic
1032705494 7:134418074-134418096 CACCAGCAGCTCCCCGACCAGGG - Intergenic
1033243506 7:139700194-139700216 AACCCCCAGCTCCTCTAGAAAGG - Intronic
1033920693 7:146387783-146387805 CTCCACCAGCTTCCTAAGAAAGG + Intronic
1035249958 7:157590678-157590700 CACCAGCCTCTCCCCCAGCATGG - Intronic
1035882901 8:3261702-3261724 CCCCATCAGCACCCACAGAAAGG + Intronic
1035985843 8:4430879-4430901 CAGCACCAGCTTCTCCTGAATGG + Intronic
1036106713 8:5848704-5848726 CACCTCCAGCTCACTCACAAAGG - Intergenic
1040015514 8:42696128-42696150 GACCACCAGCTCCTGCAGGAGGG - Intergenic
1040472102 8:47742401-47742423 CTGCACCTGCTCCCCCAGGAAGG + Intergenic
1041201064 8:55452330-55452352 CACCACCTTCTCCCCCACCAGGG + Intronic
1042201379 8:66282188-66282210 CACCTCCAGCTCCTCCTGCAGGG - Intergenic
1046230443 8:111348543-111348565 CCCCACCGCCTCCCCCAAAATGG - Intergenic
1048266448 8:132991554-132991576 CACCATGAGCTCCCTCAAAATGG - Intronic
1049162939 8:141109310-141109332 CACCACCATCACCTCCAGAACGG + Intergenic
1049288230 8:141788124-141788146 CTCCACCCGCATCCCCAGAAAGG + Intergenic
1050290317 9:4147665-4147687 CACCAGCAGTTCCCCTTGAAGGG - Intronic
1053362935 9:37502416-37502438 CACCACCAGCTCTCCCAGTTGGG - Intronic
1053444966 9:38145879-38145901 CAGCTCCAGCTGCCCCAGTAGGG - Intergenic
1053538276 9:38947409-38947431 CTTCTCCAGGTCCCCCAGAAAGG + Intergenic
1054627857 9:67416510-67416532 CTTCTCCAGGTCCCCCAGAAAGG - Intergenic
1056756998 9:89388114-89388136 CAGCACCAGCTCCCTCCCAAGGG - Intronic
1057227011 9:93297779-93297801 CACCGCCAGCTCCTCCAGGAGGG - Intronic
1057303427 9:93899428-93899450 CACTCCCAGCTCCTCCTGAAGGG + Intergenic
1057439591 9:95073270-95073292 CAGCTCCAGCTCCCCAAGATGGG - Intronic
1057796350 9:98160735-98160757 CATCACCAGCTGCCACAGACAGG - Intronic
1060585514 9:124782912-124782934 CTCCACCCACTCCCCCAGATGGG - Intronic
1061416100 9:130447651-130447673 CCCCACCACATCCCCCAGAAAGG - Intronic
1061452390 9:130675349-130675371 CAGCCCCATCTCCCCCAGAAGGG - Intronic
1061902528 9:133680375-133680397 CACGGCCAGCTCCCCCTGTAGGG - Intronic
1062000049 9:134211373-134211395 CAGCCCCAGCACCCCCAGCAAGG - Intergenic
1203463904 Un_GL000220v1:68267-68289 CACCTCCCTCCCCCCCAGAAGGG + Intergenic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1190308747 X:49101780-49101802 CACCACCAACTACCCCTGGACGG - Intergenic
1192237894 X:69307444-69307466 CACCAGGAGGCCCCCCAGAAGGG - Intergenic
1192264583 X:69529995-69530017 CAGCTCCAGCTCCCCCAGGTTGG + Exonic
1200101712 X:153691760-153691782 CAGCCCCAGCTCCCCCATCAGGG - Intronic
1200413784 Y:2887404-2887426 CACCACCACCACCCCCACACTGG - Intronic
1201568071 Y:15386877-15386899 CACCACCACCTCCTCCTGATTGG + Intergenic