ID: 901221857

View in Genome Browser
Species Human (GRCh38)
Location 1:7587935-7587957
Sequence CCATCTGGGCCGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901221857_901221865 -7 Left 901221857 1:7587935-7587957 CCCGCCTCCCTCGGCCCAGATGG 0: 1
1: 0
2: 1
3: 33
4: 290
Right 901221865 1:7587951-7587973 CAGATGGCAGCTGTAGCTTCTGG 0: 1
1: 0
2: 4
3: 24
4: 225
901221857_901221870 27 Left 901221857 1:7587935-7587957 CCCGCCTCCCTCGGCCCAGATGG 0: 1
1: 0
2: 1
3: 33
4: 290
Right 901221870 1:7587985-7588007 CTTGATCCCCTATCGGTGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 46
901221857_901221868 20 Left 901221857 1:7587935-7587957 CCCGCCTCCCTCGGCCCAGATGG 0: 1
1: 0
2: 1
3: 33
4: 290
Right 901221868 1:7587978-7588000 ACAGGTCCTTGATCCCCTATCGG 0: 1
1: 0
2: 0
3: 8
4: 85
901221857_901221867 2 Left 901221857 1:7587935-7587957 CCCGCCTCCCTCGGCCCAGATGG 0: 1
1: 0
2: 1
3: 33
4: 290
Right 901221867 1:7587960-7587982 GCTGTAGCTTCTGGGAGAACAGG 0: 1
1: 0
2: 0
3: 26
4: 206
901221857_901221866 -6 Left 901221857 1:7587935-7587957 CCCGCCTCCCTCGGCCCAGATGG 0: 1
1: 0
2: 1
3: 33
4: 290
Right 901221866 1:7587952-7587974 AGATGGCAGCTGTAGCTTCTGGG 0: 1
1: 0
2: 1
3: 32
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901221857 Original CRISPR CCATCTGGGCCGAGGGAGGC GGG (reversed) Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
900823970 1:4911582-4911604 CAAGCAGGGCCCAGGGAGGCAGG + Intergenic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901239416 1:7684280-7684302 CCATCTGGCCCGCAGGTGGCAGG - Intronic
901449080 1:9325240-9325262 CCATCTGCACCGGTGGAGGCGGG - Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
904585450 1:31577264-31577286 GCATCCGGGACGCGGGAGGCCGG + Exonic
904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG + Intergenic
904910251 1:33929237-33929259 GCATCTTGGTCGAGGGTGGCCGG - Intronic
905064910 1:35172276-35172298 CCATCTTGGGCGGGGGAGGCGGG - Intergenic
905239101 1:36571087-36571109 ACAGCTGGGCTGAGGCAGGCAGG - Intergenic
905242390 1:36589282-36589304 CCATCTGAGCCCAGGAAGCCAGG + Intergenic
905321529 1:37120637-37120659 CCAGGTGGGCCTGGGGAGGCGGG + Intergenic
905388854 1:37623432-37623454 CCACCCGGGACGAGGGAGGCAGG + Intronic
905676843 1:39832240-39832262 CCATCTTAGCCTAGGGAGGTTGG - Intergenic
906243386 1:44256468-44256490 CCATCTGGGGTTAGGGAGGATGG - Intronic
906313021 1:44767312-44767334 GCATCTGGGCCCAGGGCAGCTGG + Exonic
906430244 1:45750372-45750394 CCAGTTGGGGCGGGGGAGGCAGG + Intronic
906445065 1:45889269-45889291 CCACCTGAGCCCAGGAAGGCTGG - Intronic
906518295 1:46452478-46452500 CCCTCTGGACCATGGGAGGCAGG - Intergenic
908370328 1:63473553-63473575 CCATCTGGGAGGGGGGAGGGGGG + Intronic
908714865 1:67058811-67058833 CCATCTGCCCCAAAGGAGGCAGG - Intergenic
908829906 1:68168487-68168509 CCATCTAGTCCCAGGGTGGCTGG + Intronic
911078950 1:93909314-93909336 CGCTCGGGCCCGAGGGAGGCCGG + Exonic
912735324 1:112145097-112145119 CCAGCTGGGCAGGGGGAGGATGG + Intergenic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
917516686 1:175714449-175714471 CCAGCTGGGGTGAGGGAGGGAGG - Intronic
918056124 1:181023174-181023196 CCTCCAGGGCCGAGGGACGCAGG - Intergenic
918453490 1:184683879-184683901 ACACCTGGGCCCTGGGAGGCTGG - Intergenic
919573088 1:199272847-199272869 CCAGCTGGGCTGAGGGCTGCTGG - Intergenic
920655433 1:207870760-207870782 GGATCTGGGCCTAGTGAGGCTGG - Intergenic
920805591 1:209231500-209231522 CCCTCTGGGCCGAGTGGCGCCGG - Intergenic
920860788 1:209704822-209704844 ACATCAGGGACGGGGGAGGCTGG - Intronic
921051624 1:211515505-211515527 CCCTCCGGGCCGAGGGTCGCGGG + Intergenic
922235219 1:223717573-223717595 CCATCAGGGCCCAGGGAGCAGGG + Intronic
922755332 1:228093445-228093467 ACATATGGGCAGAGGGTGGCTGG - Intronic
924384264 1:243487803-243487825 CTACCTGTGCCGGGGGAGGCGGG - Intronic
924546292 1:245030973-245030995 GTATCTGTGCCTAGGGAGGCAGG + Intronic
1062908336 10:1195058-1195080 CCACCTTGGCCCTGGGAGGCAGG + Intronic
1063251826 10:4282331-4282353 CCATCAGGACTGTGGGAGGCAGG - Intergenic
1064841720 10:19599948-19599970 CCATCTGGGCCCTGGAAGGCTGG - Intronic
1065656571 10:27957362-27957384 CCATCGGGGCAGAGGTAGGGAGG + Intronic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1068965995 10:62912636-62912658 CCATCTGGTCCGAGGCAGCTGGG - Intronic
1070304872 10:75234242-75234264 CCAACCGGGCCGTGGGAGGCGGG + Intronic
1070963675 10:80516542-80516564 CCCTCTGGGCGGGGGCAGGCTGG + Intronic
1072307548 10:94121934-94121956 CCAGCTGGGCAGAGAGAGGAAGG + Intronic
1072635274 10:97173878-97173900 CCCCCTGGGCCAAGGCAGGCTGG - Intronic
1075714104 10:124546020-124546042 CCAGCTTGGCAGAGGGAGGGAGG - Intronic
1076594544 10:131617675-131617697 CCACCTGGGCTGCGAGAGGCTGG - Intergenic
1076871895 10:133198581-133198603 CCTCCTGGGCCAAGGCAGGCTGG - Exonic
1076874877 10:133211086-133211108 CCATGGGTACCGAGGGAGGCTGG - Intronic
1077133417 11:986480-986502 GCATCAGGCCCGCGGGAGGCCGG - Intronic
1077214012 11:1387727-1387749 ACAGCAGGGCCAAGGGAGGCTGG + Intergenic
1077442075 11:2573583-2573605 GCAGCTGGGCCTAGGGAAGCAGG + Intronic
1077479357 11:2806395-2806417 CCATGTGGCCCCAGGCAGGCTGG - Intronic
1077506913 11:2933806-2933828 CCACCTGAGCCTGGGGAGGCTGG + Intergenic
1077554898 11:3221185-3221207 CCCTCTGTGCCCAGTGAGGCTGG + Intergenic
1077755255 11:5021810-5021832 CCATCTGTGCCTCTGGAGGCAGG - Intergenic
1077836869 11:5933792-5933814 CCATCTTGGCTGGGGGAGTCAGG - Intronic
1080655185 11:34252802-34252824 CCAGCTGGGCCAGAGGAGGCTGG + Intronic
1080796159 11:35565558-35565580 CCAGCTGGGCAGAATGAGGCAGG + Intergenic
1081276011 11:41149626-41149648 CTATCTGTGCCCAGGAAGGCAGG - Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083857493 11:65400370-65400392 CCATCTGTGTCCTGGGAGGCAGG + Intronic
1084005196 11:66318918-66318940 CCACCTGGGCCGGGGGTGGGTGG - Intergenic
1084051952 11:66605779-66605801 CCATCTGGGAGGAGCGAGGCCGG + Exonic
1084122518 11:67077814-67077836 CTATCTGGGAGGAGGGAGGCGGG + Intergenic
1084315437 11:68342913-68342935 CCAGCCCAGCCGAGGGAGGCAGG - Intronic
1084362756 11:68679675-68679697 ACATCAAGGCCGAGGGAGCCTGG - Intergenic
1088240651 11:107770581-107770603 CCATCTGACCCAAGGAAGGCTGG + Intergenic
1090331039 11:125932482-125932504 CCGCCTGAGCCCAGGGAGGCAGG + Intergenic
1090354103 11:126128036-126128058 CCACCTGAGCTGTGGGAGGCAGG + Intergenic
1090794775 11:130125253-130125275 CACTCTGGTCCCAGGGAGGCTGG + Intronic
1091239250 11:134041637-134041659 CCACCTGGGTCGTGTGAGGCAGG - Intergenic
1091412594 12:253946-253968 TCATCTGGGCTGAGATAGGCAGG + Intronic
1091454947 12:599948-599970 GCAGCTGGGCAGAAGGAGGCGGG - Intronic
1092169405 12:6363785-6363807 TCATCTGTGCCCCGGGAGGCCGG + Intronic
1092229379 12:6768194-6768216 CCATCTGGGCTGATGCAGGGAGG - Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1097196136 12:57243336-57243358 CCATCTGGGCTGAGGTTGGCGGG - Intergenic
1102626462 12:114239331-114239353 CCATCTGTGTCCTGGGAGGCTGG + Intergenic
1102896055 12:116599514-116599536 CAATCTGGGCCAGGGGAGGCTGG + Intergenic
1103583347 12:121932963-121932985 CCCTCTGGCCCTAGTGAGGCTGG - Intronic
1103926650 12:124427134-124427156 CCAGCTGGGCCCAGGGAGCCCGG + Intronic
1103951571 12:124554376-124554398 CCAGCTGGGTGGTGGGAGGCTGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105378433 13:19864513-19864535 CCATCTTGGTTGATGGAGGCGGG - Intergenic
1105388777 13:19957830-19957852 CCATCTTGGTTGATGGAGGCGGG + Intergenic
1109527470 13:63595952-63595974 CCAGCATGGCCGAGTGAGGCTGG - Intergenic
1111132917 13:83999642-83999664 CCATCTAGACCGAGGGGAGCAGG - Intergenic
1112580878 13:100675144-100675166 CCAGCTGGGTCGGGCGAGGCTGG + Intergenic
1117221265 14:53608883-53608905 CCATCTGGGCAGAGAAAGGCTGG - Intergenic
1118821769 14:69350543-69350565 CCATGTGGGCCCAGAGAGGCTGG + Intronic
1119408455 14:74412915-74412937 CCATGTGGGCTGAGGCATGCAGG + Intronic
1119749672 14:77068314-77068336 CCACCTGGGCCCAGGTAGGGGGG - Intergenic
1121259072 14:92553233-92553255 CTAACTGGCCCGGGGGAGGCTGG + Intronic
1122397533 14:101444166-101444188 CCATGTGGGTAGAGGAAGGCGGG - Intergenic
1122624147 14:103075610-103075632 CCGGCTGTGCCGGGGGAGGCTGG + Intergenic
1122889127 14:104724506-104724528 CCGTCTGGGTCGGGGGAGGGGGG - Intronic
1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG + Intronic
1122954883 14:105065985-105066007 CCATGTAGGAAGAGGGAGGCGGG - Intergenic
1124109357 15:26772608-26772630 CGGCCTGGGCGGAGGGAGGCGGG - Intronic
1125711503 15:41790786-41790808 CCATCTGGTCAGAGGTAGGCAGG - Intronic
1126167998 15:45669824-45669846 CCATGTGGTCTAAGGGAGGCAGG - Intronic
1127497033 15:59523135-59523157 ACACCTGGGAAGAGGGAGGCGGG + Exonic
1128344909 15:66847677-66847699 GGATGTGGGCCAAGGGAGGCTGG - Intergenic
1129107661 15:73320566-73320588 CCATCTGGGAGGAGGGAGGATGG + Exonic
1129114664 15:73358513-73358535 CCTTCTGGGCCTAGTAAGGCAGG + Intronic
1129714523 15:77839495-77839517 CCATCTGGGAGGATGGAGGAGGG + Intergenic
1129846802 15:78771559-78771581 CCGCCTGGGCCACGGGAGGCAGG + Intronic
1130597168 15:85256273-85256295 CCACCTGGGAAGTGGGAGGCTGG - Intergenic
1130910637 15:88268503-88268525 CCATCTGGGGTAAGGGATGCAGG - Intergenic
1130924494 15:88375031-88375053 CCACCTGGGCCAAGGTGGGCAGG + Intergenic
1131277473 15:90994270-90994292 CAGTCGGCGCCGAGGGAGGCCGG - Intronic
1131312789 15:91306058-91306080 CCATCAGGTCAGAGGGAGACAGG + Intergenic
1131783249 15:95883080-95883102 CCAGCTTGGCTGAGGGAGGGTGG - Intergenic
1133038941 16:3049707-3049729 CCACCAGGGCCCAGGGAAGCTGG + Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1137727824 16:50668960-50668982 CCAGCTGGGCCTAGGGGTGCAGG - Intronic
1139306810 16:65993613-65993635 CCATCTGTGCCAAGGGTGCCAGG - Intergenic
1140473723 16:75228430-75228452 CCATCTGGGCTGCGGGCTGCTGG + Intronic
1141562654 16:84879788-84879810 CCATCTGGCCCCAGGCAGGCAGG - Intronic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1141954196 16:87359305-87359327 CCATCCGGGCATAGGCAGGCAGG - Intronic
1141959103 16:87392596-87392618 CCGGCGGGGCCGAGGGATGCGGG + Intronic
1142125827 16:88409856-88409878 CCATCTTGGCCGGGGGGGGGGGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143486988 17:7260780-7260802 CCATCTGGGAGGAGCAAGGCTGG - Intronic
1143544380 17:7587973-7587995 CCAGCCGGGCTGAGGGAGGGAGG - Exonic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1144680094 17:17187459-17187481 CCATCTGGGTCAAGGAAGTCTGG + Exonic
1144738233 17:17566764-17566786 CCAACTGGGCGCAGGGGGGCAGG + Intronic
1144847352 17:18226762-18226784 ACATCAGTGCAGAGGGAGGCGGG - Intronic
1145202494 17:20959199-20959221 TCATCTGGGCAGTGTGAGGCAGG - Intergenic
1147322843 17:39656585-39656607 CCATCTGGGCTGATGGGGGGTGG - Intronic
1148836997 17:50470568-50470590 CTAGCTGGGCCAAGGCAGGCTGG + Intronic
1148853283 17:50565066-50565088 CCATCCTGGCTGAGGCAGGCAGG - Intronic
1148858599 17:50592452-50592474 CCCTCTGAGCCGAGGGGTGCAGG + Intronic
1150249354 17:63697706-63697728 CCATCAGGGCCGAGGTAGTCGGG + Exonic
1150489045 17:65561778-65561800 CCCTCGGGGCCGCGGGGGGCTGG - Intronic
1151337002 17:73445930-73445952 CCAGCTGGCCCCAGGGAGGTGGG - Intronic
1151823809 17:76512518-76512540 ACATCTGGGCCAAGGGAGAAAGG - Intergenic
1152026195 17:77811031-77811053 ACATCTGGGCACATGGAGGCTGG - Intergenic
1152418946 17:80181680-80181702 CCATGTGGGCCACGGGAAGCTGG - Intronic
1154217228 18:12423944-12423966 CCAGCTGGGCAGAGTGTGGCTGG - Intronic
1160333683 18:78018128-78018150 CCAGCTGGGCTGTGGGGGGCAGG + Intergenic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1160962628 19:1730322-1730344 CCCCCTGGGCCGATGGAGGTGGG - Intergenic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161327216 19:3669712-3669734 CCATGGGGGCCGAGGGGCGCTGG - Intronic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1163666501 19:18606297-18606319 GCAGCTGGGCCGAGGGCGCCAGG - Intronic
1163716960 19:18878471-18878493 CCATCTGGGCCGAGACATCCTGG - Exonic
1163856577 19:19707225-19707247 CCATCTGGGGCGAGGTCTGCTGG - Intergenic
1164564624 19:29316966-29316988 CCATCTGAGCCATGGGAGCCTGG - Intergenic
1165902968 19:39177412-39177434 CTACCTGGGCTGAGGGAGGGAGG + Intronic
1165939858 19:39409698-39409720 CCCACGGGGCCGCGGGAGGCGGG + Intergenic
1167038570 19:47008687-47008709 CCATCTTGGCTGGGGGAGTCAGG - Intergenic
1167208932 19:48121241-48121263 CTACCTGGGCCGGGGGAAGCGGG - Exonic
1167399477 19:49255444-49255466 CCAGCAGGGCCAAGGGAGGCAGG - Intergenic
1167425375 19:49427465-49427487 CAATCCGGGCTGAGGGAGGAGGG - Exonic
925107655 2:1306661-1306683 ACACCCTGGCCGAGGGAGGCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925398908 2:3558075-3558097 GCATCGGGGTCGAGGGAGGCCGG - Intronic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926749283 2:16185794-16185816 GTATCTGGGCCTAGGCAGGCTGG + Intergenic
927709044 2:25313981-25314003 GCATCTGGGCGCCGGGAGGCAGG + Exonic
928656285 2:33455001-33455023 TCATCTGGGCCAAGGTAGGGGGG + Intronic
929779773 2:44949956-44949978 CCGTCTGGCCCGAGGGAGGGCGG + Intergenic
930479206 2:51926003-51926025 CCAACTGTGCAGAGGGAGCCTGG + Intergenic
930797623 2:55409663-55409685 GCATGTGGGCCGAGGAGGGCCGG - Intronic
931773883 2:65523335-65523357 CCATCTGAGACCAGGGTGGCAGG - Intergenic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
933130978 2:78673716-78673738 CCATCTGGAAAGAGGGAAGCAGG + Intergenic
934150241 2:89140185-89140207 TCATTAGGACCGAGGGAGGCTGG - Intergenic
934217053 2:90041849-90041871 TCATTAGGACCGAGGGAGGCTGG + Intergenic
934761571 2:96859654-96859676 CTCTCTGGGTGGAGGGAGGCTGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936271655 2:111053840-111053862 CCAGCTTATCCGAGGGAGGCAGG - Intronic
937738435 2:125319272-125319294 CCACCTGGGGCCATGGAGGCTGG + Intergenic
937986491 2:127640431-127640453 GCAGCTGGGCCCTGGGAGGCAGG - Intronic
938063116 2:128267399-128267421 CCAGTTGGCCCGAGGAAGGCCGG + Exonic
943715965 2:191152132-191152154 CCGTCAGGGAAGAGGGAGGCAGG - Intergenic
944541040 2:200753936-200753958 CCATCAGAGCCTAGGAAGGCAGG + Intergenic
946246965 2:218393313-218393335 CCATCTGGGGGGTGGGAGGGGGG - Intronic
947324934 2:228963586-228963608 CCATCTGGTCCTTGGGAGCCAGG + Intronic
948426953 2:237894562-237894584 CCATCTGGGGCGGGGGATTCAGG - Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169273216 20:4216532-4216554 CCACTTGGGCCGAGGGAGCACGG + Intergenic
1170947943 20:20908846-20908868 TCATCTGGGCCAAGCGACGCAGG + Intergenic
1172650240 20:36497397-36497419 CCAGCTGACCCGTGGGAGGCGGG + Intronic
1173741668 20:45406429-45406451 CCGGCTGGGCGGAGGGAGGAAGG + Intronic
1174447190 20:50598021-50598043 CCAGCGGGGACCAGGGAGGCAGG + Intronic
1175074755 20:56363031-56363053 CCATCCTGGCCGGGGGTGGCAGG + Intronic
1175405220 20:58721758-58721780 CCACCTGTGCCCCGGGAGGCAGG + Intergenic
1176388869 21:6153549-6153571 CCACCTGTGCCCAGGTAGGCAGG - Intergenic
1176410230 21:6445760-6445782 CCATGGGGGCCCAGGGTGGCTGG + Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1179565545 21:42245609-42245631 CCATGTGGTGTGAGGGAGGCAGG + Intronic
1179685723 21:43054082-43054104 CCATGGGGGCCCAGGGTGGCTGG + Intronic
1179734603 21:43384699-43384721 CCACCTGTGCCCAGGTAGGCAGG + Intergenic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180147536 21:45929624-45929646 CCAGCTGGTGAGAGGGAGGCTGG + Intronic
1180847049 22:18989213-18989235 CTGTCTGGGTCGGGGGAGGCAGG + Intergenic
1180853358 22:19032385-19032407 CCAGCAGGGCACAGGGAGGCTGG - Intergenic
1181235161 22:21444189-21444211 CCATCTGGGCCTAGGAAAGGTGG - Intronic
1181585350 22:23849877-23849899 TTACCTGGGCCTAGGGAGGCAGG - Intergenic
1181734121 22:24868548-24868570 TCATCGGGACCCAGGGAGGCTGG + Intronic
1182316338 22:29449740-29449762 CCAGCAGGGCCCATGGAGGCAGG + Intergenic
1182432867 22:30310888-30310910 CCCTCTGTGCCGAGAAAGGCAGG + Intronic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1183015601 22:34983946-34983968 CCGTCTTGGCCGAGACAGGCTGG + Intergenic
1183705214 22:39471598-39471620 CCATCTCTGCAGAGGAAGGCCGG - Intronic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1184865849 22:47201602-47201624 GCTTCTGGGCCGAAGGGGGCGGG - Intergenic
1185205555 22:49535895-49535917 CCATGGGGGCCCCGGGAGGCTGG + Intronic
949754301 3:7391906-7391928 CCATCAGGGCCTGGGGAGCCTGG - Intronic
950098790 3:10345033-10345055 CCACGAGGGCAGAGGGAGGCAGG - Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954414921 3:50388636-50388658 CCAGCTGGGCCTTGGGAAGCGGG - Intronic
954709506 3:52498357-52498379 CCAGCTGGGTGGAGTGAGGCTGG - Intronic
954787332 3:53103624-53103646 CCCTCTGGGGTGAGGGAGGAAGG - Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
958729044 3:97940794-97940816 CCAGCTGTGCTGAGGGAGGTAGG - Intronic
960495897 3:118374697-118374719 CCACCTGAGCCAAGGGAGGCAGG + Intergenic
960806930 3:121593063-121593085 CCAGCTGTGCTGAAGGAGGCTGG - Intergenic
962000118 3:131287081-131287103 CCATCTGTGCCCATGGAAGCTGG + Intronic
963400473 3:144791146-144791168 CCTCCTGGAGCGAGGGAGGCTGG - Intergenic
968267680 3:197375280-197375302 GCATCTGGGCTCAGGGAGACAGG + Intergenic
968673425 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG + Intergenic
969715141 4:8864712-8864734 CCAACTGGGCGCAGGGAAGCTGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971855773 4:32041404-32041426 CCAACTGAGCTGAGGGATGCAGG + Intergenic
972552187 4:40144168-40144190 CCATGTGGGCAGCTGGAGGCTGG - Intronic
974004753 4:56544765-56544787 CCACCTGGCCCGAGGGCGGGAGG + Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
979670648 4:123357210-123357232 CCAGCTGGGGCGAGGGCGGCGGG - Intergenic
983892086 4:173040157-173040179 GCATCTGGGTCGAAGGAGTCAGG + Exonic
985590539 5:762213-762235 CCATCTGGGCTGTGAGTGGCTGG - Intronic
985673158 5:1216741-1216763 CCACCTGGGGCCAGGGAGGCTGG - Intronic
986280295 5:6316780-6316802 CTTTCTGGGTCGAGGAAGGCAGG - Intergenic
991702799 5:69331814-69331836 ACATCTGGTCCAAGGGAGTCAGG - Intronic
993654364 5:90559031-90559053 ACAGCCGGGCCCAGGGAGGCTGG + Intronic
994197528 5:96936288-96936310 CCACGAGGGCTGAGGGAGGCAGG + Intronic
995346820 5:111131063-111131085 TCATCTGGTCCAAGCGAGGCAGG - Intergenic
997579481 5:135008254-135008276 TCATCTGGGCCTAGGGAAGCTGG + Intronic
998113214 5:139517872-139517894 CCACCGTGGCCGCGGGAGGCAGG + Intergenic
998385766 5:141756331-141756353 CCATGTGGGCAGAGCCAGGCGGG + Intergenic
998811923 5:145975127-145975149 ACATCTGGGCCCAGGCAGCCAGG + Intronic
1000320454 5:160130403-160130425 TCACCTGGGCCCTGGGAGGCAGG - Intergenic
1001000249 5:167999278-167999300 CCATCTGGGCCCAGGGAGTTGGG - Intronic
1001355920 5:171022629-171022651 CCTCCTGGGACCAGGGAGGCTGG - Intronic
1001382294 5:171312479-171312501 CCACCTGGGGGGTGGGAGGCAGG + Intergenic
1001551121 5:172602950-172602972 CCATGTGGGCCGAGGGGGCCTGG - Intergenic
1001600140 5:172923244-172923266 GCATCTGGGAGGAGGGAGGAGGG + Intronic
1001839711 5:174864812-174864834 CCTGCTGGGGCAAGGGAGGCTGG - Intergenic
1002653322 5:180720824-180720846 CCATCTGGGCACATGGAGGTAGG + Intergenic
1003333994 6:5153455-5153477 CCAGCTGGGCAGAGAGAAGCTGG + Intronic
1003869342 6:10389952-10389974 CCGCCAGGGCCGAGGGAGGCGGG + Intergenic
1004750924 6:18561130-18561152 CCATCTGGGCAGAGGGAATGTGG - Intergenic
1006152820 6:31998389-31998411 CCATCTGAGCCGTGGGCAGCGGG - Intronic
1006159128 6:32031126-32031148 CCATCTGAGCCGTGGGCAGCGGG - Intronic
1007346697 6:41236499-41236521 CCACCTGAGCCAAGGCAGGCAGG - Exonic
1007414647 6:41684467-41684489 CCAACGGGGAGGAGGGAGGCAGG + Exonic
1008773664 6:55009228-55009250 CCTTCTGGAGCCAGGGAGGCTGG - Intergenic
1008932572 6:56955296-56955318 GCAATTTGGCCGAGGGAGGCTGG - Exonic
1015603534 6:134933488-134933510 CTATCTTGGCCCAGGGAAGCAGG + Intronic
1018091328 6:160348645-160348667 GGCTCTGGGCCGCGGGAGGCGGG - Exonic
1019608935 7:1926268-1926290 CCATCTGGGCCTAGGGATTGTGG - Intronic
1019671653 7:2283235-2283257 CCACCTGCGCCGAGGCTGGCAGG - Intronic
1020633798 7:10672236-10672258 CCTGCTGGGGCCAGGGAGGCTGG - Intergenic
1020748658 7:12111729-12111751 GCGTCAGGGCAGAGGGAGGCGGG + Intergenic
1022174756 7:27862354-27862376 ACCTCTGGGGCGGGGGAGGCGGG - Intronic
1022394371 7:29972528-29972550 GTATGTGGGCCAAGGGAGGCTGG + Intronic
1024392811 7:48834861-48834883 CTATCTGGCCTCAGGGAGGCTGG + Intergenic
1026774252 7:73221197-73221219 CCATCTGTCCCCAAGGAGGCTGG + Intergenic
1026850303 7:73719511-73719533 CCATCCTGGCCGCGGGAGCCGGG + Intronic
1026896788 7:74014015-74014037 CCAGCTTGGCCATGGGAGGCAGG - Intergenic
1026936155 7:74257060-74257082 CATTCTGGGCCAATGGAGGCTGG - Intergenic
1026944341 7:74306467-74306489 CATCCTGGGGCGAGGGAGGCAGG - Intronic
1027015109 7:74774583-74774605 CCATCTGTCCCCAAGGAGGCTGG + Intronic
1027072922 7:75171370-75171392 CCATCTGTCCCCAAGGAGGCTGG - Intergenic
1029175649 7:98662565-98662587 CCAGAAGGGGCGAGGGAGGCAGG + Intergenic
1030097859 7:105917048-105917070 CCAACTGGGCAGAGAAAGGCTGG + Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031884685 7:127233704-127233726 CCCTCTGGGATTAGGGAGGCTGG - Intronic
1032193486 7:129777454-129777476 CCATCCTGGTGGAGGGAGGCTGG + Intergenic
1035106012 7:156441930-156441952 CGGTCTGGGCCCTGGGAGGCTGG - Intergenic
1035399512 7:158555610-158555632 CCATGGGAGCTGAGGGAGGCTGG - Intronic
1037150015 8:15626021-15626043 CCAGCTGTGGCGAGGGAGGCTGG + Intronic
1037946572 8:22993380-22993402 CCATCTGGGCCGTGTGTGGAGGG - Intronic
1039492504 8:37958571-37958593 CAATCTGGGCCCAGGGAGATGGG + Intergenic
1039620306 8:38991300-38991322 CCATCATGGCCCAGGGAGGCGGG - Exonic
1040525990 8:48225761-48225783 CCATCGGGGCAGTTGGAGGCTGG - Intergenic
1041208294 8:55521085-55521107 CCAGCTGTGCTGAAGGAGGCCGG + Intronic
1041612178 8:59863761-59863783 GCATCTAGGCCCAGGGAAGCTGG + Intergenic
1044356159 8:91225019-91225041 CCTGCTGGGGCCAGGGAGGCTGG - Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049838403 8:144754890-144754912 CCTCCTGGGTCGCGGGAGGCAGG + Intronic
1051806302 9:20996498-20996520 GTATCTGGGCCCAGGGAGGTGGG + Intergenic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1056532197 9:87497824-87497846 CCTTTTGGGCGGAGGGCGGCCGG - Intronic
1058455988 9:105138718-105138740 CCAGCTGTGGGGAGGGAGGCGGG - Intergenic
1059623590 9:116036264-116036286 CCTTCTAGGCCAAGAGAGGCTGG - Intergenic
1059937145 9:119322609-119322631 GCACCTGGGCGGAGGGAGGGAGG - Intronic
1060192063 9:121599614-121599636 CCAGCTGGGCCGAGTGGAGCGGG - Intronic
1061062588 9:128258075-128258097 CCTTCTGGGCCGAGGCCAGCAGG + Exonic
1061404572 9:130386201-130386223 CCAGCTTGGCCCAGGGAGGGAGG + Intronic
1061724560 9:132575009-132575031 GGACCTGGGCCGAGGCAGGCAGG + Intergenic
1062395580 9:136351328-136351350 CCCTCCAGGCCCAGGGAGGCTGG - Intronic
1062398216 9:136361121-136361143 ACATCCGGCCCGTGGGAGGCCGG - Intronic
1186510735 X:10128078-10128100 CCATCAAGGACGCGGGAGGCTGG + Exonic
1186608869 X:11119201-11119223 CCATCTGCCCCAAGGGAGGTGGG + Intronic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1189281270 X:39821428-39821450 TCATTAGGGCCGGGGGAGGCGGG + Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1199692477 X:150319290-150319312 CCAACTAGGCCCAGGGAGGCTGG - Intergenic