ID: 901225136

View in Genome Browser
Species Human (GRCh38)
Location 1:7608930-7608952
Sequence ATGTCCTTCTAGAAAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901225136_901225142 8 Left 901225136 1:7608930-7608952 CCTGGCCTTTTCTAGAAGGACAT 0: 1
1: 1
2: 1
3: 14
4: 164
Right 901225142 1:7608961-7608983 GAAATTCTAAGCAGAAGTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 394
901225136_901225141 7 Left 901225136 1:7608930-7608952 CCTGGCCTTTTCTAGAAGGACAT 0: 1
1: 1
2: 1
3: 14
4: 164
Right 901225141 1:7608960-7608982 GGAAATTCTAAGCAGAAGTGAGG 0: 1
1: 0
2: 1
3: 21
4: 269
901225136_901225146 30 Left 901225136 1:7608930-7608952 CCTGGCCTTTTCTAGAAGGACAT 0: 1
1: 1
2: 1
3: 14
4: 164
Right 901225146 1:7608983-7609005 GCAGGAGCTGTCTGGCTAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 223
901225136_901225144 22 Left 901225136 1:7608930-7608952 CCTGGCCTTTTCTAGAAGGACAT 0: 1
1: 1
2: 1
3: 14
4: 164
Right 901225144 1:7608975-7608997 AAGTGAGGGCAGGAGCTGTCTGG 0: 1
1: 0
2: 3
3: 34
4: 320
901225136_901225143 12 Left 901225136 1:7608930-7608952 CCTGGCCTTTTCTAGAAGGACAT 0: 1
1: 1
2: 1
3: 14
4: 164
Right 901225143 1:7608965-7608987 TTCTAAGCAGAAGTGAGGGCAGG 0: 1
1: 0
2: 2
3: 14
4: 220
901225136_901225145 27 Left 901225136 1:7608930-7608952 CCTGGCCTTTTCTAGAAGGACAT 0: 1
1: 1
2: 1
3: 14
4: 164
Right 901225145 1:7608980-7609002 AGGGCAGGAGCTGTCTGGCTAGG 0: 1
1: 1
2: 4
3: 38
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901225136 Original CRISPR ATGTCCTTCTAGAAAAGGCC AGG (reversed) Intronic
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
901962418 1:12838114-12838136 ATGTGCTCCTAGGGAAGGCCTGG - Intergenic
904832074 1:33311808-33311830 ATGTGGTTCTAGAACAGCCCTGG + Intronic
905494362 1:38372866-38372888 AGGCCCATCTAGAAATGGCCAGG + Intergenic
913992440 1:143627205-143627227 AGGTCCTTCTGGGGAAGGCCTGG + Intergenic
914449210 1:147775757-147775779 ATGGCTTGCTAGAAAAGTCCAGG + Intergenic
915552905 1:156645488-156645510 AGGCCCTCCTGGAAAAGGCCAGG + Intronic
916576785 1:166074132-166074154 ATGTCCATATAGAAAAGCCTTGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920302795 1:204999340-204999362 GGGTTCTTTTAGAAAAGGCCAGG - Intronic
921303152 1:213769661-213769683 AAGTCCTTTTGGAAAAGGGCAGG + Intergenic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
922117693 1:222630401-222630423 ATGGCCTTGTAGAACAGGGCTGG + Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924054030 1:240106977-240106999 AAATCCTCCTGGAAAAGGCCGGG - Intronic
924400087 1:243670663-243670685 ATGTGCTTATACAAAATGCCAGG + Intronic
1065524976 10:26610967-26610989 GTGTCCTTATAAAAGAGGCCGGG + Intergenic
1066232572 10:33451198-33451220 GTGTCCTTATAAAAGAGGCCCGG - Intergenic
1066285433 10:33961633-33961655 ATTTCTATCTAGAAAATGCCTGG + Intergenic
1068775395 10:60863115-60863137 ATTTCTTTCTAAAAAAGGCCAGG - Intergenic
1071099635 10:82020131-82020153 GTGTCATTTTAGAAAATGCCAGG + Intronic
1073598016 10:104819063-104819085 ATGTGATTGGAGAAAAGGCCAGG + Intronic
1075182700 10:120226094-120226116 AAGTCTTTCTAGGACAGGCCCGG + Intergenic
1076893871 10:133299317-133299339 ATGTCCTTCCAGCAGGGGCCCGG + Intronic
1077351661 11:2095840-2095862 GATTCCTTCTAGAGAAGGCCAGG + Intergenic
1078311512 11:10248098-10248120 ATTACATTCTAGATAAGGCCTGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079591639 11:22190397-22190419 GTGTCCTTCTAATAAAGGTCTGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084539835 11:69779139-69779161 ATGTCTTTCTGCAAAAGTCCAGG + Intergenic
1085367425 11:75963315-75963337 ATGTCCTTTTATAATAGGACAGG + Intronic
1085526213 11:77165823-77165845 CTGCCCTTCTTGAACAGGCCTGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092517966 12:9235629-9235651 ATGTCATTCTATAAAATGACAGG - Intergenic
1092957364 12:13562901-13562923 ATGTCCTTCTGGAAACGGGCTGG + Exonic
1094796525 12:33979610-33979632 ATGTCCTTCGAGGAAAGAGCAGG + Intergenic
1095109084 12:38271601-38271623 ATGTCCTTCGAGGAAAGAGCAGG + Intergenic
1095455933 12:42385774-42385796 AAGTCCTTCAAGAAAAGGGTAGG - Intronic
1097119331 12:56719490-56719512 AGTTCCTTCTAGAAAAGGGCTGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098947585 12:76605906-76605928 ATATCCTTCCAAATAAGGCCAGG - Intergenic
1099954028 12:89335170-89335192 ATCACCTTTTGGAAAAGGCCTGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102159106 12:110754392-110754414 ATTTCCTAGGAGAAAAGGCCGGG - Intergenic
1103640419 12:122346925-122346947 ATTTCCTTCTCCAAGAGGCCAGG + Intronic
1104346516 12:128004544-128004566 ATGTCCTTCAATACAATGCCTGG - Intergenic
1105497499 13:20943748-20943770 GGATCCTTCTAGAAAAGGCTGGG - Intergenic
1108061663 13:46539128-46539150 ATGACATTCTAGAAAATGCATGG - Intergenic
1110707593 13:78612612-78612634 GTGCCCTTATAAAAAAGGCCTGG - Intergenic
1111866523 13:93775467-93775489 ATTTTCTTCTAGAAAACTCCAGG - Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1117412011 14:55458540-55458562 ATGGCCCTCTAGACCAGGCCTGG - Intergenic
1117573623 14:57074715-57074737 ATGTCCTTCCTTAAAGGGCCTGG + Intergenic
1117899891 14:60520956-60520978 CTGTCCTTCTAAACAGGGCCAGG + Intergenic
1118391840 14:65302465-65302487 ATGTCCTTCTAGAAATGGCCAGG - Intergenic
1122051613 14:99064814-99064836 ATGTCCTTCCGGGAAAGGCCCGG - Intergenic
1123478004 15:20605021-20605043 ATTACTTTCTAGATAAGGCCCGG + Intergenic
1123640010 15:22395362-22395384 ATTACTTTCTAGATAAGGCCCGG - Intergenic
1125787075 15:42328719-42328741 AAGTGATTCTAGAAAAGACCAGG + Intronic
1130617144 15:85421412-85421434 ATATCCTTCTCAAAAACGCCAGG - Intronic
1132563717 16:610848-610870 ATGTCACTCTGGAAAAGGTCTGG - Intronic
1132747502 16:1443114-1443136 AGGTCCAGCTAGAAAAGGCCGGG - Intronic
1138800179 16:60017183-60017205 ATATTCTTTTAGAAAAAGCCAGG + Intergenic
1139217888 16:65147005-65147027 ATGTATTTCTAGAAATGGCTGGG + Intergenic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1142108534 16:88319007-88319029 ATGACCTGCTAGGAAAGCCCTGG - Intergenic
1143514974 17:7414952-7414974 ATGGCCTTCTGGAACAGCCCTGG - Exonic
1146614899 17:34348505-34348527 AGGTTCTTCTGGAAAAGGCATGG + Intergenic
1146948786 17:36891648-36891670 ATGACCTTCTAGAGAAAGGCTGG - Intergenic
1148776887 17:50101032-50101054 ATGTGCTTCCAGAAAATGCAGGG + Intronic
1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG + Intronic
1150496069 17:65608705-65608727 ATGTTGTTCAAGAACAGGCCGGG + Intronic
1151359727 17:73581684-73581706 GTGTCCTTTGAGAAAAGCCCTGG - Intronic
1151814289 17:76463601-76463623 GAATCCTTCCAGAAAAGGCCGGG - Intronic
1152086000 17:78218973-78218995 ATATCCTTGTAGCAAAGCCCTGG + Intronic
1152988165 18:338163-338185 ATGTCCTTCTGCAAAATTCCTGG + Intronic
1158250038 18:55477633-55477655 CTGTCCTGCTAGCAAAGTCCTGG - Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1158762431 18:60405494-60405516 ATGTTCTTTTAGAAAAAGCAGGG + Intergenic
1163158386 19:15451025-15451047 ATGTCTGCCTAGAAAAGGCCTGG - Intergenic
1165152443 19:33768986-33769008 AGTTCCTTCTAGACAAAGCCTGG - Intronic
1166235637 19:41453868-41453890 ATGTCTTTAAAGAAAAGTCCAGG + Intergenic
1167405775 19:49307491-49307513 ATTTTCTTCTAGAAGATGCCTGG - Intronic
1202664371 1_KI270708v1_random:104289-104311 CTGTCCCTACAGAAAAGGCCAGG - Intergenic
929139744 2:38656439-38656461 ATGTCCTTAAAGAAAGGGGCTGG + Intergenic
930643158 2:53875272-53875294 AGGTCTCTCTAGAAAAGACCAGG + Intronic
930688365 2:54332714-54332736 AAGTCCTTGAAGAAAAGGACTGG - Intronic
931550628 2:63441987-63442009 ATGTACTTCTATAATAGGTCTGG - Intronic
934087940 2:88525743-88525765 ATGAGCTTCTAGAAAGAGCCTGG - Intronic
934747739 2:96770605-96770627 AAGTCCGTCTAGAAAAGGAGGGG - Intronic
934889058 2:98049973-98049995 ATGAGGTTCTAGATAAGGCCTGG + Intergenic
935828187 2:106972416-106972438 GTGTCCTTTTCGAAAAGGACTGG + Intergenic
937188051 2:120064911-120064933 ATGTTCTTCTGGGAAAGGTCTGG - Intronic
937900704 2:127016808-127016830 ATGTGCTTCCACAAAAGGGCTGG - Intergenic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
940550875 2:155154728-155154750 CTGTCCTTGAAGAAAGGGCCAGG - Intergenic
941332611 2:164197241-164197263 TTCTCCTTATAGAAATGGCCTGG - Intergenic
943406062 2:187487626-187487648 ACGTCCTTTTAATAAAGGCCTGG - Intronic
944052198 2:195482968-195482990 ATGACTTTATATAAAAGGCCTGG + Intergenic
947170969 2:227310849-227310871 ATGACATTCTAGAAATGGGCTGG - Exonic
948952963 2:241266700-241266722 AGGTACTTCTAGAAAGGGCATGG + Intronic
1170095277 20:12639207-12639229 AGGTCCTTCTGGGAAAGGGCTGG - Intergenic
1170465242 20:16616979-16617001 AAGTCCTGATAGAAATGGCCTGG + Intergenic
1171340902 20:24427982-24428004 ATGACATTCTGGAAAAGGCTAGG + Intergenic
1174095366 20:48084855-48084877 ATGTCCTTCTATACAATGTCTGG + Intergenic
1175917694 20:62434550-62434572 ATTTCCTTCTGGAAAGGGCTTGG - Intergenic
1179381601 21:40904196-40904218 AGGTCCTGCTAGAAAAGGGAGGG - Intergenic
1179437391 21:41371377-41371399 AGGTCCTCCTAGCAAATGCCAGG - Intronic
1180331100 22:11481196-11481218 CTGTCCCTACAGAAAAGGCCAGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183812863 22:40272409-40272431 CTGTCCTTCAAGGAAAGGCCTGG + Intronic
1184658086 22:45952215-45952237 ATTTCCCTCAAGAAAAGGGCGGG - Intronic
1184789875 22:46693696-46693718 ATGTCCTTCTCTAAAAGGTTTGG + Intronic
951159734 3:19403645-19403667 ATGTGCTTATAGAAAAGCGCAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955006056 3:54969918-54969940 ATGCCCTTATAAACAAGGCCAGG + Intronic
955422923 3:58757958-58757980 AAGTCCTGCAAGAAAAGTCCTGG - Intronic
958271957 3:91511548-91511570 AGGTCCTTCTGGAAGAGGCCTGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
966282137 3:178244148-178244170 ATTTCATTCTAGAAATGGCAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969103557 4:4788224-4788246 ATATACTTTTAGAAAAAGCCAGG - Intergenic
969210671 4:5684832-5684854 GTGTCCTTATAGAAGAGGCTAGG + Intronic
969284692 4:6195779-6195801 AACTCCTCCTGGAAAAGGCCAGG + Intronic
969852494 4:9970908-9970930 ATGTCCTTCTATATAATGTCTGG - Intronic
970313492 4:14807329-14807351 ATGTCCTTTTAAATAGGGCCAGG + Intergenic
971166914 4:24193426-24193448 ATGCCCTTCTAGGGAAGGCTGGG - Intergenic
975727284 4:77304289-77304311 ATGTCACTTTACAAAAGGCCAGG + Intronic
979900646 4:126212949-126212971 ATGTTCATCTAGACAAGGCAAGG - Intergenic
985473115 5:58677-58699 ATGACTTTCCAGAAATGGCCAGG + Intergenic
986014608 5:3747139-3747161 ATATGCTTTTAGAAAAAGCCAGG - Intergenic
986071060 5:4283749-4283771 TTGTCCTTCTAAAGAAGGCAAGG + Intergenic
986467581 5:8041584-8041606 ATGGCCTACTAGACAAAGCCAGG - Intergenic
987655209 5:20797565-20797587 ATGTGCTTTTAGAAAAAGCCAGG + Intergenic
988475352 5:31580099-31580121 ATGACATTCCAGAAAAGGCAGGG + Intergenic
988768348 5:34406337-34406359 ATGTGCTTTTAGAAAAAGCCAGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989817300 5:45751520-45751542 GTATGCTTCCAGAAAAGGCCAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993747994 5:91625657-91625679 ATGTCTTTATAAAAGAGGCCAGG + Intergenic
995035699 5:107531741-107531763 ATGTCTTTATTGAAAAGGCAAGG - Intronic
1000301326 5:159959057-159959079 TTGCCCTTCTAGCACAGGCCTGG - Intronic
1004193404 6:13484264-13484286 TTGTCCTTTTAGCAAAGGCCTGG - Intronic
1004763593 6:18698855-18698877 ATGTCCTTATTGACAAAGCCAGG - Intergenic
1006783827 6:36651398-36651420 CTGTCCTTCCAGGAAAAGCCAGG + Intergenic
1007282944 6:40725778-40725800 CTGACCTTCCAGAAAAGGACTGG - Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1008983154 6:57509589-57509611 AGGTCCTTCTGGAAGAGGCCTGG + Intronic
1009171211 6:60402455-60402477 AAGTCCTTCTGGAAGAGGCCTGG + Intergenic
1011694522 6:89900010-89900032 ATGACATTCTGGAAAAGGCAAGG - Intergenic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1021837883 7:24698306-24698328 ATGTCCTTCTATAAATAGCTTGG - Intergenic
1022781690 7:33591499-33591521 AAGTCCTTCTGGAAAAGGAAGGG - Intronic
1026644204 7:72153760-72153782 ATGTCCTGCGATGAAAGGCCAGG - Intronic
1027763688 7:82311756-82311778 ATGTCTTTCTAGTCAAAGCCTGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030376052 7:108754975-108754997 ATGTCCTTCTGGATAAAGGCTGG + Intergenic
1033488436 7:141815346-141815368 ATGTACTTCTGGAAGATGCCTGG + Intergenic
1033641786 7:143268691-143268713 AAGTCTTTCTAGAAAACCCCTGG + Intronic
1033707461 7:143902912-143902934 ATGTGCTTCTATAAGAGGCGGGG + Intergenic
1034825289 7:154256912-154256934 AAGTGCATCTAGAAAATGCCAGG + Intronic
1036980243 8:13462106-13462128 GTGTCCTCCTAGAAAAAGGCTGG - Intronic
1041162832 8:55062263-55062285 GTGCTCATCTAGAAAAGGCCAGG - Intergenic
1043736724 8:83757338-83757360 ATATCTTTATAGAAAATGCCAGG - Intergenic
1044927729 8:97223786-97223808 ATGCCCTTAGAGAGAAGGCCGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1054739160 9:68787386-68787408 TTGTACTTCTACAAAAGGACTGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058345775 9:103959834-103959856 AAGTCCTTCCAGAAGAGACCAGG + Intergenic
1062585581 9:137247981-137248003 CTGTCCCTCCAGAAAGGGCCTGG + Intergenic
1186800742 X:13090127-13090149 ATTTCCTTCTAGAACAACCCTGG - Intergenic
1187157124 X:16730877-16730899 ATTAGATTCTAGAAAAGGCCTGG - Intronic
1187852637 X:23606362-23606384 ATGTCCTTGTAGACAAGGGTGGG + Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1197524709 X:127547281-127547303 ATATGCTTCTAGAAGAAGCCAGG - Intergenic
1197728407 X:129791579-129791601 ATGGACTTCTAGAAGATGCCAGG - Intronic
1199231187 X:145437683-145437705 ATTTTCTTCTAGAAGATGCCTGG - Intergenic
1200949195 Y:8877461-8877483 ATCTCCTTCTGTAAAGGGCCAGG + Intergenic