ID: 901226276

View in Genome Browser
Species Human (GRCh38)
Location 1:7614597-7614619
Sequence GTGAGGAATGTTAATAACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901226276_901226280 -7 Left 901226276 1:7614597-7614619 CCCGCGTTATTAACATTCCTCAC 0: 1
1: 0
2: 1
3: 13
4: 106
Right 901226280 1:7614613-7614635 TCCTCACTTGGGAATGTTTATGG 0: 1
1: 0
2: 1
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901226276 Original CRISPR GTGAGGAATGTTAATAACGC GGG (reversed) Intronic
901226276 1:7614597-7614619 GTGAGGAATGTTAATAACGCGGG - Intronic
906266815 1:44437627-44437649 GGGAGAAATGCTAATAACCCTGG + Intronic
910067009 1:83166286-83166308 GTGAGGACTGTTGATAATGGGGG - Intergenic
910804034 1:91172941-91172963 GTGAGGAATGTTGATAATGGGGG + Intergenic
911390627 1:97236807-97236829 GTGGGGAATGTTGATAATGAGGG + Intronic
911809062 1:102250526-102250548 TTGAGGAATGTTACTAATGAAGG + Intergenic
912151802 1:106868520-106868542 GTGGGGAATATTAGTAACGGGGG + Intergenic
916881004 1:169019393-169019415 GTGAGGAATCTTAATCCTGCAGG - Intergenic
917460425 1:175224575-175224597 TTGAGGAATGTTGATAAATCTGG + Intergenic
918334858 1:183498691-183498713 GTGGGGAATGTTCATAACAGGGG - Intronic
918624723 1:186644322-186644344 GTGGGGAATGTTGATAACAGGGG + Intergenic
919831962 1:201547741-201547763 GTGTGGAATGTAAAAGACGCAGG - Intergenic
920743776 1:208606358-208606380 GTGGGGAATGTTGATAATGGAGG - Intergenic
1063215633 10:3923146-3923168 GTGAGGATTGGTAAGAAAGCAGG - Intergenic
1068747395 10:60548598-60548620 GTGAGGAATGTTAATAAATCAGG - Intronic
1071815634 10:89229842-89229864 GTGAGGGATGTTCATAACAGGGG + Intronic
1074482184 10:113834256-113834278 GTGAGCAATGTTGATCACGGGGG + Intergenic
1074663841 10:115695297-115695319 GTTAGGAATTTAAACAACGCTGG + Intronic
1075447437 10:122523495-122523517 GTGAGGGATGTTGATAATGGGGG + Intergenic
1075988949 10:126816465-126816487 GAGAGGAAAGATCATAACGCAGG + Intergenic
1085985760 11:81785739-81785761 ATGAGGAATGGTCATAACGCTGG + Intergenic
1086329068 11:85735103-85735125 ATGAGGAATGTTGATAATGAGGG + Intronic
1086478248 11:87203139-87203161 GTGCGGGATGTTAATAATGGGGG - Intronic
1087803805 11:102533889-102533911 GTGAGGGATGTTGATAATGGGGG + Intergenic
1089856710 11:121551800-121551822 GTGAGGTATGTTAATTACTCTGG - Intronic
1093460880 12:19405738-19405760 GTGAGGGATGTTCATAATGGGGG - Intronic
1100172876 12:91996602-91996624 GTGAGGAATATCAATAATGAAGG + Intronic
1100258783 12:92911692-92911714 GTGGGGAATGTTGATAATGGGGG + Intronic
1102400827 12:112628218-112628240 GTGAGGCATGTTAATAATGAGGG + Intronic
1102811634 12:115829325-115829347 GTGAGGGATGTTAGTAATGAGGG - Intergenic
1103221475 12:119249599-119249621 GTGTGGATTTTTAATAAGGCCGG + Intergenic
1106668629 13:31880701-31880723 GGGATGAATGTTAACAACGGGGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1108794725 13:54017671-54017693 GGGAGAAATGTTAAAAATGCTGG + Intergenic
1112085788 13:96031106-96031128 GTGAGGGATGTTGATAACAGGGG + Intronic
1112335173 13:98508916-98508938 TTGAGGAATGTGACTAGCGCTGG + Intronic
1115733018 14:36292458-36292480 ATGAGGGATGTTGATAACGGGGG - Intergenic
1116820466 14:49621578-49621600 CTGAGGAATGTAGATAAGGCTGG + Exonic
1117625418 14:57632579-57632601 GTGGGGAATGTTGATAATGGGGG - Intronic
1118322391 14:64760849-64760871 GTGAGGAATGTTGAGGTCGCAGG + Intronic
1121194558 14:92058151-92058173 GTGATGAATATGAATAACGCAGG - Exonic
1123724142 15:23085467-23085489 ATGAGGAATGTTAACAGCCCAGG + Intergenic
1127733911 15:61824262-61824284 GTGAGGCATGTTATTTACACTGG - Intergenic
1128023182 15:64411367-64411389 GTGAGGGATGCTAATAATGGGGG + Intronic
1128328384 15:66740002-66740024 ATGAAGAATGTTAATGACACAGG - Intronic
1133872753 16:9704686-9704708 CTGAGGAATATTAATAAGTCAGG + Intergenic
1136049237 16:27638757-27638779 GTGTGGACTGTGAATAAGGCTGG - Intronic
1138904954 16:61320129-61320151 GTGGGGAATGTTGATAATGGGGG + Intergenic
1150878571 17:68997731-68997753 TTGGGGAATGTTAATAATGGCGG - Intronic
1153169475 18:2299302-2299324 GTGAGGGATGTTGATAATGGGGG + Intergenic
1156750408 18:40446735-40446757 GTGATTAATGTTAAAAACGTGGG + Intergenic
1159207659 18:65274269-65274291 GTAGGGAATTGTAATAACGCAGG + Intergenic
1159736510 18:72105608-72105630 GTGTGGAATGTTGATAATGGGGG + Intergenic
1166497858 19:43317084-43317106 GAGGGGAATGTTAATCTCGCTGG + Intergenic
925272498 2:2622596-2622618 GTGGAGAATGTTAATAATGCTGG - Intergenic
925343665 2:3154378-3154400 GTCAGGAAGCTTAATAAGGCAGG - Intergenic
925350143 2:3195308-3195330 GTGAGGAAGGTAAATGATGCAGG - Intronic
925661313 2:6206084-6206106 GTTTAGAATGTTAATAAGGCAGG - Intergenic
927795735 2:26047057-26047079 CTGGGGAATTTTAATAAGGCTGG - Intronic
928020767 2:27703039-27703061 GTGGGGAATGTTGATAATGGGGG - Intergenic
928478884 2:31660584-31660606 GTGGGGGATGTTGATAACGGGGG + Intergenic
931063364 2:58556196-58556218 GTGGGGAATGTTGATAATGGGGG - Intergenic
936085748 2:109467855-109467877 GTGAGGGATGTGAATGACGGCGG - Intronic
941508626 2:166377490-166377512 GTGGGGAATGTTGATAATGGGGG - Intergenic
944119907 2:196229976-196229998 GTGAGGATTTTTAATACCACTGG - Intronic
946209005 2:218132227-218132249 GAGAGGAATGTTAATGACTACGG - Intronic
947060543 2:226159960-226159982 GAGAGGAATGTCAAGAATGCAGG + Intergenic
1170651477 20:18246496-18246518 GTGGGGGATGTTAATAATGGGGG - Intergenic
1170779314 20:19409702-19409724 GTGAAGAATTTTAATAACATAGG + Intronic
1173646050 20:44633815-44633837 GTGAGGACAGTTAATGAGGCAGG + Intronic
949451282 3:4188074-4188096 GTGAGGGATGTTGATAATGCGGG - Intronic
949901621 3:8819692-8819714 GGGAAGAATGTGAATAACTCCGG + Intronic
953278276 3:41526022-41526044 GTAGGGAATGTTAATATCACTGG - Intronic
958813253 3:98887769-98887791 GTCAGGAATGTTAATAATGAAGG - Intronic
962325680 3:134430086-134430108 GACAGGAATGATAATAACACAGG + Intergenic
966465071 3:180222402-180222424 GTGGAGAATGTTAATAATGGGGG + Intergenic
966609557 3:181854818-181854840 GTGGGGAATGTTGATAACAGAGG - Intergenic
966658405 3:182385712-182385734 CTGAGGAAGGTTAGTAACCCTGG + Intergenic
968015688 3:195330552-195330574 GTGAGGAATGTCTAAAACCCAGG + Intronic
970319117 4:14858159-14858181 GTGAGGGATGTTAATAATTGAGG + Intergenic
971306064 4:25482714-25482736 GTGGGGAATGTTGATAATGGGGG + Intergenic
971949551 4:33327394-33327416 GAGGGGAATGTTAATAATGGAGG + Intergenic
972322370 4:37983686-37983708 GTGAGGAATATTAATAACAGGGG - Intronic
974632617 4:64513420-64513442 GTGGGGGATGTTAATAATGGGGG + Intergenic
980579143 4:134726929-134726951 GTGAGAAATGATAATAAAACTGG - Intergenic
985936915 5:3104542-3104564 GTGAGGAATCTCATTAACTCCGG + Intergenic
987856064 5:23422410-23422432 TTGAGGAATATTATTAAAGCCGG + Intergenic
990202272 5:53389829-53389851 GTGGGGAATGTTGATAATGGAGG + Intergenic
990379285 5:55206352-55206374 GTGAGGAATGTTGTTAATGGGGG + Intergenic
990902786 5:60771239-60771261 CTGAGGCATGTTAATAGCACAGG + Intronic
991029725 5:62070368-62070390 GTGTAGAATGTTAACAACGGAGG + Intergenic
993100473 5:83532525-83532547 GAGAGAAATGTTAATTACCCAGG - Intronic
996774204 5:127116767-127116789 GTGAAGACAGTTAATAAAGCAGG + Intergenic
997610850 5:135214800-135214822 GTTAGAAATGTTAATAACGTGGG - Intronic
998731681 5:145084385-145084407 TTGAGGCATGTTAAAAACCCAGG + Intergenic
999189555 5:149736862-149736884 GTGGGGAATATTAATAATGGGGG - Intronic
999427865 5:151503284-151503306 GTGGGGAATGTTAATAATGAGGG + Intergenic
1007968687 6:46028738-46028760 GTGATGAATGTTGATAATGGGGG - Intronic
1010051819 6:71513442-71513464 GTGTGGAATGTGAATAAAGCTGG + Intergenic
1010770822 6:79827982-79828004 GTGGGGAATGTTGATAACGGGGG + Intergenic
1013845630 6:114447596-114447618 GTAAGGAATGTTGATAATGGGGG - Intergenic
1015757183 6:136619526-136619548 GTGGGGAATGTTGATAAGGGGGG - Intronic
1023586584 7:41737362-41737384 GTGTGGAATGTTCTTAACTCTGG + Intergenic
1027277102 7:76568467-76568489 GTGAGGACTGTTGATAATGGGGG + Intergenic
1031110404 7:117601103-117601125 TAGAGGAGTGTTAATAATGCTGG - Intronic
1031379004 7:121061515-121061537 GTGGGGGATGTTAATAATGGAGG + Intronic
1031841446 7:126744759-126744781 GTGAGGAATGTAAAGAAATCTGG - Intronic
1032015309 7:128376314-128376336 GTGAGGGATGTTTATAATGGGGG - Intergenic
1032986236 7:137340679-137340701 GTGAGGAATGTTTTTAGCTCTGG - Intronic
1037606425 8:20441519-20441541 TTGAGGAATGTCAAGAATGCTGG + Intergenic
1039333362 8:36563227-36563249 GTGAGGGATGTTGATAATGGGGG + Intergenic
1049141930 8:140962814-140962836 GTGAGGAGTGTCACTAATGCTGG - Intronic
1051083748 9:13323216-13323238 GGGAAGAATGATAATCACGCAGG - Intergenic
1055324033 9:75109999-75110021 GTGAGGGATGTTGATAATGGAGG - Intronic
1057011109 9:91602118-91602140 GTGGGGGATGTTAATAATGTGGG - Intronic
1061791270 9:133060520-133060542 GTGGGGGATGTTGATAACGGGGG + Intergenic
1187311101 X:18143710-18143732 GTGAGGGATGTTGATAGTGCGGG + Intergenic
1188088579 X:25934099-25934121 GTGGGGGATGTTAATAATGAGGG + Intergenic
1194007082 X:88507976-88507998 CTGAGGAATGAGAATAACACAGG - Intergenic
1196639923 X:118047014-118047036 GTGAGGAATGCAAATACAGCAGG + Intronic
1198096398 X:133383942-133383964 GTGGGGAATGGTAATCACGGGGG + Intronic