ID: 901226763

View in Genome Browser
Species Human (GRCh38)
Location 1:7617658-7617680
Sequence TAGGGTCACCTGAAGGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901226761_901226763 -7 Left 901226761 1:7617642-7617664 CCAGATGTCTCAATGGTAGGGTC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 110
901226757_901226763 17 Left 901226757 1:7617618-7617640 CCAGGAAAGGACACAGCAGGGGT 0: 1
1: 0
2: 1
3: 28
4: 301
Right 901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 110
901226755_901226763 18 Left 901226755 1:7617617-7617639 CCCAGGAAAGGACACAGCAGGGG 0: 1
1: 1
2: 2
3: 42
4: 428
Right 901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901226763 Original CRISPR TAGGGTCACCTGAAGGACTT TGG Intronic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
901879747 1:12186794-12186816 TGGGGGCCCCTGAAGGACTTGGG + Intronic
902212537 1:14914092-14914114 CAGGGTCACCTGGAGGGCTGTGG + Intronic
905924484 1:41740096-41740118 TGGGGAGACCTGGAGGACTTAGG - Intronic
907054864 1:51356926-51356948 AAAGGACACCTGAAGGACTCTGG + Intronic
915129746 1:153688112-153688134 CAGAGTCACCTGGAGGAGTTGGG + Exonic
916187074 1:162144061-162144083 TTGGTTCATCTGAATGACTTTGG - Intronic
917194002 1:172447429-172447451 TAGTGTGACTTGAAGGGCTTTGG - Intronic
918247790 1:182675186-182675208 TAGGGTCCCTTGTGGGACTTGGG - Intronic
922937625 1:229433938-229433960 GAGGGGAACCTGAAGGACTCCGG - Intronic
923956143 1:239023876-239023898 TAGGGTTACTTGAAGAGCTTTGG - Intergenic
1062984445 10:1754831-1754853 TTGGGTCACCTGGGGGGCTTGGG + Intergenic
1064240874 10:13627154-13627176 TGGGGCAACCTGAAGGACTTTGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1085768060 11:79301223-79301245 AAGGAACACATGAAGGACTTTGG - Intronic
1088889547 11:114033736-114033758 CAGAGTAACCTGAAGGACTCAGG - Intergenic
1090191431 11:124772211-124772233 GAGGGACACCTGAAGTATTTTGG - Intronic
1091239056 11:134040258-134040280 TGGGGGCACCTGAGGGACTGTGG + Intergenic
1091467260 12:695924-695946 TAGGGTCATCTGAAGTCCTGTGG + Intergenic
1092282835 12:7110304-7110326 TAGGGTCACCTGGAGCACCTTGG + Intergenic
1094332385 12:29308568-29308590 TAAGGTCAGCTGAATGGCTTAGG + Intronic
1096173442 12:49493186-49493208 GAGGGTCACAGAAAGGACTTGGG + Intronic
1099773382 12:87093466-87093488 TAGGGTCACCCTAAGGATGTGGG - Intergenic
1101467243 12:104960484-104960506 GAGGGTCAGGTTAAGGACTTTGG + Intergenic
1102745760 12:115247642-115247664 CAGGGTCATCTGGAGGACTGAGG - Intergenic
1103476433 12:121222248-121222270 CAGGGTCATGTGAAGGAATTGGG - Intronic
1104064507 12:125296159-125296181 TGGGGCCACCATAAGGACTTCGG - Intronic
1113069323 13:106404782-106404804 TAGAGTCACTTGGAGGGCTTGGG - Intergenic
1113571495 13:111361413-111361435 TTGGCTCACCTGCAGGATTTTGG - Intergenic
1113581505 13:111433348-111433370 TAGAGTCACACAAAGGACTTGGG - Intergenic
1114038300 14:18650312-18650334 TAAGGTCAGCTGAATGGCTTAGG + Intergenic
1114120321 14:19664730-19664752 TAAGGTCAGCTGAATGGCTTAGG - Intergenic
1119781298 14:77278218-77278240 TAGGATCACCTGGGGGACTCTGG + Intronic
1119860797 14:77934479-77934501 TAAGGTCTCCAGAAGGACTGGGG - Intronic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG + Intronic
1128552653 15:68608377-68608399 TGTGGTCCCCTGGAGGACTTCGG + Intronic
1131230602 15:90656180-90656202 AAGGGCCAGCTTAAGGACTTAGG + Intergenic
1132178279 15:99732920-99732942 GAGGGTCACCTGCAGGACCACGG + Exonic
1133580907 16:7143701-7143723 TATGATCAAATGAAGGACTTTGG - Intronic
1136054342 16:27677252-27677274 TAGGGTCATTTGGAGGCCTTTGG + Intronic
1150377860 17:64696746-64696768 TGAGGTCATCTGAAGGACATAGG - Intergenic
1158895087 18:61905207-61905229 TAGGATCATCTGAGGCACTTGGG - Intergenic
1160076088 18:75679227-75679249 TGGGGTCACCTGAAGGAACAGGG - Intergenic
1160406000 18:78646795-78646817 AAGGGTCCCATGAAGGATTTGGG - Intergenic
1163601679 19:18252951-18252973 TAGGGAGACCTGAAAGATTTAGG + Intronic
1164435262 19:28223205-28223227 TCAGGTCACCTGGAGGACTGAGG - Intergenic
1167475663 19:49699542-49699564 AAATGTCACCTGGAGGACTTGGG - Intronic
1167635507 19:50652674-50652696 TATGGTCACTGGAAGGACTTTGG + Intronic
926038616 2:9654933-9654955 AGGGGTTACCTGAAGGACTGAGG + Intergenic
926980369 2:18561152-18561174 CAGAATCACCTGGAGGACTTGGG + Intronic
927284762 2:21345151-21345173 TAGGGTCACCTGAGGTTCGTTGG + Intergenic
928175605 2:29032185-29032207 TAGGGAGACATGAAGGAGTTAGG - Intronic
928392004 2:30917408-30917430 TAGTCTCACCTGAAGGGCTTGGG + Intronic
929456161 2:42067514-42067536 TAAGGCCACCTGGAGAACTTAGG + Intergenic
932883806 2:75528756-75528778 TAAGGTCACCTGGATAACTTCGG - Intronic
933819702 2:86099581-86099603 TAGAGACACCTGAAGGGCTCAGG + Intronic
936397811 2:112142314-112142336 TTGGGTCCCCTGAAGGGCTCTGG + Intronic
938443574 2:131357327-131357349 TAAGGTCAGCTGAATGGCTTAGG + Intergenic
939867320 2:147487365-147487387 TCTGGTGACCTTAAGGACTTTGG - Intergenic
940251133 2:151678115-151678137 TAGGGTCATCTTGAAGACTTTGG + Exonic
943260143 2:185649095-185649117 TAGGTTCACCTAAATAACTTGGG + Intergenic
944279606 2:197880278-197880300 TAGAGGCAGCCGAAGGACTTTGG + Intronic
944681053 2:202077086-202077108 TGGGGTCACCTGGAGGAGCTGGG - Intronic
944836122 2:203581668-203581690 TAGGGTCAGGTTAAGGACTATGG - Intergenic
945805304 2:214483143-214483165 TAGTTTCAACTGAAGTACTTAGG - Intronic
1169943040 20:10958148-10958170 TAAGCTCATCTGAATGACTTTGG + Intergenic
1170774736 20:19365353-19365375 CAGGCTCACCTGGAGGGCTTGGG - Intronic
1172187674 20:33041426-33041448 TAGACTCACCCGAGGGACTTTGG + Intronic
1172648968 20:36489757-36489779 GAGGATCCCCAGAAGGACTTGGG + Intronic
1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG + Intronic
1180462421 22:15577353-15577375 TAAGGTCAGCTGAATGGCTTAGG + Intergenic
950538496 3:13595498-13595520 GAGGGTTACCTGAAGGTCTGTGG - Intronic
950663823 3:14482902-14482924 TGGGGTCACCTGGAGGGCTCGGG - Intronic
954324697 3:49857034-49857056 TGGGGTGACCTGAGGGACTGGGG - Intergenic
955393281 3:58536554-58536576 TAGGGGCACTTGCAGGACTCCGG - Intronic
957116461 3:76033381-76033403 TAGGGTCACCTTCAGCTCTTTGG + Intronic
959969410 3:112392225-112392247 TAGAGTCATCTGAAAGAGTTTGG - Intergenic
960511585 3:118555632-118555654 TAGGGTCTCCTAGAGGAATTTGG - Intergenic
961320215 3:126068007-126068029 CACGGTCACCTGAAGGCCTATGG + Exonic
963360655 3:144268401-144268423 TAGGGTCACCTGGGGAACTCAGG + Intergenic
968978929 4:3836373-3836395 TCGGGTCACCTGGAGGGCTGGGG - Intergenic
970411213 4:15809563-15809585 CAAGGTCACCTGAAGAGCTTTGG - Intronic
970656257 4:18233785-18233807 TAGGGTCAGCTGAAGTTCTTTGG + Intergenic
972268774 4:37488852-37488874 AAGGGTCAACTGGAGGACTAAGG - Intronic
972757964 4:42069813-42069835 CAGAATCACCTGAAGGGCTTGGG + Intronic
973862191 4:55076826-55076848 TAGGGTCTCCTGAAAGACACTGG - Intergenic
976168058 4:82276024-82276046 AAGGGTGTCCTGAAGGGCTTAGG - Intergenic
977536265 4:98260222-98260244 CAGTGTCCCCTGAAGGACTCCGG + Intergenic
991097962 5:62759404-62759426 CAGGACCACCTGCAGGACTTGGG + Intergenic
998806617 5:145923088-145923110 CAGAATCACCTGAAGTACTTGGG + Intergenic
1000946163 5:167425952-167425974 TAGGGTCAATTGAAGGAACTGGG + Intronic
1004271615 6:14200989-14201011 TTGGGTACCTTGAAGGACTTGGG + Intergenic
1005983582 6:30856170-30856192 AAGGGTCATCTGAAGGGGTTTGG - Intergenic
1006354769 6:33548748-33548770 TAGGATGACCTGAAGGACAGTGG + Intergenic
1006409457 6:33863870-33863892 AAGGGTCGCCTGGAGGGCTTTGG - Intergenic
1010648435 6:78422471-78422493 TTAGGTCACCTCAAGGCCTTGGG - Intergenic
1015176550 6:130315859-130315881 TAGGATCCCCTGATGGACTTGGG + Intronic
1018354730 6:163000902-163000924 TAGGGGCTCCTGAAACACTTAGG + Intronic
1026718085 7:72807430-72807452 CAGGGGCCCCAGAAGGACTTTGG - Intronic
1029480262 7:100808000-100808022 AAGGCTCACCTGAGGGAGTTGGG - Intronic
1034787306 7:153937056-153937078 TAGGGTCCCATGGAGGACCTTGG + Intronic
1035917826 8:3644226-3644248 TAGTGTCACCTCAACGACCTGGG - Intronic
1039825774 8:41173040-41173062 CAAGGTCACCAGAAGGACGTGGG - Intergenic
1042046685 8:64660832-64660854 TAGGCTAACCAGAAGGACTCAGG + Intronic
1047171045 8:122492519-122492541 TACCATCACCTGAAGGAGTTAGG + Intergenic
1048053675 8:130843910-130843932 GAGAGTGACCTGAAGGAGTTGGG + Intronic
1050546426 9:6713662-6713684 CAGGGCCAGCTGCAGGACTTGGG - Intergenic
1051366191 9:16323144-16323166 TAGGGTCTCCTTGAGGACCTTGG + Intergenic
1058119092 9:101118985-101119007 TAGAAGCTCCTGAAGGACTTGGG + Intronic
1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG + Intergenic
1187133336 X:16524139-16524161 GAAGGGCACCTGAGGGACTTGGG - Intergenic
1190299775 X:49050356-49050378 GGGGGTCACTGGAAGGACTTAGG + Intergenic
1190846233 X:54193694-54193716 CAGGGTGACCTGAAGGCATTTGG + Exonic
1192000841 X:67149741-67149763 TTGGGTTACCTGAAGGAAATGGG - Intergenic
1197637301 X:128929565-128929587 TCAGGTCACATGAAGGAATTGGG + Intergenic
1198125461 X:133639233-133639255 TAGATTCACCTGCAGGAATTGGG - Intronic
1198600986 X:138283791-138283813 TTAGGCCACCTGAAGGACTAAGG + Intergenic