ID: 901227039

View in Genome Browser
Species Human (GRCh38)
Location 1:7619496-7619518
Sequence ATGAGGTAAGAGAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901227039_901227040 -10 Left 901227039 1:7619496-7619518 CCTTCACACTTCTCTTACCTCAT 0: 1
1: 0
2: 1
3: 27
4: 404
Right 901227040 1:7619509-7619531 CTTACCTCATGAGCCAGAATTGG 0: 1
1: 0
2: 2
3: 8
4: 117
901227039_901227041 -9 Left 901227039 1:7619496-7619518 CCTTCACACTTCTCTTACCTCAT 0: 1
1: 0
2: 1
3: 27
4: 404
Right 901227041 1:7619510-7619532 TTACCTCATGAGCCAGAATTGGG 0: 1
1: 0
2: 3
3: 7
4: 149
901227039_901227046 25 Left 901227039 1:7619496-7619518 CCTTCACACTTCTCTTACCTCAT 0: 1
1: 0
2: 1
3: 27
4: 404
Right 901227046 1:7619544-7619566 TTCCTAAATATTCCCTTATGAGG 0: 1
1: 0
2: 2
3: 43
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901227039 Original CRISPR ATGAGGTAAGAGAAGTGTGA AGG (reversed) Intronic
901227039 1:7619496-7619518 ATGAGGTAAGAGAAGTGTGAAGG - Intronic
905301108 1:36986625-36986647 ATGAAGGAAGAGAAGTGACAAGG + Intronic
905328715 1:37176758-37176780 GGGTGGTAAGAGAAGTGAGAGGG + Intergenic
906265934 1:44429511-44429533 ATGATATTAGAGAAGTGAGAAGG + Intronic
906287797 1:44598943-44598965 ATGGGGTGGGGGAAGTGTGAGGG - Intronic
908066994 1:60416736-60416758 ATGAGGAAAGAGAAGGGAGGTGG + Intergenic
910036770 1:82798497-82798519 ATAAAGTAAGAGAAGTTTAATGG + Intergenic
910118563 1:83759565-83759587 ATCAGGTCACGGAAGTGTGAAGG - Intergenic
910276580 1:85455705-85455727 CTGAGGAAAGTGATGTGTGATGG + Intronic
910841308 1:91564670-91564692 ATGAGGTGACAGAAGTGAGTGGG + Intergenic
913219814 1:116650425-116650447 CTGAGGTATGAGAAGTCTGCTGG - Intronic
913485562 1:119329888-119329910 GTGATTTAGGAGAAGTGTGAAGG + Intergenic
915038308 1:152947002-152947024 ATGAGGCAAGGGGAGGGTGAAGG + Intergenic
915733542 1:158070633-158070655 ATGCAGTAAGAGAAGAGGGAGGG + Intronic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916220680 1:162441997-162442019 ATGAGAAAAGGGAAGAGTGAAGG + Intergenic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
916826495 1:168446925-168446947 AAAAGCTAAGAGAAGTATGATGG + Intergenic
917427077 1:174925475-174925497 ATGAGATAAGAGGAGAGTGGAGG + Intronic
917626394 1:176850795-176850817 GTGAGGTCAGAGAAGTATGGAGG + Intergenic
919072847 1:192777742-192777764 GTGATGTAAGAGAAGCATGATGG - Intergenic
920260078 1:204683428-204683450 AGGAGGAAAGTGAAGAGTGAAGG + Intronic
920786431 1:209046593-209046615 CTGGGGTCAGAGAAGTGAGAGGG + Intergenic
921896169 1:220403807-220403829 ACGATGTAAGAGAAAAGTGAGGG - Intergenic
922000488 1:221472854-221472876 ATGAGTTAAGAGAAATGAGATGG + Intergenic
922599440 1:226838443-226838465 ATGGGGTAAGGGATGTGGGAGGG + Intergenic
922966453 1:229694904-229694926 ATGAGGCTAGAGAGGTGGGAAGG - Intergenic
923088157 1:230717474-230717496 ATGAGGTAAGGAAAGAATGAAGG + Intergenic
923359633 1:233198274-233198296 ATGGGGGAGGTGAAGTGTGATGG - Intronic
1063901265 10:10734661-10734683 AGGAGGTAAGAGAAAAGGGAAGG + Intergenic
1066056427 10:31685376-31685398 ATGAGGATAGAGAAGGGTGGTGG - Intergenic
1067231823 10:44417497-44417519 AGGAGGAAAGAGAAGTGGAATGG + Intergenic
1067709822 10:48639099-48639121 CTGAGCTTAGAGAAGTGGGATGG - Intronic
1067722311 10:48737750-48737772 TTGAGGTAAGGGAAGTGAGAGGG + Intronic
1069218084 10:65847567-65847589 TTGAAGTAAGAAAAGTGAGATGG - Intergenic
1069509821 10:69033803-69033825 ATGAAGAAAGGGAAGTTTGAAGG - Intergenic
1070151660 10:73808795-73808817 AGGAGGTAAGAGAGATGGGATGG - Intronic
1070269919 10:74943612-74943634 ATGAGGTGAGATAAGGGTCAAGG - Intronic
1071074333 10:81732877-81732899 ATGGGGTAGGAGAAGGGAGATGG - Intergenic
1071310252 10:84336652-84336674 ATGAGGTCAGAGAGGTGGGTTGG + Intronic
1072512129 10:96138327-96138349 ATGAGGTCAGAGAAGTAACAAGG - Intronic
1073846406 10:107560751-107560773 TTTAGGTAAGAGAAGAGTAAAGG + Intergenic
1073870877 10:107862779-107862801 CTGAGGTAAGAGTGGTGTGGAGG + Intergenic
1074591409 10:114817285-114817307 ATGAGGTAAGTTTAGTGAGATGG - Intergenic
1075510987 10:123072984-123073006 ATGAGGAATGGGAAGAGTGATGG - Intergenic
1076749471 10:132535455-132535477 AGGAGGCAGGAGAACTGTGAGGG + Intergenic
1080110284 11:28559141-28559163 AGAAGGTGAGAGAAGTGTTAAGG - Intergenic
1080154564 11:29093960-29093982 ATGAGATGAGAGAAGCTTGAGGG - Intergenic
1080382834 11:31791608-31791630 ATGAATTAAAAGAAGTGTGTCGG + Intronic
1080571405 11:33560170-33560192 ATGAGATAAGAGAAATGCAAAGG - Intronic
1080915604 11:36655403-36655425 ATGTGGTAAGAACAGGGTGATGG - Intronic
1081124562 11:39307115-39307137 AGGAGGTAAGAGAAGGGACAAGG - Intergenic
1081559188 11:44197277-44197299 GTGAGGTAAGAGAAGCGGTAAGG - Intronic
1082762985 11:57144750-57144772 AGCAGATAAGGGAAGTGTGATGG - Intergenic
1085187280 11:74586500-74586522 TGGAGGTAAGGGAAGTTTGAGGG - Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085564463 11:77500866-77500888 CTGTGGTAAGAGAAGTCTGTTGG - Intergenic
1086101313 11:83102750-83102772 GTGTGGGAAGAGAAGTGGGAAGG - Intergenic
1086474777 11:87160771-87160793 ATGAGGTAATAGATTTGTGAAGG - Intronic
1087871785 11:103303564-103303586 TAGAGGTCAGAGAAGTGAGAAGG + Intronic
1089067280 11:115671371-115671393 AGGAGGGAGGAGAAGGGTGAAGG - Intergenic
1089223432 11:116895123-116895145 ATGAGGTCAGAGAGGTAAGAGGG - Intronic
1090106745 11:123861727-123861749 TTGAGGTAAAGGAAGTATGAAGG - Intergenic
1090689510 11:129163859-129163881 ATGAGGTCAGAGAAGTGGTTTGG - Intronic
1091330642 11:134728710-134728732 ATGAGGGAAGTGAAGTGGGCAGG - Intergenic
1091852055 12:3707355-3707377 ATAGAGCAAGAGAAGTGTGAAGG - Intronic
1093059538 12:14588787-14588809 ATGAGGTAACAGACAAGTGAAGG + Intergenic
1093506122 12:19868762-19868784 GTGAATTAAGTGAAGTGTGAAGG + Intergenic
1094056233 12:26272317-26272339 CTGAGGGGAGAGCAGTGTGAGGG + Intronic
1096752420 12:53769584-53769606 ATGATGAAAGAACAGTGTGATGG + Intergenic
1097848852 12:64391721-64391743 ATTAGGTTAGAGAAATGAGAAGG + Intergenic
1098348263 12:69528993-69529015 ATGAGGTAAGAGAGATGGGGTGG + Intronic
1098917129 12:76269184-76269206 ATGAGACCAGAGAAATGTGAGGG - Intergenic
1099807449 12:87537348-87537370 ATGAGGATAGAGTAGGGTGAAGG - Intergenic
1100568268 12:95819628-95819650 ATTAGGTTAAAGATGTGTGAAGG - Intronic
1101261395 12:103034622-103034644 ATGGCATAAGAGAAGTCTGAAGG - Intergenic
1102146370 12:110658018-110658040 ATGACGTGAGTGAAGTATGAAGG + Intronic
1102744361 12:115237340-115237362 ATGAGGTTGGAGCAGTGAGATGG + Intergenic
1102774316 12:115505499-115505521 TTGGGGTTAGAGAAGTGTCATGG - Intergenic
1102790687 12:115642743-115642765 AAGAGGAAAGAGAAGTGTGCAGG - Intergenic
1103046545 12:117739763-117739785 ATGAGGTAAGATAGGGGTGCTGG + Intronic
1104489477 12:129181591-129181613 ATGAGGTGGGAGAGGTGGGAAGG - Intronic
1105287207 13:19014123-19014145 AGCAGGTGAGAGAAATGTGAAGG - Intergenic
1107064361 13:36196487-36196509 ATGAGGAAAGAGAGGTGAAAGGG + Intronic
1107139799 13:36985840-36985862 ATGAGGTATGAGATGGCTGAAGG + Intronic
1107152712 13:37130332-37130354 ATAAGGAAGGAGAAGTATGATGG - Intergenic
1107602606 13:42028815-42028837 ATGTGTTAAGACAAGTGTAAAGG - Intergenic
1108058834 13:46512569-46512591 AAGAGGAGAGAGAAGTGTGTTGG - Intergenic
1112078475 13:95938876-95938898 ATAAGGTGAGAGATGTGAGATGG - Intronic
1112646101 13:101333675-101333697 TTGAGGTAAGAGCTGTGTTACGG + Intronic
1112892675 13:104258096-104258118 ATAAAGAAAAAGAAGTGTGATGG + Intergenic
1113467943 13:110525181-110525203 ATGAGGAAACTGAAGTGTGGGGG + Intronic
1113728601 13:112623999-112624021 GTGAGGTCAGTGAAGTGTGGAGG + Intergenic
1114192074 14:20447326-20447348 ATGAGGGCAGAGAAGAATGAAGG - Intronic
1114849306 14:26364043-26364065 ATGAGTTAAGAGGAGAGAGAAGG - Intergenic
1115076812 14:29402973-29402995 ATAAGGAAAAAGAAGTGTAATGG + Intergenic
1115310835 14:31976220-31976242 ATGAGGTCATAGAGGTGGGATGG + Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1117962203 14:61174563-61174585 ATGAGGTAAGAAGAATGGGATGG - Intergenic
1118108088 14:62683415-62683437 ACGAGGAAAGAGAAGTGTGCCGG - Intergenic
1118172024 14:63396568-63396590 CTAAGGTAAGTGGAGTGTGATGG - Exonic
1118880335 14:69820128-69820150 AGGTGGGAAGAGAAGGGTGATGG + Intergenic
1119409329 14:74419908-74419930 ATGAGGCAGGAGAGGTGGGAAGG + Intronic
1120087593 14:80292568-80292590 AAGAGGTAACAGTAGTGGGAGGG - Intronic
1120527885 14:85598894-85598916 ATGAAATAAGAGAAATGGGATGG + Intronic
1120819966 14:88903004-88903026 ATGATGTCAGAGATGTGTGTGGG + Intergenic
1120982612 14:90303902-90303924 CTAAGGTAAGAGAATTGGGATGG + Intronic
1121942298 14:98082711-98082733 AAGAGGTAAGACAAATGAGAGGG + Intergenic
1122187355 14:100010492-100010514 CTGAGGTAGGAGAATTGTGGAGG - Intronic
1202873543 14_GL000225v1_random:187812-187834 ATCAGGCTAGAGAAGTCTGAAGG + Intergenic
1124182609 15:27490906-27490928 ATGCGGCAAGAGCAGTGTGAAGG - Intronic
1125148563 15:36503811-36503833 CCGAGGTAAGAAAAGGGTGAAGG - Intergenic
1125695519 15:41633897-41633919 ATAAGGTCAGAGAAGTAAGAGGG - Intronic
1125871104 15:43102703-43102725 AGGAGGTGAGAGTAGTGTGATGG - Intronic
1125915595 15:43484571-43484593 AAGAGGTCAGAGAAGTCAGAAGG - Intronic
1125982088 15:44011668-44011690 AGGAGGAAAGAGAAGGGTAAAGG + Intronic
1127103965 15:55593573-55593595 ATGAGGTAAGAGATGGATGAGGG + Intergenic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1129042735 15:72704076-72704098 ATGGGGCAAGAGAAGTGGCAAGG + Intronic
1131802701 15:96088027-96088049 ATGAGGTTAGAGAAGGGGGAAGG - Intergenic
1132364653 15:101248676-101248698 ATGAGGGAAGAGATGTGGAAAGG + Intronic
1133821541 16:9241529-9241551 ATGAGGTCAAAGAAGTAGGAAGG - Intergenic
1134428531 16:14178037-14178059 ATTAGAAAAGAGGAGTGTGAGGG + Intronic
1135377802 16:21964483-21964505 ATAAAGTAAGAGAAGTGGGCTGG - Intronic
1136386922 16:29933444-29933466 ATGAGTTAAGTAAATTGTGATGG + Intergenic
1140617383 16:76682796-76682818 CTGAAGTAAGAGAAGTCTTATGG - Intergenic
1141154965 16:81590867-81590889 AAGAGGAAATAGAAATGTGATGG - Intronic
1141815447 16:86406309-86406331 ATGAGGAAAGAGTGTTGTGAAGG - Intergenic
1143225395 17:5297967-5297989 AAGAGGAAAGAGAAGTCTTAAGG - Intronic
1143660293 17:8320539-8320561 ATGAGGTCATAGAAGTGGCAGGG + Intronic
1143862315 17:9899810-9899832 ATGAAATAAGAGAAGCATGAAGG - Intronic
1144291228 17:13828535-13828557 ATGAGGAGAGAGGAATGTGAGGG + Intergenic
1146142198 17:30378131-30378153 ATGAGGTGGGAGAAGTGGGCCGG + Intergenic
1146297955 17:31665054-31665076 ATGAGGTGGGAGAAGGGGGAAGG - Intergenic
1146929055 17:36765043-36765065 ATGTGGTAAGGAAAGGGTGAGGG + Intergenic
1147039442 17:37706797-37706819 ATGGTATAAGAGAAGTGTGGAGG + Intronic
1147436495 17:40419699-40419721 ATGATCTCAGAGTAGTGTGAGGG + Intergenic
1147808683 17:43150947-43150969 ATGAGGTATGGCAAGAGTGAAGG + Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148948617 17:51288512-51288534 ATGAGGAAAGAAAATTGTGAAGG - Intronic
1150096467 17:62380521-62380543 ATGAGGTCACAGTTGTGTGATGG + Intronic
1150178549 17:63089454-63089476 ATGAAGTCAGAGAAGTTGGAAGG + Intronic
1150368338 17:64611855-64611877 ATGAGGTCAGAGAGGTGAGCAGG - Intronic
1151095424 17:71492175-71492197 CTGAGGTAAGAGAGGAGAGAAGG + Intergenic
1151489711 17:74425518-74425540 AAGAGATAAGAGAAGTGTACTGG + Intronic
1151541615 17:74767611-74767633 ATGAGGTGAAAGAAGGTTGAGGG - Intronic
1152178007 17:78800506-78800528 ATGAGGTCAGATTTGTGTGAAGG - Intronic
1153642744 18:7170317-7170339 ATTAGGTAAAATATGTGTGAAGG - Intergenic
1155082782 18:22427304-22427326 ATGAGGTAAGGAAAGTGAGAAGG - Intergenic
1155108545 18:22690786-22690808 ATGAGCTTAGAGAAATGTGGTGG - Intergenic
1156162329 18:34374372-34374394 ATGAGGCATGAGAAGGGTCAGGG - Intergenic
1156315696 18:35966918-35966940 ATGTGGCAAGAGCAGTGAGACGG + Intergenic
1156574493 18:38298932-38298954 TAGAGGTAAGAAAAGTGGGAAGG + Intergenic
1157145270 18:45156189-45156211 ATGAGATAAGAGCACGGTGAAGG + Intergenic
1157359190 18:46962997-46963019 AGGAGGCAAGAGAAGTCTGCAGG - Exonic
1157360184 18:46968924-46968946 AGGAGGCAAGAGAAGTCTGCAGG - Exonic
1157360785 18:47022516-47022538 AGGAGGCAAGAGAAGTCTGCAGG - Exonic
1157361774 18:47028431-47028453 AGGAGGCAAGAGAAGTCTGCAGG - Exonic
1157362579 18:47033277-47033299 AGGAGGCAAGAGAAGTCTGCAGG - Exonic
1157684028 18:49628684-49628706 AGGAGGTAAGAGAAGAATGGTGG + Intergenic
1158043687 18:53129280-53129302 ATGAAGAAAGAAAAGTGCGAGGG - Intronic
1158433419 18:57414310-57414332 ATGAGGGAATAGATATGTGAGGG + Intergenic
1158919554 18:62175565-62175587 ATGAGGTGAGAGAGGTATGCAGG - Intronic
1162551184 19:11359336-11359358 AGGAGGTGAGAGAAGGGTCAGGG - Intronic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1164649045 19:29879023-29879045 CTGGGATAAGAGACGTGTGAAGG - Intergenic
1165765220 19:38346318-38346340 ATGAGGTCAAGGAAGTGAGAAGG + Intronic
1167081386 19:47278416-47278438 TTGGGGTAAGATAAGTGTGGAGG - Intergenic
1167410310 19:49340213-49340235 ATGAGGTCAGAGAAGTCGAAGGG - Intronic
1168069232 19:53940620-53940642 ATGAGGTTAGAGAAAGGGGAAGG - Intronic
1168456871 19:56519028-56519050 ATGAGGTTATAGAAGTAGGAAGG - Intronic
1168651133 19:58093074-58093096 ATGAGGTAACAAAAGGGTGGGGG - Intronic
925173299 2:1765909-1765931 ATGGGGTAAGGGGAGTGGGAAGG + Intergenic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
926205437 2:10831882-10831904 ATGAGGAGAGAGAGGTTTGAGGG - Intronic
926478512 2:13358316-13358338 ATGAGGTAAAGAAAGTGTGAGGG + Intergenic
927578298 2:24219077-24219099 AGGAGGAAACAGAAGTGGGATGG - Intronic
928697136 2:33860792-33860814 ATTAGGTAAGGGAAGTGAGAAGG + Intergenic
929084353 2:38153687-38153709 ATAAGGTCAGAGAAGTAAGAAGG + Intergenic
930729800 2:54717410-54717432 ATGAGGTGAAAGACGTGTGCTGG + Intergenic
931306296 2:61032109-61032131 AACAGGTAAGAGAACTGTAAGGG + Exonic
931690977 2:64834555-64834577 AGCTGGCAAGAGAAGTGTGAAGG + Intergenic
932426068 2:71636134-71636156 GTGAGGTCAGGGAGGTGTGAGGG + Intronic
932438135 2:71715266-71715288 AGGAGGCTAGAGAAGTGTGTAGG - Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
933306311 2:80604175-80604197 ATCAGGTAATAGAAGAGGGAAGG + Exonic
935004668 2:99060888-99060910 ATGATGTAAGATAAGGGTCAAGG - Intronic
935348356 2:102130441-102130463 AAGAGGAAAGATAAGAGTGAGGG - Intronic
935362908 2:102262803-102262825 ATGAGGGAGGAGATGGGTGAAGG + Intergenic
935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG + Intergenic
938259608 2:129885861-129885883 AAGAAGTAAGAGAAGCGTGAGGG + Intergenic
938679214 2:133672153-133672175 AGGAGCTAAGAGAAGAGTCAGGG + Intergenic
939179297 2:138785244-138785266 AGGAGGTAACAGGAGTGTGTTGG + Intergenic
939413853 2:141866785-141866807 ATGAGGTAAGAGAAGGGGAGAGG + Intronic
939633245 2:144550891-144550913 ATTAGGAATGATAAGTGTGATGG + Intergenic
940708367 2:157131997-157132019 GTGAGGTAAGAAAGGTGTTATGG - Intergenic
941919769 2:170838755-170838777 CTGAGCTAAGAGAAGAGTAAGGG - Intronic
943284647 2:185982090-185982112 CTGAGGAAAGATAAGTGAGAAGG + Intergenic
943458797 2:188143349-188143371 ATGAAGTAAGAGAGGTCAGAAGG - Intergenic
943522876 2:188975854-188975876 ATGAGTGAAGAGAAGTCTAAAGG - Intronic
944081952 2:195797862-195797884 ATGAGGTCTGAGATGTGTGAAGG - Intronic
944226828 2:197356546-197356568 GTGCGGAAAGAAAAGTGTGAGGG + Intergenic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
945743670 2:213694161-213694183 AGGAGGTAAGAGAAGGAGGAGGG + Intronic
946084136 2:217154238-217154260 ATGGGGTAAAAGGAGTGAGATGG - Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947318049 2:228885166-228885188 ATGAGGTATGAAAATTGTAAAGG + Intronic
947475518 2:230444477-230444499 ATGAGCTAAGAGAAGACTCATGG - Intronic
948083767 2:235229160-235229182 GTGAGGAGAGAGACGTGTGAAGG + Intergenic
1169232590 20:3901573-3901595 AAGAGGGAAGAGAAGGGAGAAGG - Intronic
1169288129 20:4326494-4326516 ATGAGGAAATTAAAGTGTGAGGG + Intergenic
1170307190 20:14951518-14951540 ATGAAGTAAGAGAGGAGTGGTGG + Intronic
1171134537 20:22684727-22684749 ATGAGGTAAGAGAGTGGGGATGG - Intergenic
1172859076 20:38033386-38033408 ACGAGGTAAGGGAAGAGTGGCGG - Exonic
1173025641 20:39305251-39305273 ATGAGGTGAGAGAAGCAGGATGG + Intergenic
1174348938 20:49952874-49952896 GTCAGCTAAGAGAAGTGGGAGGG + Exonic
1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG + Intergenic
1175043139 20:56075325-56075347 TTGAGGGAAGAGAAGTGAAATGG - Intergenic
1180821110 22:18828469-18828491 CTGAGGTATGAGAAGTCTGCTGG - Intergenic
1181191868 22:21147576-21147598 CTGAGGTATGAGAAGTCTGCTGG + Intergenic
1181207328 22:21262934-21262956 CTGAGGTATGAGAAGTCTGCTGG - Intergenic
1182017866 22:27055967-27055989 ATGAGGTCAGAGAGGTGAGCAGG + Intergenic
1182059277 22:27385511-27385533 ATGAGGACAGAGAGGTGTCAGGG + Intergenic
1182200164 22:28560482-28560504 ATGAGGTCAGAGAGGTAGGAGGG - Intronic
1182860412 22:33554796-33554818 ATAAGGTAAGAGAGGTATAAAGG - Intronic
1183911626 22:41083858-41083880 CTGGGGTGAGAGAAGTGTTATGG - Intergenic
1185065283 22:48628993-48629015 AGGAGTAAAGAGGAGTGTGAGGG + Intronic
1185358184 22:50387725-50387747 AAGAGGGAAGAGAGGTATGAGGG + Intronic
1203219590 22_KI270731v1_random:32482-32504 CTGAGGTATGAGAAGTCTGCTGG + Intergenic
1203271235 22_KI270734v1_random:54345-54367 CTGAGGTATGAGAAGTCTGCTGG - Intergenic
951204077 3:19907580-19907602 ATGAGGTAAATGAAATATGAGGG - Intronic
951333575 3:21394361-21394383 ATGAAGTTAGAGAAGGGGGATGG + Intergenic
951433350 3:22633805-22633827 ATGAGAGATGAGAAGAGTGAGGG - Intergenic
951586083 3:24216135-24216157 TTAAGGTGTGAGAAGTGTGAAGG + Intronic
951814978 3:26744457-26744479 AGCAGGAAAGAGAAGAGTGAAGG + Intergenic
952114689 3:30164359-30164381 ATGAGGTATGGGAAGGGTGAAGG + Intergenic
952740718 3:36731644-36731666 ATGAGGAAAGAGAAGACTCAAGG - Intronic
952975094 3:38687086-38687108 ATGAGGTCAGGGAGGAGTGAGGG + Intergenic
953317682 3:41943802-41943824 ATAATGTAAGTGAAGTTTGAGGG - Intronic
954714720 3:52521332-52521354 ATGGGGTAGGAGAAGTGAGGTGG - Intronic
955550070 3:60074377-60074399 ATGAAGTTAGAGAAGTGGCATGG - Intronic
957683409 3:83469619-83469641 ATGAGAGAAGAGAAGAGGGAAGG + Intergenic
958568718 3:95851583-95851605 TTGAGGCAAGAGAAGTGGGGTGG + Intergenic
959444394 3:106420511-106420533 ATAGGGAAAGAGAAGGGTGAGGG + Intergenic
959550278 3:107647890-107647912 AAGAGGAAAGAGAAAAGTGATGG + Intronic
960231654 3:115235096-115235118 ATGAGGTCAGAGAAGAGGGAAGG + Intergenic
960552092 3:118987242-118987264 GTGAGGCCAGATAAGTGTGAGGG + Intronic
960735509 3:120775172-120775194 ATGAAGTAAGACAAAAGTGAAGG + Intronic
960994332 3:123331050-123331072 AGTAGGAAAGAGAAGTGGGAGGG + Intronic
961798652 3:129427822-129427844 ATGAGGTGAGAGAGGTCAGAAGG - Intronic
962622028 3:137189808-137189830 ATGAAGTAAGGGAAGGGTGGGGG + Intergenic
963843336 3:150130350-150130372 ATGGGGTGAGATAAGTGTCAGGG + Intergenic
964318184 3:155465907-155465929 AGGAGGGAAGAGGAGTGGGAAGG + Intronic
964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG + Intergenic
964740925 3:159965173-159965195 AAGAGCTAAAAGAAGAGTGAGGG - Intergenic
964951499 3:162300566-162300588 ATGAGGCAAGAGTATGGTGAGGG + Intergenic
965137958 3:164798651-164798673 ATGAGGTCAGAGAGGTAGGAAGG - Intergenic
965801365 3:172497126-172497148 TTGAGCCAAGAGAAGCGTGAGGG - Intergenic
968152764 3:196351694-196351716 AAGAAGAAAGAGAAGTGTGAAGG + Exonic
968919876 4:3516964-3516986 AGGTGGGAAGAGAAGTGTGTGGG + Intronic
968987009 4:3880930-3880952 AGGAGGAAAGAGATGGGTGACGG + Intergenic
969728820 4:8941213-8941235 AAGAGGAAAGAGATGGGTGATGG - Intergenic
969965492 4:10990188-10990210 ATGAGGAATGAGAAATTTGACGG + Intergenic
969997900 4:11333371-11333393 ATGAGGAAATAGAAGTGGAAAGG + Intergenic
970546077 4:17131742-17131764 ATGAGGCCAGAGAAGTGGAAGGG - Intergenic
970651762 4:18186413-18186435 AGGAGGAAAGAGAATTGAGAAGG + Intergenic
970969973 4:21970928-21970950 AATAGTTAAGAGAAATGTGATGG + Intergenic
971363444 4:25957307-25957329 ATGAGGCAAGACAAGTGACAAGG - Intergenic
972106962 4:35500736-35500758 AGGAGGTAATAGAAGAGTCAGGG - Intergenic
972365323 4:38369027-38369049 TTGAGGTCAGAGAGGTGGGATGG - Intergenic
972370824 4:38421712-38421734 ATGAGGTAAAAGATGTGTATAGG - Intergenic
973242820 4:47975858-47975880 ATGAAGGTAGAGAAGTGGGAAGG - Intronic
978164162 4:105586878-105586900 CTGAGGGCAGAGAGGTGTGAGGG - Intronic
979766174 4:124466865-124466887 GTGAGCTAAGAGAACTCTGAAGG - Intergenic
979987825 4:127337094-127337116 AAGAGGTAAGAGAAGGGTTTGGG - Intergenic
980288831 4:130817498-130817520 ATGAGGCAAAAGCAGTGTTAAGG - Intergenic
980468905 4:133224332-133224354 ATCAGGTTAAAGAAGTGTGATGG - Intergenic
980619055 4:135273247-135273269 GTGAGGTTAGAGAAGTGATATGG - Intergenic
980788590 4:137587947-137587969 AGTATGTAAGAGATGTGTGAAGG - Intergenic
981357725 4:143810022-143810044 AGTAGGTAAGAGAAGAGAGAGGG + Intergenic
983026826 4:162747825-162747847 AAGAGTTAAGAGTAGTGAGAGGG - Intergenic
983073056 4:163292477-163292499 ATAAGGTAAGTGCAGTGAGAAGG + Intergenic
983775514 4:171601918-171601940 ATCAAGTAAGTGAAGTCTGATGG + Intergenic
984320460 4:178189461-178189483 ATGAGGTAGGACATGGGTGATGG + Intergenic
984735901 4:183107650-183107672 GTTAGGTAAGAGAAGTTAGAGGG + Intronic
987100755 5:14589449-14589471 AGGAGGTGAGAGAAGAGGGAGGG + Intronic
987218629 5:15766217-15766239 ATGAGGGAAAAGAAGTTTCATGG - Intronic
988685517 5:33521747-33521769 AAGAGGTAAGATTAGCGTGAAGG - Intergenic
988708934 5:33754300-33754322 AAGATGTAAGAGAAGTGGGCAGG - Intronic
988926110 5:35992403-35992425 AAGGGGAAAGAGAAGTGTGGAGG + Intergenic
989248769 5:39283158-39283180 AAGAAGTTAGAGAAGTGGGATGG - Intergenic
989529361 5:42489190-42489212 ATGAGGTAAGAAGAGTGGGGAGG - Intronic
989792038 5:45416594-45416616 ATTTGGTAAGAGAAGGATGAAGG + Intronic
990498962 5:56376089-56376111 GTGAGTGAAGAGAAGTGAGAGGG + Intergenic
991700522 5:69312640-69312662 AGGAGATAAGAGAAGTGGGGTGG + Intronic
992774883 5:80080411-80080433 ATGAGGTAAGAGGTGTGGCAGGG + Intronic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
993097343 5:83494845-83494867 AGGAAGTGAGAGAAGTGTGGGGG + Intronic
993118963 5:83751846-83751868 CTGAGGACAGAGAAGTTTGAAGG - Intergenic
993809051 5:92452812-92452834 ATGAAATAACAGAACTGTGAAGG - Intergenic
993974145 5:94456200-94456222 AAGAGATCAAAGAAGTGTGAGGG - Intronic
994447757 5:99899293-99899315 ACTAGGTAAGAAAAGTATGATGG - Intergenic
995018206 5:107337075-107337097 ATGAAGAAATAAAAGTGTGAAGG - Intergenic
995470335 5:112495023-112495045 ATGAGGTTAGTGAAGTGTCTGGG - Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995940706 5:117579783-117579805 ATGAGATTAGAGAAATTTGAAGG - Intergenic
996555931 5:124778824-124778846 ATCAGGTTTGAGAACTGTGATGG + Intergenic
996972811 5:129393573-129393595 AAGAGGGAAGAGAAGAGGGAAGG + Intergenic
997009097 5:129855896-129855918 ATTGGGGAAGAGAAGTGAGAGGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998005333 5:138653202-138653224 CTGGGGCAAGAGAAGGGTGAAGG - Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999665309 5:153906579-153906601 ATGAGGTAATATATGTGAGATGG - Intergenic
1000119213 5:158180566-158180588 ATGAGGGACGAGAAGTTTGTTGG + Intergenic
1002987729 6:2207099-2207121 ATCATGTAAAAGAAGTCTGATGG + Intronic
1002987825 6:2208118-2208140 ATCATGTAAGAGAAGTCTGATGG + Intronic
1003717064 6:8659190-8659212 GTCAGGTAAGGGAAGTGAGAGGG + Intergenic
1004971204 6:20912404-20912426 ATGAGGGAAGTGTAGTGTGTTGG + Intronic
1005826779 6:29636822-29636844 ATGACGAAAGAAAAGTGTGCAGG - Intergenic
1006981038 6:38148472-38148494 ATGAGGTAGAGGAAGTGTTAAGG + Intronic
1008388730 6:50924015-50924037 ATAAGCAAAGAGAAGTGAGAAGG - Intergenic
1008705279 6:54150604-54150626 ATGAGGCGAGACAAGTATGAGGG - Intronic
1010085571 6:71913784-71913806 TTGAGGAGAGAGAAGTGTGCTGG - Intronic
1012030136 6:94049332-94049354 ATGTGGTATGAGAAGTGGCATGG + Intergenic
1012259682 6:97073145-97073167 ATGAGGGAAGACAGGGGTGAGGG - Intronic
1012411225 6:98959751-98959773 AAGAGGTAGGAGAAGTTTGAAGG - Intergenic
1012526311 6:100182263-100182285 ATGAGGGAAGAGAAGAGAAAGGG - Intergenic
1012631275 6:101470623-101470645 ATGGGGGAAGAGTAGGGTGATGG + Intronic
1013067890 6:106701206-106701228 ATGAGGTAAGAGAAGAGCAAAGG - Intergenic
1013127332 6:107196997-107197019 ATAAGTTAAGACAAGTGGGAAGG - Intronic
1013263547 6:108471080-108471102 ATGAGGAGGGAGAAATGTGAGGG + Intronic
1015471438 6:133611142-133611164 ATGAGGTCAGAGAATTGGCATGG - Intergenic
1015539543 6:134300216-134300238 ATGAGTTAAGAGATGAGTTAAGG + Intronic
1015988544 6:138911554-138911576 AGCAGGTAATAGATGTGTGAGGG + Intronic
1016401782 6:143688968-143688990 ATGAGGTCAGAGAGGTGGGCAGG - Intronic
1017241318 6:152172182-152172204 AGGAGGGAAGAAAAGAGTGACGG + Intronic
1017274463 6:152549706-152549728 ATGAGTTAAGAGAATTTTTAGGG + Intronic
1021229505 7:18068849-18068871 ATGAGTTAAGAGAAGTAGGCAGG - Intergenic
1021586324 7:22212489-22212511 ATGAGGTCAGAGATGTATCAGGG + Intronic
1022594487 7:31699282-31699304 GTGAGGTAAAAGAGCTGTGATGG - Intronic
1023041504 7:36176803-36176825 GTGAGGAAAAAGAAGTGGGAGGG + Intronic
1023207088 7:37763134-37763156 AGGAAGGAAGAGCAGTGTGATGG + Intronic
1023535351 7:41202980-41203002 AGGAGGGAAGAAAAGAGTGAAGG - Intergenic
1024247909 7:47484429-47484451 ATAAGGGAGGAAAAGTGTGACGG - Intronic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1026506060 7:70984999-70985021 ATAAGGTAAGCCAAGTGTTAAGG - Intergenic
1029349507 7:100003275-100003297 CTAAGGTAAGAAAAGTGTCAGGG + Intergenic
1029908471 7:104118516-104118538 ATCTTGTAAAAGAAGTGTGAGGG - Intergenic
1030332256 7:108283790-108283812 ATGGAGTAAGAGAATTGTAAGGG - Intronic
1030589010 7:111456967-111456989 AGTAGGTAAGAGAAGAGAGAGGG - Intronic
1030915470 7:115306702-115306724 ATGAGCTCAGAGAAAAGTGAAGG - Intergenic
1031843614 7:126777219-126777241 ATAAGGTCAGAGAAGTGAAAGGG + Intronic
1032223932 7:130015435-130015457 AGGATTTAAGGGAAGTGTGAGGG - Intergenic
1032627780 7:133611192-133611214 AATAGGAATGAGAAGTGTGATGG + Intronic
1032637400 7:133724895-133724917 ATGAGGTCAGAGAAGTGGTGTGG + Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1033137648 7:138798234-138798256 AGGAGGGAAGAGAGGTGGGAGGG + Intronic
1033467465 7:141608514-141608536 ATGAGGTTAGAGAAGTAAGGAGG + Intronic
1033793868 7:144824098-144824120 ATGTGGTAAGAGACATGTAAGGG - Intronic
1033883880 7:145920582-145920604 GTGAGGGAAAAGAAGAGTGAAGG - Intergenic
1034965305 7:155387171-155387193 ATGAGGAAACAGATGTGTGGAGG + Intronic
1036138882 8:6188124-6188146 ATAAGCAAAGAGAAGTGTAAAGG + Intergenic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1038207454 8:25480568-25480590 ATGAGGAAAGAGAAAGTTGATGG + Intronic
1038897078 8:31796318-31796340 ATGGGGTTAGAGAAGAGTAAGGG - Intronic
1041174675 8:55182480-55182502 ATGAGGTGAGGTAAGTGTCAAGG + Intronic
1041558632 8:59188203-59188225 ATGAGGTGATAGGAGTGTGGTGG - Intergenic
1041570891 8:59335913-59335935 GGGAGGTAAGTGAAGTGTCAAGG + Intergenic
1042128779 8:65565737-65565759 CTGTGGTAAGAGAAGGGTGTTGG + Intergenic
1042350105 8:67768487-67768509 ATGAGGTCAGAGAAGTGACGAGG - Intergenic
1042438626 8:68797781-68797803 ATTAGGTCAGATAAGTGTCAGGG + Intronic
1043305469 8:78788043-78788065 ATGAGGTAAAAGTATTTTGATGG - Intronic
1043915390 8:85916973-85916995 AAGAGGTAAGAGGAGGGTGATGG - Intergenic
1044235821 8:89828913-89828935 CTGTGGTCAGAGAAGTGGGAAGG + Intergenic
1044469420 8:92549388-92549410 CTGAGGGAAAACAAGTGTGAAGG - Intergenic
1044775345 8:95681184-95681206 ATGAGGAAAGAAAATTGTGGAGG + Intergenic
1045058049 8:98385950-98385972 ATGAGCCAAGAGATGTGTTAGGG + Intergenic
1045315859 8:101043038-101043060 ATAAGGTAAGCCAAGTGTGGTGG - Intergenic
1045961559 8:107974664-107974686 TTGAGGGAAGAGAGGTGGGAGGG + Intronic
1046888008 8:119389965-119389987 ATGAAATAAGGGATGTGTGATGG - Intergenic
1047929179 8:129709708-129709730 ATGAGGACAGAGAATTGGGAAGG - Intergenic
1049101243 8:140580448-140580470 GTGTGGTAAGAGAAATGGGAAGG + Intronic
1049937425 9:512833-512855 AAGAGGAAAGAGAGGTGTGAGGG - Intronic
1050322020 9:4462361-4462383 ATGAGGTAAGAGACCAGTGGGGG + Intergenic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1051287914 9:15514913-15514935 ATGAGATAAGAGAAGTCTTAAGG + Intergenic
1051512139 9:17889858-17889880 ATGAGGGAAGAGGACAGTGATGG - Intergenic
1051951489 9:22639269-22639291 ATTAGGAAAGAGAAGAGAGAAGG + Intergenic
1052849770 9:33370644-33370666 ATGTGGTATGAGAAGTGCCAGGG - Exonic
1053311225 9:37021672-37021694 TTGATGTAAGAGAAGGGTGGAGG - Intronic
1053465221 9:38302030-38302052 ATAAGGTTAGAGAGGTGTCAGGG + Intergenic
1055478689 9:76688669-76688691 ATGATGCAAGAGAAATGGGAGGG - Intronic
1056285259 9:85081188-85081210 ATAAGGGAAGAGAAGAGAGAAGG - Intergenic
1058248911 9:102667692-102667714 ATGACATAATAAAAGTGTGAAGG - Intergenic
1058977034 9:110134521-110134543 ATGTGGAAAGTGAAGAGTGAAGG + Intronic
1059080490 9:111243839-111243861 AAGAGAGAAAAGAAGTGTGAAGG + Intergenic
1059731086 9:117057944-117057966 ATGAAGAAAGAGAGGTGGGAGGG - Intronic
1059811656 9:117861889-117861911 AAAAGGGAAGAGAAGGGTGAGGG - Intergenic
1060116022 9:120941543-120941565 ATGAGGTCAGAGAAGTGAGAGGG - Intergenic
1061338579 9:129960617-129960639 ATGAGGTCAGAGAAGAAAGAGGG + Intronic
1061712688 9:132498816-132498838 ATGAGGGCAGAGGAGTGGGAGGG + Intronic
1187057855 X:15757842-15757864 ATGAGATTAGATAAGTGAGATGG + Intronic
1188055511 X:25536418-25536440 ATGAGAGGAAAGAAGTGTGATGG + Intergenic
1189518169 X:41736857-41736879 ATGAGGTCAGAGAAGTTTCCTGG - Intronic
1190008245 X:46759625-46759647 ATGAGGAAAGAGAGGTGTAGGGG - Intergenic
1190321481 X:49182429-49182451 ATGAGGTCAGAGATGTGGCAGGG - Intronic
1190432947 X:50395044-50395066 ATGAGGTCAGAGAGGTGACATGG + Intronic
1190742875 X:53301685-53301707 GGGAGGGAAGAGAAGTGTGGAGG + Intronic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190853072 X:54265524-54265546 ATGAGGTCAGAGAGTTGTGCAGG + Intronic
1192336148 X:70221493-70221515 ATGAGGTGAGAGAGGTGACAGGG + Intergenic
1192533392 X:71908795-71908817 ATGAGGTACGAGCAGATTGAAGG - Intergenic
1192536226 X:71930174-71930196 GTGAGGTAAGAGAGGTGGGCAGG - Intergenic
1193254556 X:79331839-79331861 ATGAGGCAGGAGAATAGTGAAGG - Intergenic
1194060269 X:89188059-89188081 ATGAGGTATGGGAAGTATGGGGG - Intergenic
1194311558 X:92315456-92315478 CTGAGGCCAGAGAAGTGAGATGG - Intronic
1194633209 X:96312097-96312119 AGGAGATTAGAGAAATGTGAAGG + Intergenic
1195108164 X:101620161-101620183 AAGAGGTAAGAGAATTGAAAGGG - Intergenic
1195737475 X:108028518-108028540 AGAAGCTGAGAGAAGTGTGAGGG + Intergenic
1195827371 X:109016674-109016696 ATGGGGTAGGAGAAGTGGGGAGG + Intergenic
1195887635 X:109656986-109657008 ATGAAGAAAGAGATGTGTGTGGG - Intronic
1196358974 X:114830359-114830381 AGGAGGTAAGGGAAGTGGGAAGG + Intronic
1196679341 X:118455137-118455159 GTGAGGAAGGAGAAGTGTTAGGG + Intergenic
1196925436 X:120629682-120629704 AATAGGGAAGAGAAGTGAGAGGG + Intronic
1197611440 X:128643489-128643511 ATTAGGTGAGAGTAGGGTGAGGG - Intergenic
1197635631 X:128911882-128911904 AAGAGGGAATAGAGGTGTGAAGG + Intergenic
1197983302 X:132241272-132241294 CTGAGGGAAGAGAAGTGCAACGG + Intergenic
1199730741 X:150629784-150629806 ATGAGGTAGCTGAAGTGTGCCGG - Intronic
1200619833 Y:5429590-5429612 CTGAGGCCAGAGAAGTGAGATGG - Intronic
1201562704 Y:15334518-15334540 ATGAGAGAAAAGAAGTGTAAGGG + Intergenic
1201970211 Y:19784435-19784457 ATGTGGTAAAAGCAGTGTTAAGG + Intergenic