ID: 901227578

View in Genome Browser
Species Human (GRCh38)
Location 1:7623043-7623065
Sequence CTTGAGAAGGCCTCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901227578 Original CRISPR CTTGAGAAGGCCTCTGAGGA TGG (reversed) Intronic
901227578 1:7623043-7623065 CTTGAGAAGGCCTCTGAGGATGG - Intronic
901874802 1:12161402-12161424 GTTGAGAAGGACTCTGAGCCTGG - Intergenic
903462248 1:23528177-23528199 CTTTCCAAGTCCTCTGAGGAAGG - Intronic
903574737 1:24332202-24332224 CTTGGGAAGGCCCCGAAGGAAGG - Intronic
903835583 1:26201308-26201330 TTTCAGAAGGCCTCAGGGGAGGG - Intronic
904775947 1:32906629-32906651 CATGTGAAGGCCACTGAGGATGG - Intergenic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
906568871 1:46819590-46819612 CTTGAGGAGGCCTGGGAGGCTGG + Intergenic
908529153 1:65017220-65017242 CTTTAGGAGGCCTCCGAGGCAGG + Intergenic
908541975 1:65130412-65130434 CTTGAAAAGACCTCAGATGATGG + Intergenic
910743783 1:90551030-90551052 CTTGAGAAAAGTTCTGAGGAGGG - Intergenic
911173289 1:94793650-94793672 CTTGAGCAGGATTTTGAGGAAGG + Intergenic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
920864108 1:209737187-209737209 CCTGAGACGACCTCTTAGGAAGG - Intergenic
921101033 1:211929820-211929842 CTTGTGGGTGCCTCTGAGGAGGG + Intergenic
921764836 1:218959507-218959529 GACGAGAAGGCCTTTGAGGAGGG - Intergenic
922991333 1:229914834-229914856 CTTGGCAAGGCCACTGAGGGTGG - Intergenic
923257774 1:232235846-232235868 CTTGAGATGGCGTCTTAGGCAGG - Intergenic
1063389553 10:5640388-5640410 CCTGAGAGTGCCTTTGAGGATGG + Exonic
1066402199 10:35087446-35087468 CTTGAGAAGCCCTCGTTGGATGG + Intronic
1067079406 10:43204789-43204811 CTGGGGTAGGCCTCTGAGAAGGG + Intronic
1067303328 10:45034437-45034459 TATGAGAGGGCCTCTGAAGAGGG + Intergenic
1067717092 10:48698032-48698054 CTTGAGATGGCCTCCGAGGAGGG + Intronic
1073867668 10:107823798-107823820 CTTGAGATACCCTCTGAGGTGGG - Intergenic
1074897624 10:117790992-117791014 CTTGACAATGCCTCAGGGGAAGG + Intergenic
1075278114 10:121113426-121113448 CTTGAGATGGTCTCTGACTAAGG - Intergenic
1076470492 10:130714828-130714850 CTGAGGAAGGCCTCTGGGGATGG + Intergenic
1076525681 10:131111110-131111132 CTTGAGAGGGCCTCAGATCAGGG + Intronic
1076559170 10:131349936-131349958 CTTGAGGTGGCCTTTGAGGTGGG + Intergenic
1078612308 11:12831230-12831252 TTTGAGATGGGCTCTGAAGAAGG - Intronic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1081270739 11:41079199-41079221 CTGAAGATAGCCTCTGAGGAGGG + Intronic
1084575825 11:69987250-69987272 CTTGAGGAAGCCGCTCAGGAAGG - Intergenic
1084580302 11:70019147-70019169 CCTAAGCAGGCCTCTGTGGAAGG + Intergenic
1084672577 11:70615967-70615989 CCTGAGAGGGCTGCTGAGGAAGG + Intronic
1084680331 11:70662972-70662994 GCTGGGAAGGCCTCTGTGGAGGG + Intronic
1084936119 11:72587613-72587635 CTTGGGAAGGCCTTTGGGGAAGG - Intronic
1085137012 11:74100270-74100292 CTTGACAAACCCTCTGAGGCAGG - Intronic
1086057301 11:82661826-82661848 CTTGAGAAGGATTCTGGGGCTGG + Intergenic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1087102428 11:94378881-94378903 CTTGAGGCTGCCTCTAAGGAGGG + Exonic
1089181037 11:116582971-116582993 CTGCAGAAGTCCTCAGAGGAAGG - Intergenic
1089748481 11:120633700-120633722 CATTAGAAGGCCCCTGAGCAGGG + Intronic
1090429037 11:126630623-126630645 CTGGAGCTGGCCTCTGAGTAGGG + Intronic
1091683816 12:2547131-2547153 TTTGAGAAGGCTTCCAAGGAGGG - Intronic
1093027219 12:14255928-14255950 TTCAGGAAGGCCTCTGAGGAAGG + Intergenic
1096219779 12:49821813-49821835 CTTGAGAATTCCTCAGAGGCCGG + Intronic
1102365402 12:112329862-112329884 CTTGGGAAGGCCTAAGAGGTAGG + Intronic
1102741051 12:115207767-115207789 CTTTAGATGGCCTCAGTGGAAGG - Intergenic
1103150226 12:118631702-118631724 ATTCAGAAGGCCTTTGAGGAGGG - Intergenic
1104319330 12:127735642-127735664 CTAAAGAAGGTCTCTGAAGAAGG - Intergenic
1104498893 12:129266092-129266114 CTTGTGAAGGCCACTGATGATGG + Intronic
1104518991 12:129455567-129455589 CTGGGGAAGGCTTCTAAGGAGGG + Intronic
1104843882 12:131837186-131837208 CCTGCCAAGGACTCTGAGGAAGG + Intronic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1108778275 13:53794698-53794720 CCAGAGTAGGTCTCTGAGGAAGG + Intergenic
1112111299 13:96302115-96302137 ATTGAGGAAGCCTCTCAGGAGGG + Intronic
1112127245 13:96481611-96481633 CTGCAGAAGGCATCTGGGGAAGG - Intronic
1112598497 13:100831881-100831903 CTAGAGATGGCATCTCAGGAAGG - Intergenic
1112975522 13:105313302-105313324 CTGGAGGAGGCTTCTGAGTAGGG - Intergenic
1113842836 13:113370075-113370097 TCCGAGAAGGCCTCTGAAGAAGG + Intergenic
1116641343 14:47467425-47467447 CTTGATAAGGCCTCTGGGGAAGG + Intronic
1117365757 14:55025904-55025926 CTTGAGACGCCATCTGAAGACGG - Intronic
1119231707 14:72985035-72985057 TTTGAGAGGACCTCTGGGGATGG - Intronic
1119812627 14:77535385-77535407 GATGAGAAGGCCTTTGGGGAGGG + Intronic
1119879982 14:78092311-78092333 CCAGAGAAGCCCTCTGAGCAGGG - Intergenic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122802244 14:104237533-104237555 CTGGAGCAGGGCTCTGAGCATGG + Intergenic
1123644212 15:22427605-22427627 CTTGAGCAGGTCTTTGACGATGG + Intergenic
1124319353 15:28701925-28701947 CTTGAGCAGCTCTTTGAGGATGG + Intergenic
1124483166 15:30093506-30093528 CTTGAGCAGCTCTTTGAGGATGG - Intergenic
1124489615 15:30145574-30145596 CTTGAGCAGCTCTTTGAGGATGG - Intergenic
1124544707 15:30614568-30614590 CTTGAGCAGCTCTTTGAGGATGG - Intergenic
1125593824 15:40872155-40872177 CTTGAGGAGGGTTCTGAGGGAGG + Intergenic
1128508665 15:68299779-68299801 CTTGTGAAGACCTCTAGGGATGG + Intronic
1128797349 15:70475565-70475587 TTTCAGAGGGCCTCTGTGGAGGG + Intergenic
1129226092 15:74171271-74171293 GTTGTGCAGGCCTCTGAGGATGG - Intergenic
1129246658 15:74283100-74283122 CTTTACAAGGCCTCTGGAGAGGG + Intronic
1131456267 15:92584845-92584867 CTTGAGATGGCATTTGAGGAGGG + Intergenic
1131680791 15:94720840-94720862 TTAGAGAAGGCATATGAGGAAGG - Intergenic
1132343437 15:101092431-101092453 GCTGAGAAGGCCTCTCCGGAGGG - Intergenic
1132508142 16:322827-322849 GCAGAAAAGGCCTCTGAGGATGG + Intronic
1132785758 16:1656324-1656346 CTTGAGAAGACCCCTGCAGAAGG + Exonic
1133023143 16:2975652-2975674 CTGGAGCAGGCCTGGGAGGAGGG - Exonic
1133087223 16:3374404-3374426 CTTGGGAAAGTCCCTGAGGAAGG - Intronic
1134692972 16:16203262-16203284 GGTGAGAAGGACACTGAGGAAGG - Intronic
1135113867 16:19710047-19710069 CCTGAGAAGATCTCTCAGGAGGG - Intronic
1136079509 16:27842528-27842550 CTAGAGAAGGGCACAGAGGAAGG - Intronic
1136288176 16:29256212-29256234 CTTGACAAGGACGGTGAGGACGG - Intergenic
1136477326 16:30521627-30521649 CATGAGAAGGACTCTGAGAGTGG + Exonic
1137223893 16:46482995-46483017 TTGAAGCAGGCCTCTGAGGAGGG - Intergenic
1137387442 16:48054852-48054874 CTGGAGAAGGCTTCCAAGGATGG - Intergenic
1137571055 16:49566499-49566521 CTGCAGGAGGCCTCTGGGGAGGG + Intronic
1137715273 16:50594736-50594758 CTAGGGCAGGCCTCTGAAGAGGG + Intronic
1138600168 16:58049343-58049365 CTTGAGAAGTCAGCTGAGGGTGG - Intergenic
1139964297 16:70737033-70737055 CTTGAGATGCTCTCTGAGGCAGG + Intronic
1140837536 16:78809137-78809159 CTTGAGATTGCATCTGAGAAGGG - Intronic
1141838647 16:86559910-86559932 CTGGGGGAGGCCTCGGAGGAGGG + Intergenic
1142093850 16:88228979-88229001 CTTGACAAGGACGGTGAGGACGG - Intergenic
1142352221 16:89585759-89585781 ATGCAGAAGGCCTTTGAGGAGGG + Exonic
1143184385 17:5001442-5001464 CTTTAGCTGCCCTCTGAGGAAGG + Intronic
1144032715 17:11336589-11336611 CTTGCGAAGGCAGATGAGGAGGG + Intronic
1144204699 17:12971834-12971856 CATGAGAAGGCCTCTGGTGATGG + Intronic
1145259965 17:21348895-21348917 TTTGAGCAGGCCCCTGGGGACGG + Intergenic
1145316652 17:21739043-21739065 TTTGAGCAGGCCCCTGGGGACGG - Intergenic
1146688563 17:34857520-34857542 CTTGGGGAGGCTCCTGAGGAGGG + Intergenic
1146975425 17:37107416-37107438 CTAGAGAAGGCTTGGGAGGAAGG + Intronic
1151156237 17:72124383-72124405 CTTGAGGAGGCCTCCCACGAAGG + Exonic
1152181501 17:78824790-78824812 CTTAAGAACGCCTCTAAGAAAGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152425301 17:80215218-80215240 CCCGAGAAGGCCCCTGGGGATGG - Intronic
1152694696 17:81738265-81738287 CTTGTGAAGGTCCCTGAGCAGGG + Intergenic
1153200397 18:2641768-2641790 CTAGAGAAGCACTCAGAGGAGGG - Intergenic
1155355269 18:24945762-24945784 ATTGGGAAGGCCTCAGAGCATGG + Intergenic
1156558642 18:38096253-38096275 CTTGTGAAGGTTTCTGAGCAGGG + Intergenic
1157419210 18:47531340-47531362 CTGGAGATGGGCTCTGAGGATGG + Intergenic
1160526997 18:79544070-79544092 CTTGCGAAGGCCGCTGGTGATGG + Intergenic
1162110946 19:8399480-8399502 CTTGAGAAGGCTCCTGAGCGGGG - Intronic
1164727893 19:30479011-30479033 CTTCACCAGGCCTCTGAGAAAGG - Intronic
1165403377 19:35615774-35615796 TCAGCGAAGGCCTCTGAGGAGGG + Intronic
1165890960 19:39111989-39112011 GCAGGGAAGGCCTCTGAGGAGGG - Intergenic
1166215489 19:41331937-41331959 CTAGAGAGGGGCTCTGAGCAGGG - Intronic
1166239595 19:41480885-41480907 CTTGAGAAGTGCTGTGATGATGG - Intergenic
1166566070 19:43766434-43766456 CAGGAGAAGGCCTCTGAGACAGG + Intergenic
1166933598 19:46317384-46317406 CTTCAGAAGGGCTCTGAGAAGGG - Intronic
1166996699 19:46722917-46722939 CTGGTGAAGGCCACTGAGGTGGG + Exonic
1168543160 19:57229793-57229815 TTTGGGAAAGCCTCTGAGAAAGG + Intergenic
1168632510 19:57968392-57968414 CTTGAGTTGGCCTAAGAGGATGG + Intronic
925492212 2:4407468-4407490 CTTGAGAAGGCCTCTCTTGCTGG + Intergenic
926483793 2:13431112-13431134 AATAAGAAGGGCTCTGAGGAAGG - Intergenic
926672282 2:15587674-15587696 CCTGGGAAGGCCTCTGTAGATGG - Intergenic
926800407 2:16655248-16655270 CTTGAGAATGCCTCTGGGCTTGG + Intronic
927955636 2:27205526-27205548 GTTTAGAAGGCCTCTGTGGCAGG - Intronic
929981658 2:46687034-46687056 CTGGAGGAGTCCTCGGAGGAAGG + Intergenic
931640072 2:64374298-64374320 CCTGAGAAGGTCTCTGAGTGGGG - Intergenic
934914038 2:98283906-98283928 CTTGAAATGACCTCAGAGGAAGG - Intronic
936933267 2:117812270-117812292 CTTGGGAAGGGGTCTGGGGATGG - Intergenic
936946676 2:117937313-117937335 CCTGGGAAGGGCTCTGAGGCAGG + Intronic
937228029 2:120380963-120380985 CTTGTCAAGGCCTCTCAGGCAGG + Intergenic
937988166 2:127647905-127647927 CTTGACAGGGCCTGTGAGGCAGG - Intronic
940989718 2:160085228-160085250 GTTGAGGAAGCCTCTCAGGAAGG - Intergenic
942115073 2:172720829-172720851 CTTGAGAAAGCATCTAAGGAGGG + Intergenic
942482194 2:176401439-176401461 ATTGAAAAGGACTCAGAGGAGGG - Intergenic
946705558 2:222455310-222455332 CTTGAGAAGGCATCTCTGAACGG + Intronic
946740532 2:222796700-222796722 CCTGAGAATTGCTCTGAGGAAGG + Intergenic
946868683 2:224066272-224066294 ATTGAGAAGGTCTGTCAGGATGG + Intergenic
948125792 2:235563977-235563999 CTCCAGGAGGCATCTGAGGATGG - Intronic
948511198 2:238466426-238466448 CTTGAGAAGCTTCCTGAGGAGGG + Intergenic
948611494 2:239169990-239170012 AGGTAGAAGGCCTCTGAGGAGGG - Intronic
1168780848 20:488517-488539 ATTGAGCAGGCCTCTGATAAAGG - Intronic
1169546169 20:6653156-6653178 CTTGAGGAGTGCTGTGAGGATGG + Intergenic
1170590662 20:17768946-17768968 GTTGAGAAGGATTCTGAGGCTGG - Intergenic
1171390619 20:24799414-24799436 CATGAGAGGGCCTCAGAGGCAGG - Intergenic
1171858850 20:30376666-30376688 CTGGAGGCGGCATCTGAGGAGGG - Intergenic
1172517076 20:35542326-35542348 CATGAGAAGGCCACTGACAATGG - Exonic
1173613698 20:44389052-44389074 TGAGAGAAGGACTCTGAGGAGGG - Intronic
1173728380 20:45312324-45312346 CTTGATAAGGCGGCTGTGGAAGG - Exonic
1174030101 20:47616725-47616747 CTTGAAAAGGCTTCTGAGACTGG + Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1176287859 21:5028281-5028303 CTTGGGAGAGCCTCTGAGGTAGG + Intronic
1177613322 21:23483174-23483196 GTTGAGAAGGCTTAGGAGGAGGG + Intergenic
1179397674 21:41056332-41056354 CTTGAGAAGGCCTCTGCGCCCGG - Intergenic
1179869322 21:44235194-44235216 CTTGGGAGAGCCTCTGAGGTAGG - Intronic
1180013130 21:45064467-45064489 CTTGAGAAAGGCTCTGGGTATGG + Intergenic
1180790705 22:18574094-18574116 CTGGGGGAGGGCTCTGAGGAGGG - Intergenic
1180918348 22:19505253-19505275 GGTGAGCAGGCCCCTGAGGAAGG + Intronic
1181231032 22:21421220-21421242 CTGGGGGAGGGCTCTGAGGAGGG + Intronic
1181247616 22:21513648-21513670 CTGGGGGAGGGCTCTGAGGAGGG - Intergenic
1181541097 22:23573769-23573791 CTTGGGAAGGGCTCCTAGGAAGG - Intronic
1181550996 22:23639126-23639148 CTTGGGAAGGGCTCCTAGGAAGG - Intergenic
1181747067 22:24962852-24962874 CCAGAGCAGGCCTTTGAGGATGG + Intronic
1181783405 22:25208798-25208820 CTGCAGAAGGCCTCTGGGCAAGG - Intergenic
1182062878 22:27410479-27410501 CTAGAGCAGGCCTCTGGAGATGG + Intergenic
1182312159 22:29416913-29416935 CTTGAGAAGGCCTGTGACTCTGG - Intronic
1182675450 22:32035728-32035750 CCTGTGAAGGGCTCTGGGGAAGG + Intergenic
1183111728 22:35654357-35654379 CTTTAGAAAGCCTCCAAGGATGG - Intronic
1183658366 22:39204142-39204164 CTAGAGAAGACCTCAGAGAATGG + Intergenic
1184362368 22:44026004-44026026 CCAGGGGAGGCCTCTGAGGAGGG + Intronic
1185167498 22:49270529-49270551 TTTGACAAGGCTTCTTAGGAAGG + Intergenic
949099684 3:128972-128994 ATTGAGAAGGCCTCAGAGGAAGG - Intergenic
949265961 3:2156407-2156429 CTTGAGGACGCTGCTGAGGAAGG - Intronic
949381119 3:3447028-3447050 GTTGAGAAGGCTCCAGAGGAGGG - Intergenic
950682751 3:14596180-14596202 CCTGAGAAAGGCTCTGAGGTAGG + Intergenic
953803807 3:46050815-46050837 CTTGAAATGGCCACTGGGGAAGG + Intergenic
955904262 3:63790124-63790146 GTTGAGAAGGATTCTGAGGCTGG - Intergenic
959821384 3:110739257-110739279 CTTGATAAGGTCTCGGGGGAAGG - Intergenic
960734735 3:120766281-120766303 CTTGAGATGGCCTCTCAATAAGG - Intronic
960910233 3:122642489-122642511 CTGTAGCAGTCCTCTGAGGAAGG + Intergenic
961155701 3:124677838-124677860 CTTGAGAAGGGCACGGTGGATGG - Intronic
961428938 3:126866436-126866458 CTTGAACAAGCCTGTGAGGAAGG + Intronic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
964892190 3:161550740-161550762 ATTGAGAAGGTCTGTGAGCAGGG - Intergenic
965204481 3:165704004-165704026 TCTGGGAAGGCCTCTGAGGAGGG - Intergenic
966086892 3:176079295-176079317 CTTCAGAAGCCTTCTCAGGAGGG + Intergenic
966681112 3:182643018-182643040 CTTGAGCAAGGCTCTAAGGAAGG + Intergenic
969518925 4:7664636-7664658 CTTGCGAGGGCTTCTGTGGATGG - Intronic
969648518 4:8448443-8448465 TGTGGGAAGGCCTCTGAGAAGGG + Intronic
970538545 4:17054809-17054831 CATGGGAAGGCCTCTCATGAAGG - Intergenic
970565241 4:17325684-17325706 ATTGAGGAGGGCTCTGAGGCTGG - Intergenic
972356248 4:38281626-38281648 CTTGAGAACTCATCTGGGGATGG + Intergenic
974370234 4:61007307-61007329 TTTGGGAAGTCCTCTGAGAAGGG - Intergenic
974801961 4:66829027-66829049 CTAGAGAAAGCCACTGAGGGTGG + Intergenic
976032184 4:80769756-80769778 CTTGTTGAGGCCCCTGAGGAGGG - Intronic
976270639 4:83227317-83227339 CTTGAGAATCACTCTAAGGAGGG + Intergenic
976331188 4:83832799-83832821 CTGGAGGAGGCCCCTGAGTAGGG + Intergenic
978202567 4:106039687-106039709 CATCAGAAGGCATCTCAGGAAGG + Intergenic
978504660 4:109443708-109443730 CTTCATAAGGCCTGTGAGAAGGG + Intronic
981106210 4:140884832-140884854 CTTGAGAAGAACTCTGAGTTGGG + Intronic
981616129 4:146646824-146646846 TTTGAGAAGGCCTCAGGGGTTGG - Intergenic
983106257 4:163690509-163690531 GTTTGGATGGCCTCTGAGGAAGG - Intronic
984145254 4:176052661-176052683 CTTGAGAAACATTCTGAGGAAGG - Intergenic
985163268 4:187065827-187065849 CTTCAGGAGACATCTGAGGAAGG - Intergenic
985779686 5:1863809-1863831 CTAGAGAAGGAATGTGAGGAAGG + Intergenic
985832045 5:2240949-2240971 CTTGACAAGGCCTCTCTGCAAGG + Intergenic
985858438 5:2449588-2449610 CCTGAGGTGGCCACTGAGGAAGG - Intergenic
985890165 5:2709000-2709022 CTGGAGAAGGCCTCTGGGAGTGG - Intergenic
986362617 5:6995266-6995288 GTTGTGAAGGTCGCTGAGGAGGG + Intergenic
986650925 5:9962600-9962622 CATGAGGATGCCACTGAGGAGGG - Intergenic
987068172 5:14309587-14309609 CTAGGGAAGGCCTCTGAAAATGG - Intronic
988197816 5:28028125-28028147 CTTGGAAAGCCCTCTGAAGAAGG + Intergenic
988241013 5:28609364-28609386 CTGGAGAAGGCCTCTAATGATGG + Intergenic
990310766 5:54535843-54535865 CTGGAGATGCCCTCTGGGGAAGG - Intronic
993421430 5:87706162-87706184 CATGACATGGACTCTGAGGATGG + Intergenic
995869153 5:116725996-116726018 CTTGAGATGTCCTATAAGGACGG - Intergenic
996665524 5:126055535-126055557 CTTCAGAAGGCATTTCAGGATGG + Intergenic
997296960 5:132774499-132774521 GTGGAGCAGCCCTCTGAGGAGGG - Intronic
997847683 5:137302970-137302992 CATGAGAATCCTTCTGAGGAAGG + Intronic
998039556 5:138943825-138943847 GTGGGGAAGGCCTCTGAGGAGGG - Intergenic
998094498 5:139389631-139389653 CTTGAGAAGGGGTGTGAGCAGGG + Intronic
999055648 5:148573239-148573261 ATTGAGAAGGTTTCTGAGAATGG + Intronic
999135425 5:149315811-149315833 CTTGGGACAGCCTCTGAGGAGGG - Exonic
1001091971 5:168748316-168748338 CTTGGGCATGCCTCTGGGGAGGG + Exonic
1001430858 5:171660825-171660847 TGTGAGAAGGCCTCTGATGACGG - Intergenic
1001746848 5:174098941-174098963 CTTTAGAACGTCTCTGAGGATGG + Intronic
1002521899 5:179796778-179796800 CGAGGGAAGGCCCCTGAGGAGGG - Intergenic
1002861878 6:1086615-1086637 GCTGAGAAGGCATCTGAGGAAGG + Intergenic
1003642657 6:7888620-7888642 TTTGAGGAGGCCTCTGAGGGTGG + Intronic
1004426060 6:15507936-15507958 GTTGGTAAGGCCTCTGAGCAGGG - Intronic
1005028950 6:21491640-21491662 CGTGAGGAGGCCACTGAGGCTGG - Intergenic
1005972336 6:30771111-30771133 GTGGAGAAGGCATCTGAGCAGGG - Intergenic
1008147703 6:47911645-47911667 CATGGAAAGGGCTCTGAGGATGG + Intronic
1008375617 6:50787796-50787818 CCTGAGGAGGCCCCTGAGAAGGG + Intergenic
1012309653 6:97706446-97706468 CATAGGAAGGCCTCTGAAGAAGG - Intergenic
1012444726 6:99296314-99296336 CTTGTGAAGGGCACTGAGGGAGG + Intronic
1015333936 6:132013490-132013512 CTTGAGAGGACCTCTTTGGAGGG - Intergenic
1016504424 6:144762659-144762681 CTTGAGAGGAACTCTGAGGTGGG + Intronic
1021080236 7:16355839-16355861 CTTGAGTAGGCATCTGCTGATGG + Intronic
1024017209 7:45327995-45328017 ATTCACAAGGCCCCTGAGGAGGG - Intergenic
1024157237 7:46638189-46638211 CTGGAGAGGGGCTATGAGGATGG - Intergenic
1025002086 7:55324949-55324971 CTTGAGAAGGCTGCTGGGGCTGG + Intergenic
1028239260 7:88399312-88399334 CATTAGAATGCCTCTAAGGATGG + Intergenic
1030540683 7:110826895-110826917 CTTAAGAATGCCTTTGATGAAGG - Intronic
1033727074 7:144130009-144130031 CCTGAGGAGGGCACTGAGGAAGG + Exonic
1034088708 7:148344397-148344419 TTGGAGAAGGACTCTGAGCAGGG - Intronic
1034275737 7:149823086-149823108 CTGGAGGAGGCAGCTGAGGAGGG - Intergenic
1034728004 7:153358276-153358298 CTTGAGAAGGCCTCTAACAGTGG - Intergenic
1034759224 7:153655545-153655567 CTTTAGAAGGCATCTGATGTTGG - Intergenic
1035774043 8:2173707-2173729 CATGGGGAAGCCTCTGAGGATGG + Intergenic
1037586874 8:20283055-20283077 CTTGAGAAGAGCTCTGGAGAAGG + Intronic
1037627482 8:20620656-20620678 CTTGGAGAGGCCTCTTAGGAGGG + Intergenic
1037649572 8:20824223-20824245 CTTGTAAAGGCCTCTGAGGGTGG - Intergenic
1037974670 8:23200851-23200873 CCTGAGAAGGCGTCAGGGGAAGG + Intronic
1038227636 8:25671352-25671374 CTTATGAGGGTCTCTGAGGATGG - Intergenic
1039055571 8:33533665-33533687 CTTGAGAAGACCTCAGGGGTTGG + Intergenic
1039193554 8:35004320-35004342 CTGCTGATGGCCTCTGAGGATGG - Intergenic
1039914790 8:41851967-41851989 ACAGAGAAAGCCTCTGAGGAGGG - Intronic
1040001481 8:42580344-42580366 CTTGAGAAGCCCTTCTAGGACGG - Intergenic
1040763696 8:50880791-50880813 CTTGAGAATGCCACAGAGCAGGG - Intergenic
1044016115 8:87050400-87050422 TCTGAGAAGGCTTCTCAGGAAGG - Intronic
1044604426 8:94036487-94036509 CTTGAGAATGCCCTTGAGGCTGG + Intergenic
1049483371 8:142838561-142838583 GTTGAGAAAGCCTCTGGGTAAGG + Intronic
1049996069 9:1035240-1035262 CTTGAAAAGGATTCTGAGGCTGG - Intergenic
1050445653 9:5719431-5719453 CCTGAGAAGTCCTCTGAAGACGG + Intronic
1051113573 9:13668156-13668178 CTTGAGCATCCCTCTGAGGGAGG - Intergenic
1051587891 9:18746390-18746412 CCTTAGAATGCCTCTGAGGTCGG - Intronic
1053006368 9:34607550-34607572 CTTGATAAGGGCTTAGAGGAGGG - Intergenic
1054867825 9:70020623-70020645 CTGGAAAAGCCCTCGGAGGAGGG - Intergenic
1056083680 9:83123564-83123586 CTTGCGAATGATTCTGAGGATGG - Intergenic
1056283547 9:85065229-85065251 CTTCAGAATTCCTTTGAGGAAGG + Intergenic
1056603767 9:88067822-88067844 TCTGGGAAGGCCTCTGGGGAGGG - Intergenic
1057308327 9:93925329-93925351 CCTGAGAGCTCCTCTGAGGAAGG + Intergenic
1057786740 9:98093653-98093675 GTTGGGATGGCCTCTGAGAAGGG - Intronic
1057921821 9:99104528-99104550 CATGTGAAGGGCACTGAGGAGGG + Intronic
1059081823 9:111258031-111258053 CTTGAGAAGGCTACAGAGGAAGG + Intergenic
1059700450 9:116770806-116770828 CTTGAGAAGGACTCTCTTGAGGG + Intronic
1060918843 9:127406531-127406553 CAAGAGAAGGCCTTCGAGGAGGG + Intronic
1061592277 9:131605375-131605397 CTTGAGAAGGGCCCTGAGACTGG + Intronic
1062257598 9:135635683-135635705 GCTGAGAGGGCCTCGGAGGAAGG - Intronic
1186064641 X:5749006-5749028 CTGGGGAGGGGCTCTGAGGAAGG + Intergenic
1186796061 X:13047617-13047639 CTTGAAAAGCCCACTGAGAAGGG - Intergenic
1187263436 X:17708656-17708678 TTTGAGAAGGCCTTGGAGGATGG + Intronic
1187508551 X:19897163-19897185 CTTGAGGATGCATCTGAGGTTGG - Intergenic
1189226729 X:39419480-39419502 TCTGGGAGGGCCTCTGAGGAAGG + Intergenic
1190394115 X:49962552-49962574 CTGGTGAAGGATTCTGAGGAAGG - Intronic
1195696923 X:107674248-107674270 CTTGGGGAGGCCCCTGAGGTGGG + Intergenic
1198077648 X:133209950-133209972 CTTGAGAAGTAGTCTGAAGAAGG + Intergenic
1199285967 X:146054543-146054565 CTTGAAAAGGCATGAGAGGAAGG + Intergenic
1199426626 X:147709327-147709349 CTTGAGAATGATTCTGAGAAGGG - Intergenic
1200690412 Y:6303212-6303234 CTTGAGAAGACACCAGAGGAAGG - Intergenic
1200834855 Y:7723548-7723570 CTGGAGATGGCTTCTGAGTAAGG - Intergenic
1201044861 Y:9871504-9871526 CTTGAGAAGACACCAGAGGAAGG + Intergenic
1202032480 Y:20592366-20592388 CATGACAAGTTCTCTGAGGATGG + Exonic