ID: 901227667

View in Genome Browser
Species Human (GRCh38)
Location 1:7623657-7623679
Sequence CTGAAAATACAGAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46528
Summary {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901227667_901227674 11 Left 901227667 1:7623657-7623679 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 901227674 1:7623691-7623713 TTTCACCATGTTGGCCAGGCTGG 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
901227667_901227673 7 Left 901227667 1:7623657-7623679 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 901227673 1:7623687-7623709 GGGATTTCACCATGTTGGCCAGG 0: 3714
1: 75810
2: 160868
3: 199205
4: 157761
901227667_901227672 2 Left 901227667 1:7623657-7623679 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 901227672 1:7623682-7623704 GAGATGGGATTTCACCATGTTGG 0: 2428
1: 46878
2: 102336
3: 132739
4: 103586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901227667 Original CRISPR CTGAAAATACAGAATTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr