ID: 901228368

View in Genome Browser
Species Human (GRCh38)
Location 1:7628169-7628191
Sequence CAGCACATGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 1, 2: 0, 3: 73, 4: 647}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901228368_901228374 -4 Left 901228368 1:7628169-7628191 CCCTTCTCCTTCTCCATGTGCTG 0: 1
1: 1
2: 0
3: 73
4: 647
Right 901228374 1:7628188-7628210 GCTGGCAAGAGATGGCTTCCAGG 0: 1
1: 0
2: 2
3: 24
4: 236
901228368_901228376 20 Left 901228368 1:7628169-7628191 CCCTTCTCCTTCTCCATGTGCTG 0: 1
1: 1
2: 0
3: 73
4: 647
Right 901228376 1:7628212-7628234 GCACTAGATTTCATTCTCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901228368 Original CRISPR CAGCACATGGAGAAGGAGAA GGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900813842 1:4828266-4828288 CAGCCCAAGGAGGAGGAAAAAGG - Intergenic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901548018 1:9973774-9973796 CAGCACTTCGAGAGGCAGAAGGG + Intronic
901638349 1:10680654-10680676 CAGCGGGTGGAGAAGGTGAAGGG + Intronic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
902162804 1:14545308-14545330 TTGCACATGGAGGAGAAGAAAGG - Intergenic
902538413 1:17135283-17135305 CAGCACAAGGTGCTGGAGAAAGG - Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903915510 1:26761218-26761240 TAGCATTTGGAGAAGGAGATTGG + Intronic
904628459 1:31822946-31822968 CAGCCCACGGAAAAGGACAATGG + Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
904982369 1:34517449-34517471 GAACACATGGAGATGGAGAGGGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905149697 1:35917975-35917997 CAGCTCCTAGAGAAGGGGAAGGG + Intronic
905461296 1:38124600-38124622 AAGCACATGGACATAGAGAAAGG - Intergenic
905514515 1:38552288-38552310 AAACACATGGAGAAGGTGTATGG - Intergenic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
905939614 1:41852634-41852656 CAGCCCATGAAGACTGAGAAAGG - Intronic
906174111 1:43754528-43754550 CACCACAAGTCGAAGGAGAAAGG + Intronic
906564292 1:46787027-46787049 CAGCAGAGGGTGAAAGAGAAAGG + Intronic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906712948 1:47945175-47945197 CAGCACTTGGAGATAGTGAAAGG + Intronic
907048460 1:51314189-51314211 CATCACATGGAGAAGGCAACAGG + Intronic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
907162870 1:52384228-52384250 CAGCCCATGGACAAAGAGCAAGG + Intronic
907845662 1:58204212-58204234 CAGCTCTTGGAGAATGAGATTGG + Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
908056830 1:60296976-60296998 CAGCCCTTAGAGAAGGAGGAGGG + Intergenic
909366491 1:74829449-74829471 CAGCACATGAAGAGGGATGAGGG - Intergenic
910080062 1:83330987-83331009 AAGAACTTGGAGGAGGAGAATGG - Intergenic
910246365 1:85142909-85142931 CAGCTCACGGAGAGGGAGCATGG + Intergenic
910491910 1:87781982-87782004 CAACACATAGAGAAAGAGATTGG + Intergenic
910604768 1:89071732-89071754 CAGCCCATGGAGAAGCAGGGTGG + Intergenic
910666784 1:89734134-89734156 CAGTACCTGGAAAAGGAGAGAGG + Intronic
910897871 1:92086780-92086802 CATCACATGTAGAAGGATAGAGG - Intronic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
911883846 1:103272521-103272543 CATCACATGAAAAAGGAGAAAGG - Intergenic
912062065 1:105686323-105686345 CTGCACCTGGACAAGGGGAAGGG + Intergenic
912210896 1:107555839-107555861 CAGCAAATGGGCAAGGAGACAGG + Intergenic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913200923 1:116494783-116494805 CAGCACATGAAGAAAAAGAGGGG + Intergenic
914247412 1:145896452-145896474 CAGCACATGGATAAAGAGGTGGG + Intronic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
915034540 1:152910947-152910969 AAGCACCTGGAGGAGGAGGAGGG + Exonic
915713109 1:157920121-157920143 CAGCAGAGGATGAAGGAGAATGG - Intergenic
916220709 1:162442354-162442376 CAACACTTGGATAAGAAGAAAGG + Intergenic
916323349 1:163530446-163530468 GAAGAAATGGAGAAGGAGAAGGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916722277 1:167493368-167493390 GAACAGATGGAGAAGGAAAAAGG - Intronic
917489439 1:175485435-175485457 CAGGACATTGGCAAGGAGAAAGG + Intronic
917511257 1:175671027-175671049 CATGACATGGAGATGGAGAGAGG + Intronic
917537750 1:175886842-175886864 CAGCTCATGGAGAGGAACAATGG + Intergenic
918060097 1:181053615-181053637 CAGCACAATGACAAGGACAATGG - Exonic
918169331 1:181981322-181981344 CAACACATGGACATGGAGAGGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919773413 1:201177420-201177442 CAGCAGATGGAGGGGGAGATAGG + Intergenic
920005668 1:202832095-202832117 CAGTCCATGGAGAAAGAAAAGGG - Intergenic
920829196 1:209449933-209449955 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
921669984 1:217914572-217914594 CAGCAAAGTGAGATGGAGAAGGG - Intergenic
921734512 1:218612031-218612053 AAGCAGATGAAGAAGGAAAAAGG - Intergenic
921856157 1:219987165-219987187 CATCAAGTGGAGCAGGAGAAGGG - Exonic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
923441306 1:234023142-234023164 CAGCCCATGGAGGAAGAAAAAGG + Intronic
924718115 1:246597568-246597590 CAGCACATGGAAACTGGGAAGGG + Intronic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1062987374 10:1781435-1781457 CTGCATATGGAGCAGCAGAAGGG - Intergenic
1064182698 10:13132990-13133012 CAGCACAAGGTAAAGAAGAAAGG - Intronic
1065038593 10:21666064-21666086 CAGCAGACAGAGAAAGAGAAGGG - Intronic
1065610804 10:27469123-27469145 AAGAACATTGAGAAGGTGAAAGG - Intergenic
1065841253 10:29703368-29703390 CAGGTGGTGGAGAAGGAGAAAGG - Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067409833 10:46054655-46054677 CAGCAAAGGGAGATGGGGAAGGG + Intergenic
1067757294 10:49014872-49014894 CTGCACATTGAGGAGGGGAAGGG - Exonic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1069299714 10:66890892-66890914 GAGCACAGAGAGAAGGAGCAGGG + Intronic
1070210714 10:74317709-74317731 CAGTACATTGAGAATGAGAATGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070752499 10:78972552-78972574 CAGCCCATAGAGAGGGAGCAGGG + Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1071074334 10:81732883-81732905 CAGCAGATGGGGTAGGAGAAGGG - Intergenic
1072084132 10:92061703-92061725 CAGGAGATGGAGATGGATAATGG + Intronic
1073588637 10:104735095-104735117 AAGCACATCAAGAAAGAGAAGGG + Intronic
1073869545 10:107847361-107847383 AAGCATCTGGAGAAGGGGAAAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075680808 10:124329952-124329974 CAGGGGATGGAGAAGAAGAATGG - Intergenic
1075822474 10:125326732-125326754 GACCACATGGAGAGGGAGAGAGG + Intergenic
1076383390 10:130040052-130040074 CAGCCCATGGAAAGGGAGAATGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077034935 11:489992-490014 CAGCACTGGGAGATGTAGAAGGG - Exonic
1077797484 11:5507762-5507784 CAGCATATGGAGAAAGGGAGGGG + Exonic
1078392086 11:10944094-10944116 GAGCTCAGGGAGTAGGAGAAGGG - Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1079363075 11:19785927-19785949 AAGCACCTTGGGAAGGAGAAAGG - Intronic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080736598 11:35022111-35022133 CAGCCCATGGAGAGTGAGGAGGG + Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080799761 11:35599305-35599327 CTGCACATGGGGATGGAAAACGG + Intergenic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1082105398 11:48215926-48215948 CAGGACATAGGAAAGGAGAATGG - Intergenic
1083276581 11:61600345-61600367 CAGAACCTGGAGAATGAGAAGGG - Intergenic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083735806 11:64680039-64680061 CAACACATGATGAATGAGAAGGG + Intronic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1084165951 11:67374762-67374784 CAGCCCTTGGAGAGGGAGGAGGG - Intronic
1084347824 11:68567721-68567743 CAGCACACAGAGAAGAAGCATGG - Intronic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1086949797 11:92880293-92880315 CAGTACTTGGCTAAGGAGAAGGG + Intronic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088128846 11:106462493-106462515 CCACACATGGAGATGGAGATGGG + Intergenic
1088608827 11:111557583-111557605 GACCACAAGGAGGAGGAGAAGGG - Exonic
1088685570 11:112281889-112281911 CAGCACCTGAAAAAGGGGAAGGG - Intergenic
1089015450 11:115161636-115161658 CAGCACATGGTGATGGAGGTGGG + Intergenic
1089543755 11:119206598-119206620 AAGCTCATGGACAAGGTGAAAGG + Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089793583 11:120962339-120962361 CAGCGGGTGGAGAAGCAGAAGGG + Intronic
1091090767 11:132769340-132769362 CAGCATATGAGGCAGGAGAATGG - Intronic
1091619221 12:2073533-2073555 CAGCACAGGTGGGAGGAGAACGG + Intronic
1091687845 12:2576254-2576276 CAGCAGCTGGAGAATGGGAAAGG + Intronic
1092065968 12:5589851-5589873 CAGGACATGGAGAAGGACCTAGG + Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1092580483 12:9835703-9835725 AGGAACATGGAGAAGGTGAAGGG + Intronic
1092981527 12:13799544-13799566 CAGCACCTGGAGAAGGCAATGGG - Intronic
1093100340 12:15020656-15020678 AAGCAAATGGAGAAACAGAACGG + Intergenic
1095882566 12:47153811-47153833 CAGTTCATGGAGAAGGAAATAGG - Intronic
1097810571 12:64014416-64014438 CAGCACATGGACACATAGAAGGG + Intronic
1097894438 12:64810253-64810275 GAAAACATGGAGAAGGAGAATGG - Intronic
1098076990 12:66742438-66742460 CAGCACCTCAAGAAGTAGAATGG + Intronic
1098641251 12:72840144-72840166 CAGCACATTGAGAGGGAGCATGG + Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099713318 12:86257481-86257503 AAGCACCTGGAGAAAGAGCAAGG + Intronic
1099904856 12:88760200-88760222 CAGCAGGTGGGGAAGGGGAAGGG + Intergenic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1100129358 12:91471582-91471604 CTACACATGGGTAAGGAGAAAGG - Intergenic
1100308014 12:93369046-93369068 TGGCAGAAGGAGAAGGAGAAGGG - Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101569864 12:105943828-105943850 CAGCCATTGGAGAAAGAGAAGGG - Intergenic
1102021444 12:109686234-109686256 GAGGACATGGAGAACCAGAAAGG - Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102454535 12:113063510-113063532 CAGCACATGGAGAGCGACATGGG - Intronic
1103206917 12:119136956-119136978 GAGGAGATGGAGAAAGAGAAGGG - Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103389107 12:120557598-120557620 CAGCTGATGAAGAGGGAGAAAGG + Exonic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104754909 12:131262923-131262945 CATCACAGAAAGAAGGAGAAAGG + Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105762929 13:23530209-23530231 CATCAAAAGGGGAAGGAGAAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1109791581 13:67255375-67255397 TAGCACATGGAGACGGGGAGGGG + Intergenic
1109815334 13:67574955-67574977 CAGCAAATAGAAAAGGAGCAAGG - Intergenic
1110708865 13:78627464-78627486 GAGCACATGGACACAGAGAAGGG - Intronic
1111707186 13:91764949-91764971 CATCACATGGAGAAATAGAGGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112065095 13:95784355-95784377 CAGCACAGGGAAAAGGTGCAAGG + Intronic
1112232943 13:97607549-97607571 GAACACATGGAGGAGGAAAATGG + Intergenic
1112479310 13:99759053-99759075 CAGCAAATGGAAGAGCAGAAAGG - Intronic
1112699398 13:101988314-101988336 TAGCTCAGGGAGAAGGAAAAAGG + Intronic
1113149123 13:107242346-107242368 CAGGACATTGAGGAGGAGAAGGG - Intronic
1113184321 13:107670044-107670066 CAGTAGATGGTGAAGTAGAAAGG - Intronic
1113274651 13:108715197-108715219 GAGCACACGGAGCAGGAGCACGG - Intronic
1113579063 13:111415513-111415535 GAGCACAGGGAGAATGAGATTGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114656162 14:24316767-24316789 CAGTACCTGGAGGAGGAGCAGGG + Exonic
1114788436 14:25627874-25627896 AAGCAAAAGGAGGAGGAGAAGGG + Intergenic
1115230134 14:31151636-31151658 CAGCACTTTGAGATGGAGGAGGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1116703530 14:48267298-48267320 CCGCTCAGGGTGAAGGAGAAGGG + Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1116906458 14:50408343-50408365 CAGCACATGGTGGAGGAGCAAGG + Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118408824 14:65454883-65454905 CAACAAATGAAGTAGGAGAAGGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118574223 14:67225458-67225480 CAGCACAGGGAGGAGGAGAGAGG + Intronic
1119511286 14:75213505-75213527 CAGGACATGGAAACGGAGAGAGG + Intergenic
1119543574 14:75456328-75456350 CAGAACACGGAGATGAAGAAGGG - Intronic
1119574457 14:75706115-75706137 AAGCACATGGTGGAGAAGAAAGG - Intronic
1120281437 14:82443615-82443637 GAGAAGATGGAGAAGGGGAAGGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120797064 14:88645621-88645643 CAGCAAGTAGAGAAGGTGAAGGG - Intronic
1121289098 14:92760081-92760103 CAGCAAAGGGAGATGGGGAAGGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122302809 14:100740731-100740753 CAGCACCTGGAGCAGGTGCATGG + Intergenic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1122755825 14:103979265-103979287 CAACAGATGGAGAAAGAAAATGG - Intronic
1202901968 14_GL000194v1_random:49456-49478 AAGCACATGGAGAGGGGGACTGG - Intergenic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1124710729 15:32007949-32007971 CAGCACTTTGGGAAGGTGAAAGG + Intergenic
1125087899 15:35752415-35752437 CCGCACATGGAGAAAAGGAAAGG - Intergenic
1125242508 15:37592133-37592155 CAGCACTTGGCGAAGTGGAAGGG + Intergenic
1125385283 15:39130446-39130468 CAGCACATGGGCAACCAGAAGGG + Intergenic
1125413346 15:39427801-39427823 CAGCACAAGGACAGGGAAAAAGG - Intergenic
1125532804 15:40424519-40424541 ATGCCCAGGGAGAAGGAGAAAGG - Intronic
1125592142 15:40861331-40861353 CAGCACAGGGAGAGGGACAGAGG + Intergenic
1125626341 15:41112425-41112447 TAGCATATAGAGAATGAGAAGGG - Intronic
1125792074 15:42374510-42374532 CATCACATGGAAAAGGCCAAAGG + Intronic
1125825290 15:42671459-42671481 CAGCCAATGGGGAAGGAGAAAGG - Intronic
1125927058 15:43571644-43571666 CAGTACAGGGAGAAGTAAAAGGG - Intronic
1125940202 15:43671209-43671231 CAGTACAGGGAGAAGTAAAAGGG - Intergenic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126233584 15:46355162-46355184 CAGAACATTGAGACGGAGCATGG + Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126557356 15:50004141-50004163 CAGCAGAGGGACAGGGAGAAGGG - Intronic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128638396 15:69317779-69317801 CAGCATGGGGAGAAGGGGAAAGG - Intronic
1129910399 15:79221622-79221644 GAGCACATGAAGAGGAAGAAGGG - Intergenic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1132340205 15:101073492-101073514 CCGCTCAGGGTGAAGGAGAAGGG - Intronic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1133392751 16:5422760-5422782 AAGAAGATGGAGAGGGAGAAGGG + Intergenic
1133474650 16:6108690-6108712 CAGGACCTTGAGAAGGAGATAGG - Intronic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1134846855 16:17447638-17447660 CATCCCAGGGAGAAGGAGAGAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136461092 16:30410566-30410588 TGGCACATGGAGGAGGAGGAAGG + Intronic
1136670177 16:31849519-31849541 CAGCAGACAGAGAAAGAGAAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138073200 16:54014414-54014436 CATCACACGGAGAGAGAGAAAGG - Intronic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1139208542 16:65053186-65053208 GAGCAGATGGAGAAGGTAAATGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1141920088 16:87129869-87129891 CAGCACATGGGGTGGAAGAAGGG + Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142367456 16:89657606-89657628 CAGCACTCGGAGAGGGAGAAGGG + Exonic
1203140168 16_KI270728v1_random:1759438-1759460 CAGCACATCCAGAAGTTGAAAGG + Intergenic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143410599 17:6706244-6706266 CAGCTCATGGGGAAGCAGAAAGG - Intronic
1143463269 17:7117641-7117663 CAGCACATGGAGAGAGAAAGAGG + Intergenic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144948133 17:18980263-18980285 CTGGCCATGGGGAAGGAGAAAGG - Intronic
1145891171 17:28416841-28416863 CAGCCCAAGGAGAAGGATAAAGG + Intergenic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146547132 17:33749268-33749290 GAGCAGCTGGAGAAGGAGAGGGG - Intronic
1146685500 17:34838832-34838854 CCACACATGGAGAAGAAGAAAGG - Intergenic
1147158134 17:38555334-38555356 CAACCAATGGAAAAGGAGAAAGG - Intronic
1148783961 17:50136172-50136194 CAGAGCCTGGAGCAGGAGAAGGG - Exonic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150249436 17:63698039-63698061 CAGCCCATGGGGGAGGAGATGGG - Exonic
1152051513 17:77982451-77982473 AAGCTAATAGAGAAGGAGAAAGG + Intergenic
1152713465 17:81886637-81886659 CAGCACTTTGAGAATGAGATGGG - Intergenic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1153759097 18:8312940-8312962 CAGCACAGGCAGAAGGAAATCGG - Intronic
1155654325 18:28177015-28177037 CGGCACATGGAGGCGGAGAGGGG + Exonic
1157080372 18:44518364-44518386 CTGCACTGGGAGAGGGAGAAGGG + Intergenic
1157407165 18:47431584-47431606 CAGCAAAAGGAGAAAGACAAAGG - Intergenic
1157431314 18:47629279-47629301 GAACACATGGACAAGAAGAAAGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157557904 18:48624753-48624775 CAGGCCATGGAGGGGGAGAAAGG - Intronic
1158096976 18:53784037-53784059 AAACACCTGGAAAAGGAGAATGG - Intergenic
1158511497 18:58094656-58094678 GAGTCCATGGAGAAGGGGAAGGG - Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159040535 18:63319906-63319928 CAGGACCAGGAGGAGGAGAAAGG - Exonic
1159310289 18:66698551-66698573 AAGCAGAAGGAGGAGGAGAAAGG + Intergenic
1159472303 18:68872670-68872692 GGCCACATGGAGAAGGAGAAAGG - Intronic
1159643258 18:70888079-70888101 AAGCACCTGGAGTAGGGGAAGGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160171668 18:76560654-76560676 CAGCACATGAACAAAAAGAAGGG + Intergenic
1160211564 18:76884883-76884905 GACCCCACGGAGAAGGAGAAAGG - Intronic
1160343814 18:78112781-78112803 CAGCACACGGTCAAGGAGAGAGG + Intergenic
1160368464 18:78349972-78349994 CAGCACCTGAGGAAGGGGAAGGG - Intergenic
1161684251 19:5695245-5695267 CAGCACATGAGGAAGGGGACTGG + Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1163045463 19:14638335-14638357 CAGCACCTGGGGGAGGAGAAAGG + Exonic
1163488214 19:17601995-17602017 CAGCACATGGGGTAGGGGTAGGG + Exonic
1163639266 19:18452148-18452170 GATCACATGGAGCGGGAGAAGGG - Intronic
1163784170 19:19266152-19266174 CAGCACAAGGAGAAGCACAGAGG - Intronic
1163977371 19:20864990-20865012 CAGCGAATGGAGATGGGGAAGGG + Intergenic
1164031806 19:21413918-21413940 CAGCAGTTGCAGAAGGAGACGGG - Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164397207 19:27876710-27876732 CAGGACCTGGTGAAGGGGAAGGG + Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166851183 19:45762080-45762102 AAGCCCAAGGAGAAGAAGAAAGG + Exonic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168339399 19:55614747-55614769 CTGCACACGGAGCAGGAGAAGGG - Exonic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
926052707 2:9755012-9755034 CAGAACATGGAAACGGAGCAAGG + Intergenic
926079242 2:9970653-9970675 CAGCCTGTGGAGAAGGGGAAGGG + Intronic
926965769 2:18408896-18408918 TAGCAGATGGAGGAAGAGAATGG + Intergenic
927355300 2:22166292-22166314 CTGCACATGGTGAAGGATAAAGG + Intergenic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
929076900 2:38085552-38085574 CCGCTCAGGGTGAAGGAGAAGGG + Intronic
929534927 2:42775670-42775692 CAGCAGAGGGTGCAGGAGAAAGG - Intronic
930198120 2:48529448-48529470 GAGTGCATGGAGAGGGAGAAGGG - Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
931960965 2:67482449-67482471 ACGCCCAAGGAGAAGGAGAAAGG - Intergenic
932854407 2:75218490-75218512 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
933646180 2:84814460-84814482 CAGCACATGCAGCTGGTGAAAGG - Intronic
933768518 2:85728159-85728181 CACCACCTGGAGGAGGAGAATGG + Intergenic
933943258 2:87262842-87262864 CAGCACATGATGGAGGAGAAGGG + Intergenic
934504721 2:94880975-94880997 AAGCACATGGAGAGGGGGACTGG + Intergenic
934867545 2:97826477-97826499 CATCAAAAGGGGAAGGAGAAGGG + Intronic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
936336956 2:111598719-111598741 CAGCACATGATGGAGGAGAAGGG - Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
937053094 2:118908147-118908169 CAGGGCATGGGGAAGGAGTAGGG + Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937266993 2:120623027-120623049 CAGCACCTGGAGATGGGGCAGGG + Intergenic
937482854 2:122280843-122280865 CTGCACAATGAGAAGCAGAATGG - Intergenic
937495957 2:122419494-122419516 GACCACATGGAGAAGGTCAAAGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938696957 2:133843146-133843168 CAATACCTGGGGAAGGAGAAGGG - Intergenic
939553076 2:143639441-143639463 TAGCAGATGGAGAAGGCTAAAGG + Intronic
940018564 2:149132564-149132586 CTACACACCGAGAAGGAGAAAGG + Intronic
940072186 2:149701266-149701288 CAGTAAATGGAAAATGAGAAAGG - Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940585179 2:155639101-155639123 CAGCACAGGGAGACAGACAAAGG + Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941604243 2:167577186-167577208 CATCACATGAAGACAGAGAAGGG - Intergenic
942361025 2:175171547-175171569 CAGCCCAGAGAGAGGGAGAATGG + Intergenic
942425224 2:175853115-175853137 CAGCAGAGGGTGGAGGAGAAGGG - Intergenic
942886979 2:180937686-180937708 CAGCTCATGTAGAAAGTGAAAGG - Intergenic
943400818 2:187408857-187408879 AAGCACAGAGAAAAGGAGAATGG - Intronic
943453964 2:188079535-188079557 CAACACAGGAGGAAGGAGAATGG + Intergenic
943571995 2:189584508-189584530 CAGCATCTGGAGAACGTGAAGGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944342418 2:198617802-198617824 CAGCACATGCAGCAAGTGAAAGG - Intergenic
945922089 2:215765045-215765067 CATCACATAGAGTAGGAGAAAGG - Intergenic
946056769 2:216909784-216909806 CAGCAGATGGGGAAACAGAAGGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946669784 2:222090255-222090277 GAGGCCATGGAGAGGGAGAATGG + Intergenic
946762328 2:223006920-223006942 CAGGACATTCAGAAGAAGAATGG + Intergenic
946872536 2:224097297-224097319 CACCACATGGAGAAGAACCATGG + Intergenic
946976398 2:225157123-225157145 TAGCACAAAAAGAAGGAGAAAGG + Intergenic
947005665 2:225508600-225508622 TAGCACCTGTAGAAGGAGAGGGG + Intronic
947856500 2:233327993-233328015 CAGCACAGGGGGTGGGAGAATGG - Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948612127 2:239176421-239176443 CAGCTCAAGAACAAGGAGAAGGG - Exonic
948779672 2:240310933-240310955 CACCACATTGAGAAGGAGACTGG - Intergenic
949003655 2:241633045-241633067 GAGCAGGTGGAGAAGAAGAACGG - Exonic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1168782862 20:509438-509460 CAGCACATGCTGTAGGAGATAGG - Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169065234 20:2691495-2691517 CAGGAGATGGAGAAAGAGACTGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169894736 20:10490792-10490814 GTTCACAGGGAGAAGGAGAATGG - Intronic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170757482 20:19217219-19217241 CAGCCCACGTTGAAGGAGAAGGG + Intronic
1170873403 20:20229179-20229201 GAGCACATGGAGAGAGAGACTGG - Intronic
1171008985 20:21496763-21496785 CAGCCAGTGGAGAGGGAGAAGGG + Intergenic
1171414081 20:24965689-24965711 CAGCACATGGTCAGGGAGGAAGG + Intronic
1171506738 20:25642450-25642472 CAGCAGAAGGTGCAGGAGAAAGG + Intergenic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172468061 20:35171869-35171891 CAGCCCAAGGAGAAGGGAAAAGG + Intergenic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173255335 20:41390567-41390589 CCGGACCTGGAGAAGGGGAAAGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1174785127 20:53425251-53425273 CAGAACATGGACAACAAGAAAGG - Intronic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1175218288 20:57402919-57402941 AACCACATGGGGAAGGGGAAGGG - Intronic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1176377562 21:6094050-6094072 CAGCACATGGAGAACGCGGCAGG - Intergenic
1176621337 21:9064223-9064245 AAGCACATGGAGAGGGGGACTGG - Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178178061 21:30128053-30128075 CGGAACAATGAGAAGGAGAATGG + Intergenic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179116691 21:38499778-38499800 GAAAAAATGGAGAAGGAGAAAGG + Intronic
1179138531 21:38701503-38701525 CATCACATGGACAAGGAAAGGGG + Intergenic
1179174676 21:38999852-38999874 CAGAAGATGGATAAGGACAAGGG - Intergenic
1179510825 21:41872170-41872192 TAGCAAATGGGGAAGGGGAAAGG - Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1180901482 22:19376519-19376541 CAGATCATGGAGGAGAAGAATGG - Intronic
1181118299 22:20648003-20648025 CAACAAATGGACAAGGAGATGGG - Intergenic
1181937307 22:26448175-26448197 CAGCACAGGGAGAAGGACCTGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1184259305 22:43305588-43305610 GAGCACAGGGAGAAACAGAAAGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185102607 22:48849753-48849775 AAGCAGGTGGAGAGGGAGAAAGG + Intronic
1185119194 22:48955755-48955777 CTGCTCATGGACAAGGAGACAGG + Intergenic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949928851 3:9062357-9062379 CAACATAGGGAGAAGGAGAGAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
951656694 3:25017038-25017060 CAGCCCATGTTTAAGGAGAAAGG + Intergenic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954541878 3:51398677-51398699 CAGCCCTGGGAGAAAGAGAAGGG + Intronic
954698268 3:52438956-52438978 TGGCACCTGGGGAAGGAGAAGGG + Exonic
955261077 3:57391044-57391066 TAGTACTTGGAAAAGGAGAAGGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
956028286 3:65007738-65007760 TAGCACATGGAGGATGAGAAAGG + Intergenic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
957410183 3:79830309-79830331 CAGCTCATGAGGCAGGAGAATGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957927185 3:86829209-86829231 CAGGACCTGGGGAAGTAGAAAGG - Intergenic
957927287 3:86830662-86830684 CAGCTGATGGAGATGGAGAAAGG - Intergenic
958623938 3:96601034-96601056 AAGCACAGGGAGAGAGAGAAAGG - Intergenic
959140197 3:102476825-102476847 CAGGGCATGGACAAGCAGAATGG + Intronic
959556859 3:107729671-107729693 TAGCAGATTGAGCAGGAGAAAGG + Intronic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960702381 3:120451062-120451084 CAGCAGAAGGGGGAGGAGAATGG - Exonic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961230657 3:125304452-125304474 AAGCACATGTAGGAGGAGAAAGG + Intronic
961546179 3:127635162-127635184 CAGTACACTGTGAAGGAGAAAGG - Intronic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
962661830 3:137609392-137609414 CATCACGTGGAACAGGAGAAGGG - Intergenic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963234627 3:142945019-142945041 CAGCTCCTGGAGAAGGGGAAGGG + Intergenic
964281340 3:155069852-155069874 CATCACATGGACAAGGGCAAGGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
966020209 3:175200539-175200561 CAGGAAGTGGAAAAGGAGAAAGG - Intronic
966365239 3:179178736-179178758 CAGCAAAGGGAAAAGGTGAATGG + Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967212374 3:187180244-187180266 CTGCTAATGGTGAAGGAGAAGGG + Intronic
967312784 3:188121844-188121866 AAACACATGTAAAAGGAGAAAGG + Intergenic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
969040725 4:4293755-4293777 GAACACATGGAGACAGAGAAGGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970412740 4:15825291-15825313 CCACTCATGGAGAAGGGGAAGGG + Intronic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
973665447 4:53154344-53154366 TATCACATGGTGAAAGAGAATGG + Intronic
973872766 4:55183021-55183043 CACCACATGGAGGAGGAGGTAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974763806 4:66313811-66313833 CTGAACATGGAAAAAGAGAAGGG - Intergenic
975681830 4:76885172-76885194 CAGCACATGGTGAAGGCCACTGG - Intergenic
977444333 4:97110176-97110198 CAGAAGCTGGAGAATGAGAAAGG - Intergenic
977587292 4:98787716-98787738 CAGCACATTGATAAAGGGAATGG + Intergenic
978237916 4:106482374-106482396 CAGCACAGAGAGGAGGAGACAGG + Intergenic
978357242 4:107890302-107890324 CAGCAGAGGGTGAAAGAGAAAGG + Intronic
978476332 4:109135531-109135553 CAGCACATTCAGAAGGATCAAGG - Intronic
978549516 4:109910370-109910392 AAGGACATAGAGAAGGAGAAGGG - Intergenic
978818017 4:112931160-112931182 CTGCACATGGCTAGGGAGAAAGG + Intronic
979054813 4:115980307-115980329 CGGCTCAGGGTGAAGGAGAAGGG + Intergenic
979129961 4:117031309-117031331 CAGCACATGCAGTATAAGAATGG - Intergenic
980076227 4:128296226-128296248 CAGCACAGGAAGAAACAGAATGG - Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980388703 4:132119132-132119154 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
980611964 4:135171984-135172006 CAGCTAAGGGTGAAGGAGAAGGG + Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
982710857 4:158757518-158757540 CAGCTCCTAGAGAAGTAGAATGG - Intergenic
984031330 4:174607521-174607543 CAGCACAGGGTGCAAGAGAAAGG - Intergenic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984839306 4:184053184-184053206 CAGCACATTCAGAAGTAGAGAGG + Intergenic
985587963 5:750737-750759 CAGCCCATGGGGAGGGAGAGTGG - Intronic
985602632 5:843204-843226 CAGCCCATGGGGAGGGAGAGTGG - Intronic
985606416 5:860507-860529 CAGCACATGGGGACTGAGACTGG - Intronic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985705609 5:1399922-1399944 CTGCACATGGGGCAGGAGCAAGG - Intronic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986623180 5:9697066-9697088 GAGGACGAGGAGAAGGAGAAAGG + Intronic
987025007 5:13918045-13918067 CAGCCCATGATCAAGGAGAAGGG - Intronic
987302107 5:16606296-16606318 GAGCACCTTGAGAAGGAGAGTGG - Intronic
987399071 5:17456319-17456341 CACCAAATGGAGGAGGAGATAGG - Intergenic
987492659 5:18600382-18600404 GATCACATGAAGATGGAGAAAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
994532744 5:100988968-100988990 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
995015075 5:107300823-107300845 CGCCACATGGTGAAGGAGATGGG + Intergenic
995215407 5:109589301-109589323 CTGCAGATGGAGAAGGTCAATGG + Intergenic
996109672 5:119550433-119550455 AAGCAAAAGGAGAAGGAAAAAGG + Intronic
996951820 5:129135921-129135943 CAAGACATGGAGAAGTAGAAAGG - Intergenic
997338367 5:133123450-133123472 GAGCTCATGCAGAAGTAGAAAGG + Intergenic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
998404199 5:141864522-141864544 CAGCACATTGACAAGGACAGTGG + Exonic
998404704 5:141867761-141867783 CAGCCCATGGGGAAGGGGAAAGG + Intronic
998598765 5:143562633-143562655 AAGCACGTGGAGAAGTAGGAGGG - Intergenic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
999633312 5:153594120-153594142 CAGCTTCTGGAGGAGGAGAAGGG - Intronic
999963461 5:156782962-156782984 CAGCCCATGGAGAATGAGCAGGG + Intergenic
1000117599 5:158167943-158167965 CAGCACTTGGTGATGGAGGAGGG + Intergenic
1000664953 5:163983614-163983636 CAGTACGTGCAGAATGAGAAGGG + Intergenic
1001071606 5:168590130-168590152 AAGCCCATGGTGATGGAGAATGG + Intergenic
1001136785 5:169109052-169109074 CAGCATATGGAAAAGGGGATGGG + Intronic
1001281344 5:170388555-170388577 GAGAAGATGGAGAAGGACAAAGG + Intronic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002187232 5:177460026-177460048 CAGCACACTGAGAAGCGGAACGG + Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002380566 5:178825278-178825300 CAGCTCAGTGGGAAGGAGAAGGG - Intergenic
1002639471 5:180623889-180623911 GTGCCCAGGGAGAAGGAGAAGGG - Intronic
1002998260 6:2306900-2306922 CATCACATGATAAAGGAGAAAGG - Intergenic
1003005811 6:2380491-2380513 CAGCCCATTGAGAAGCAGGAGGG - Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1004308611 6:14523645-14523667 CTGGCCATGGAGAGGGAGAAGGG - Intergenic
1004575017 6:16886932-16886954 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
1005211938 6:23476076-23476098 GAGCACATGGAGCTAGAGAATGG + Intergenic
1005285745 6:24324980-24325002 CAGCACAAGAAGTAGAAGAAAGG + Intronic
1005599457 6:27411825-27411847 CAGCAGGTGGAGGAAGAGAAAGG + Intergenic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006749046 6:36365183-36365205 AAGCTCAGGTAGAAGGAGAAGGG - Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008150304 6:47942089-47942111 AAGCACATGAACAAGGTGAATGG - Intronic
1008516454 6:52323776-52323798 CACCACATAGAGCAGCAGAATGG - Intergenic
1009228893 6:61040877-61040899 CATCATATTTAGAAGGAGAAAGG - Intergenic
1009298105 6:61980326-61980348 CAGCACCTGGAGTAGAACAAAGG - Intronic
1010186626 6:73151698-73151720 CAGCTCAGGTAAAAGGAGAATGG - Intronic
1010251773 6:73714485-73714507 CAGCACCTGCAGAAGGGAAAGGG - Intronic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1011010254 6:82695489-82695511 CAGCACATGGAAATGAAGCATGG - Intergenic
1011125420 6:84002386-84002408 CAGCAAATGGGGAAGGAAGAGGG - Intergenic
1011207537 6:84915985-84916007 CTCCACATGGAATAGGAGAAGGG + Intergenic
1011381219 6:86744119-86744141 CAGCACCTGGCAAAGGAGAGGGG + Intergenic
1011888357 6:92126116-92126138 CAGCAAATGCACAAGGAGAAGGG - Intergenic
1011896558 6:92234421-92234443 CAGATCATGAAGAAGGAAAAGGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012051948 6:94357880-94357902 GAGGAAATGGAGAAGGAAAAAGG - Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1013033107 6:106355470-106355492 CAGCAGCTGGAGACGTAGAAGGG - Intergenic
1013619128 6:111872380-111872402 CAGCACAGGGGAAAGGGGAAGGG + Intronic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1016798856 6:148147531-148147553 CAATACAAGGAGAAGGGGAAGGG + Intergenic
1017128736 6:151090292-151090314 CAGCACAGGGAAAGGGAGACTGG - Intronic
1017228325 6:152045142-152045164 TGGTACATGGAGAAGCAGAAGGG + Intronic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1018140539 6:160829669-160829691 AATCAAATGGAGAGGGAGAAAGG + Intergenic
1018490673 6:164289403-164289425 CAGAACATGGAAAAGCAAAATGG - Intergenic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1019528149 7:1490169-1490191 CAGCACCTGCCGAAGGAGAGAGG + Intronic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1021494418 7:21258812-21258834 GAAAACATGGAGAGGGAGAAGGG - Intergenic
1021527294 7:21603027-21603049 CAGGGCATGGAGGAGGATAATGG - Intronic
1023137229 7:37064738-37064760 CTGCAGATGGGGAAGGAGATAGG - Intronic
1024191794 7:47019657-47019679 GGGCACAAGGAGAAGAAGAAAGG - Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024565354 7:50675798-50675820 CAGCACATGGAGATGGGGAGGGG + Intronic
1025952632 7:66157547-66157569 CAGCACTTGGAGACTGAGACAGG + Intergenic
1027129511 7:75581134-75581156 CAGCACAAGGGGTAGGAAAATGG - Intronic
1027297828 7:76796266-76796288 AAGGACTTGGAGGAGGAGAATGG - Intergenic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1028088800 7:86671851-86671873 CAGTAAATGGATAAGGAGACTGG - Intronic
1028330170 7:89580384-89580406 AAGCACATGGACACGAAGAAGGG + Intergenic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1028488646 7:91386901-91386923 CACCTCATGGAGAAGTAGAGGGG + Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028721663 7:94039913-94039935 ACGCAGATGGAGAAGGAGAAAGG - Intergenic
1028752125 7:94393908-94393930 GAGCCCATGGAGAAGGGGAGGGG + Intergenic
1028829815 7:95314768-95314790 CAGCAAATGGAAAGGGAGAAAGG + Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029367379 7:100125335-100125357 CAGCAAACCGTGAAGGAGAATGG + Exonic
1030143285 7:106327283-106327305 AAGCATGTGGAGAAGAAGAAAGG - Intergenic
1030538801 7:110803496-110803518 GTACACAGGGAGAAGGAGAAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031554078 7:123149992-123150014 CATGACATGGAGAGAGAGAATGG - Intronic
1031633648 7:124075196-124075218 AAGCAAAGGGAGAAGGAGAAGGG - Intergenic
1031919954 7:127593205-127593227 CAGGACCTGGGTAAGGAGAAGGG - Intronic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032211378 7:129917407-129917429 TAGCTGATGGAGAAGGAGTAGGG - Intronic
1032429534 7:131849572-131849594 CAGCTCAGGGACAAGGGGAAAGG + Intergenic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1032524820 7:132572145-132572167 CAGCACAGTGATGAGGAGAAAGG + Intronic
1032548313 7:132761899-132761921 CTGCAAATGGAGGAAGAGAAAGG + Intergenic
1033152393 7:138926653-138926675 TGGAACATGGAGAAGGGGAAAGG - Intronic
1033275323 7:139967315-139967337 GAGCAGATGGCCAAGGAGAATGG + Intronic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033909698 7:146248247-146248269 CCGCTCAGGGTGAAGGAGAAGGG + Intronic
1034238280 7:149589748-149589770 CAGCAAATGGAAAAGAGGAAAGG - Intergenic
1034345661 7:150383923-150383945 CAGCAGCTGGGGGAGGAGAAAGG - Intronic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1036037251 8:5032491-5032513 CAGGACAGTGATAAGGAGAAGGG + Intergenic
1036242931 8:7094088-7094110 CAGCACTTTGAGAGGGTGAAGGG + Intergenic
1036526848 8:9542814-9542836 CACCACATGGTGAAAGAGGAAGG + Intergenic
1036572272 8:9990890-9990912 CAGGACTTGGAGAAGACGAATGG + Intergenic
1036898891 8:12657348-12657370 CAGCACTTTGAGAGGGTGAAGGG - Intergenic
1037340131 8:17835541-17835563 AAGAACCTGGAGAGGGAGAAAGG - Intergenic
1037562469 8:20087260-20087282 CAGCACTTAGAGGAGAAGAAAGG + Intergenic
1037672235 8:21024924-21024946 CATCACAGGGATAAAGAGAAAGG + Intergenic
1037783305 8:21886107-21886129 CAGCACAGGCAGAAGAACAAAGG - Intergenic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1038787741 8:30636049-30636071 CACCAGATAGAGAAGGAGAGGGG - Intronic
1038932471 8:32209857-32209879 AGGCACATGGAGAAGAAGCAAGG + Intronic
1039485212 8:37904536-37904558 TAGCCCATGGAGGAGCAGAAAGG + Intergenic
1039631654 8:39119115-39119137 CATCAACTGGAGAATGAGAATGG - Intronic
1040003911 8:42601903-42601925 CAGCACTGGGAGATGGAGATGGG - Intergenic
1040530062 8:48259966-48259988 CAACACCTGAAGAAGGAGAGGGG + Intergenic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040825146 8:51612299-51612321 CAGCAGATATAGGAGGAGAAAGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1042101325 8:65278486-65278508 CAGAACATGAACAAAGAGAAGGG - Intergenic
1042226310 8:66517482-66517504 CAGAACATAGAGAAGGACCAAGG + Exonic
1042263339 8:66883052-66883074 CAGCCCAGAAAGAAGGAGAATGG + Intronic
1042342127 8:67691454-67691476 CAGCAAATGAGGAAAGAGAAAGG - Intronic
1042361407 8:67887467-67887489 CAACATATTGAGAAGGAGGATGG - Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1043292565 8:78621182-78621204 TAGCACATGGATAAGTAAAATGG - Intergenic
1043415738 8:80046945-80046967 CAGCAGCGGGAGGAGGAGAAGGG + Intronic
1043803815 8:84645509-84645531 GAAAACATGGAAAAGGAGAAAGG - Intronic
1044651965 8:94505199-94505221 CAGGACAAGGAGATGCAGAAAGG + Intronic
1044911178 8:97060928-97060950 TAGCACATGGTGAAGGAGTTGGG - Intronic
1045282855 8:100764679-100764701 CAAAACATTGAGAAAGAGAATGG - Intergenic
1045385460 8:101667586-101667608 ATGCCCATGGAGAAGGAGAGGGG - Exonic
1045425797 8:102064571-102064593 CATCACTTGTAGAAGTAGAAGGG - Intronic
1045558001 8:103233269-103233291 CAGCAATTGGAGAAAGAGACGGG + Intergenic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045889014 8:107132115-107132137 CAGCCAAAGGAGAAAGAGAAAGG - Intergenic
1046678249 8:117137108-117137130 CAGGAGATGTAGACGGAGAAGGG - Intronic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1046934790 8:119875284-119875306 CAGCAAAGGGAGATGGGGAAGGG + Intronic
1047564108 8:126022882-126022904 GAAGACATAGAGAAGGAGAATGG + Intergenic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048382762 8:133882512-133882534 GAGCACATGGAGAAAAAGAGAGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048892776 8:138962732-138962754 CAGGAAATGGAGACTGAGAAAGG - Intergenic
1049401361 8:142428911-142428933 GAGCACCTGGGGAAGGGGAATGG + Intergenic
1049566192 8:143340358-143340380 CAGGACATGGAGGGAGAGAAGGG + Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050302684 9:4275456-4275478 CAGCACATAAAGAATGAGATTGG + Intronic
1050765919 9:9133805-9133827 GTGCACATGTAGAATGAGAAAGG + Intronic
1051072597 9:13190151-13190173 CAGCACATAGAGCTGGAGAAAGG - Exonic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1052652703 9:31324272-31324294 CAGCACTTGGTGTAGCAGAATGG + Intergenic
1053014541 9:34654457-34654479 CAGCAGATGGAAATGGAGACAGG - Intronic
1053057761 9:35004254-35004276 CAGCTAAGGGTGAAGGAGAAGGG - Intergenic
1055645841 9:78360519-78360541 AATCTGATGGAGAAGGAGAAGGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1057313841 9:93956920-93956942 CAGCAGCTGGAGCTGGAGAAAGG - Intergenic
1059051348 9:110930181-110930203 CATCCTATGGAGAAGAAGAAGGG - Intronic
1060026677 9:120177791-120177813 CAACACATGGACACAGAGAAGGG - Intergenic
1060480626 9:124015049-124015071 CGGCACCTGGAGGAGGAAAAGGG + Intronic
1061099894 9:128484616-128484638 AAGCAGAGGGTGAAGGAGAAAGG - Intronic
1061386651 9:130294624-130294646 CAGCACAGAGGGAAGGAGCAAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061551080 9:131335031-131335053 GGGCACCTGGAGAAGGAGTAGGG - Intergenic
1062142789 9:134969032-134969054 CTGCACATGGAAGAGGAGATGGG + Intergenic
1062214545 9:135382191-135382213 CAGCGGATGGAGGAGGAGAGGGG - Intergenic
1203744539 Un_GL000218v1:34693-34715 AAGCACATGGAGAGGGGGACTGG - Intergenic
1203565563 Un_KI270744v1:84791-84813 AAGCACATGGAGAGGGGGACTGG + Intergenic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1185555437 X:1017477-1017499 CAGCACATCCAGAAGTTGAAAGG - Intergenic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1187756895 X:22538058-22538080 CAGCTCAGGGAGCAGGAAAATGG + Intergenic
1189041091 X:37542828-37542850 CAGCACCTGTAGTAGGAGACTGG + Intronic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190358650 X:49628487-49628509 CAACACATGGACACAGAGAAGGG - Intergenic
1190789003 X:53682634-53682656 CAGCTCCTGGAAAAGGAGTATGG + Intronic
1190888577 X:54550429-54550451 GAGCACATACAGAAAGAGAACGG + Intronic
1191105278 X:56768552-56768574 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191106271 X:56773954-56773976 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191107264 X:56779356-56779378 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191107942 X:56783789-56783811 CAACAAATGGAGAAAGACAAAGG - Intergenic
1192269002 X:69561004-69561026 CATCACATGATGAAGTAGAATGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193581525 X:83269711-83269733 CAACTCATGGAGATAGAGAATGG + Intergenic
1193797808 X:85897947-85897969 TAGCACAGGGAAAAGGAAAAGGG + Intronic
1194597909 X:95881851-95881873 CAGCACTTGGAGAAGCCAAAGGG - Intergenic
1195553687 X:106197277-106197299 CTGCTCAGGGAGAAGTAGAAGGG - Intronic
1195782015 X:108477440-108477462 CATCACATGATAAAGGAGAAAGG + Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197957702 X:131970517-131970539 CAGCACACAGATAAAGAGAAGGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198671139 X:139082332-139082354 CTGCAGATGGGGAAAGAGAAGGG - Intronic
1198684427 X:139212526-139212548 CTGCACTGGGAGAAGTAGAATGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199537270 X:148916790-148916812 CAAAACATGGAGAGAGAGAAAGG - Intronic
1199686783 X:150272187-150272209 CCAGACATGGAGAAGCAGAATGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199943464 X:152647412-152647434 CAGCTCATGGAAAGGGGGAAAGG - Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201157871 Y:11149676-11149698 AAGCACATGGAGAGGGGGACTGG - Intergenic
1202602485 Y:26608313-26608335 AAACAAATGCAGAAGGAGAAGGG + Intergenic