ID: 901229346

View in Genome Browser
Species Human (GRCh38)
Location 1:7633361-7633383
Sequence TCTGCAGCTCTTCCTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901229346_901229354 21 Left 901229346 1:7633361-7633383 CCTCAGAGAGGAAGAGCTGCAGA 0: 1
1: 0
2: 4
3: 51
4: 406
Right 901229354 1:7633405-7633427 CCCCCAGATGCCACCCCTCCTGG 0: 1
1: 0
2: 4
3: 22
4: 356
901229346_901229350 -5 Left 901229346 1:7633361-7633383 CCTCAGAGAGGAAGAGCTGCAGA 0: 1
1: 0
2: 4
3: 51
4: 406
Right 901229350 1:7633379-7633401 GCAGAGGGGCAGAGAGCTCGTGG 0: 1
1: 0
2: 4
3: 45
4: 458
901229346_901229356 22 Left 901229346 1:7633361-7633383 CCTCAGAGAGGAAGAGCTGCAGA 0: 1
1: 0
2: 4
3: 51
4: 406
Right 901229356 1:7633406-7633428 CCCCAGATGCCACCCCTCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901229346 Original CRISPR TCTGCAGCTCTTCCTCTCTG AGG (reversed) Intronic
900376131 1:2355687-2355709 TCTGCAGCAGTCCCTCTCAGCGG - Intronic
900676551 1:3890819-3890841 GCTGCAAGTCTTCCTCTCGGTGG - Exonic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
901875480 1:12164931-12164953 TTTCCAGCTCATTCTCTCTGGGG - Intergenic
902462955 1:16592891-16592913 TCCAGAGCTCTTCCTCTATGTGG + Intronic
903034275 1:20484687-20484709 TCTGCGTCTCCGCCTCTCTGGGG + Intronic
903158564 1:21467841-21467863 TCCAGAGCTCTTCCTCTATGTGG - Intronic
903315038 1:22496713-22496735 TCAGCAATGCTTCCTCTCTGTGG + Intronic
903337500 1:22634967-22634989 TATGCACTTCCTCCTCTCTGAGG - Intergenic
904269922 1:29343280-29343302 CCTGCATCTCTTTCTCTCTCTGG + Intergenic
905111281 1:35596356-35596378 TCTGCAACTCTTTTCCTCTGTGG + Intergenic
906019534 1:42615215-42615237 GCTGATGCTGTTCCTCTCTGGGG + Intronic
906100261 1:43255810-43255832 TTTGCAGCTGAACCTCTCTGGGG - Intronic
906123971 1:43415144-43415166 TGAGCAGCTCTGCCTCTTTGAGG + Exonic
906188807 1:43882158-43882180 GCAGCATCTCTACCTCTCTGAGG - Intronic
906674672 1:47684682-47684704 TCTGCAGGCCTCACTCTCTGTGG - Intergenic
907514740 1:54986425-54986447 CCTGCAGCTCTCCTTCTCTGAGG - Exonic
907761852 1:57368536-57368558 TCTCCAGGTCCTCCTCTCTGCGG + Intronic
908083704 1:60608113-60608135 TCTGAGGCTCTTCCTGCCTGAGG + Intergenic
911104922 1:94121996-94122018 TCAGCATCCATTCCTCTCTGTGG - Intergenic
911938827 1:104016170-104016192 TCTCCAGCTATTCTTCTTTGGGG + Intergenic
912382574 1:109255281-109255303 CCTGCAGCACTGCCTCTCTCCGG + Intronic
913326783 1:117634765-117634787 TCTGCAGTTCTACCTTACTGAGG - Intergenic
913640118 1:120804698-120804720 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
913978927 1:143490095-143490117 CCTGCCTCTCGTCCTCTCTGTGG + Intergenic
914073332 1:144315744-144315766 CCTGCCTCTCGTCCTCTCTGTGG + Intergenic
914105822 1:144650616-144650638 CCTGCCTCTCGTCCTCTCTGTGG - Intergenic
914212394 1:145591930-145591952 TCCAAAGCTCTTCCTCTATGTGG + Intergenic
914278356 1:146145639-146145661 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914539403 1:148596587-148596609 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914627276 1:149475041-149475063 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
914940389 1:152017763-152017785 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
915563881 1:156703376-156703398 TCTGCACGTCTTCCTTTCAGAGG - Intronic
915705994 1:157844326-157844348 TCCCCAGCACTTCCTCACTGAGG - Intronic
916313125 1:163418699-163418721 TTTGCATCTGTTCCACTCTGAGG - Intergenic
916681075 1:167105626-167105648 TCTGCAGTCCTCCTTCTCTGTGG + Intronic
917145897 1:171891108-171891130 TTTGATGCTCTTCCTCTCTCAGG - Intronic
917933456 1:179840433-179840455 TCTCCTGCTTTTCCTCACTGAGG - Exonic
918435486 1:184507314-184507336 TCTGCAGCATTTGCTCTCTGTGG + Intronic
920571742 1:207022934-207022956 TCTTCAGCTCTTGCATTCTGAGG + Exonic
920608414 1:207413031-207413053 TCTGGAGCTCTTTCTGTCTTTGG - Intergenic
920803042 1:209207385-209207407 TCTGCCTCTTTTCCTCCCTGTGG - Intergenic
921098271 1:211905680-211905702 TCTGTATCTCTTCCTATCTATGG - Intergenic
921456573 1:215379335-215379357 ACTGGAGCTATACCTCTCTGTGG - Intergenic
922144229 1:222922686-222922708 TCTGCAGCTTCTACTCTCTAAGG - Intronic
924401793 1:243691196-243691218 TATGCTGCTTTTCCACTCTGAGG - Intronic
924661127 1:246018190-246018212 TACACAGCTCTTTCTCTCTGTGG + Intronic
924740074 1:246789834-246789856 TCTGCGTCTCTCCCTGTCTGGGG - Intergenic
1062946097 10:1463231-1463253 TCAGCAGTGTTTCCTCTCTGGGG + Intronic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1067079648 10:43205816-43205838 TGTCCAGCTCTACCACTCTGTGG + Intronic
1069994409 10:72333692-72333714 TCTGCAGGCCTTCCCTTCTGTGG + Exonic
1070572051 10:77647337-77647359 TCGCCAGCTCTTTCTCTCTGAGG + Intergenic
1071470184 10:85978732-85978754 TCAGCAGGCCTTCCTCACTGGGG - Intronic
1071598312 10:86943598-86943620 ACTGCAACTCCTCCTCCCTGCGG + Exonic
1072747305 10:97949724-97949746 TCTGCAACTCTTCAGCTGTGTGG + Intronic
1073034854 10:100556765-100556787 TCTCAACCTCTTCCTCTGTGAGG + Exonic
1073694004 10:105844917-105844939 TCTGCAGCTGTCTCTTTCTGTGG + Intergenic
1074149423 10:110744989-110745011 ACTCCAGCACTTCCTCCCTGGGG + Intronic
1074327792 10:112469830-112469852 TCTGGAGCTCCTTCTCTTTGTGG + Intronic
1074411909 10:113235764-113235786 TCTGTGCCACTTCCTCTCTGGGG + Intergenic
1074584028 10:114749189-114749211 TTCGCAGCTTTTCCTTTCTGAGG + Intergenic
1074765821 10:116699334-116699356 TCTGCAGAGCATCCTCTCTCTGG - Intronic
1074854370 10:117462444-117462466 ACTGCGGTTCTTCCTCCCTGGGG + Intergenic
1074867815 10:117555097-117555119 CCTGCACCACATCCTCTCTGAGG - Intergenic
1076007326 10:126958096-126958118 TCTGGATCTCTTCCTATCTTGGG + Intronic
1076121109 10:127937229-127937251 TCTGCATCTCTTCCTCCCCTAGG + Intronic
1077233814 11:1470439-1470461 TCTGCAGATCTTCCTCACCAGGG + Exonic
1077415539 11:2422761-2422783 TCTGGAACTCTGCCTGTCTGGGG + Intronic
1077613656 11:3660224-3660246 TCAGCACCTCTTCCTCTCCAGGG - Exonic
1077678228 11:4216177-4216199 TGTTCATCTCTTCCTTTCTGAGG + Intergenic
1078039717 11:7848765-7848787 GCTGCAGCTCCCCCTCTTTGTGG + Intergenic
1079804674 11:24914793-24914815 TCTGCAGCTCATGAACTCTGGGG - Intronic
1079903957 11:26222399-26222421 CCTGCAGCTTTTCCACACTGGGG + Intergenic
1080015694 11:27504633-27504655 TCTGCAGATCTTGATATCTGTGG - Intronic
1080797180 11:35575609-35575631 TCTTCTGCCCTTTCTCTCTGTGG + Intergenic
1081312080 11:41586433-41586455 TATGCAGTGTTTCCTCTCTGTGG - Intergenic
1082789275 11:57335883-57335905 TAGCCAGCTCATCCTCTCTGTGG - Intergenic
1082812985 11:57489868-57489890 TGTCCAGCGCTTCCTCTCTCCGG + Intronic
1083251932 11:61474123-61474145 TCTGCAGCCCTGCCTTTATGAGG - Intronic
1084079979 11:66816135-66816157 TCTGCTGCTTTTTCTCTTTGTGG + Exonic
1084547108 11:69819951-69819973 TCTGCATCTCTTTCTCTCTAGGG - Intergenic
1084548348 11:69825704-69825726 GCTGCAGCCCCTCATCTCTGGGG + Intergenic
1085321708 11:75578397-75578419 GTTGCAGCACTTGCTCTCTGTGG + Intergenic
1086455620 11:86956096-86956118 TCTGCAGCTCCGCAGCTCTGGGG - Intergenic
1088323010 11:108572359-108572381 TCTGCTGCTTTTTATCTCTGTGG + Intronic
1088736800 11:112734423-112734445 TCTGCCACTTTGCCTCTCTGGGG + Intergenic
1088973952 11:114798332-114798354 TCTTCATCTCTTTCTCTCTTTGG + Intergenic
1089092742 11:115891851-115891873 TAAGCAGCTAATCCTCTCTGGGG + Intergenic
1089575686 11:119441436-119441458 TATGCAGCCTTTCCTCACTGGGG + Intergenic
1089948687 11:122505485-122505507 TCTCCAGATCTCCCTCTATGAGG + Intergenic
1090404622 11:126469334-126469356 CCAGCTTCTCTTCCTCTCTGCGG + Intronic
1090938322 11:131365274-131365296 GCTGCAGCTCTCCCTTTCTGGGG + Intergenic
1091020382 11:132094430-132094452 GGTGCAGCACTTCCTGTCTGTGG + Intronic
1091224079 11:133947175-133947197 TGCGTGGCTCTTCCTCTCTGCGG - Intronic
1091224219 11:133947978-133948000 TCTCTAGCTCTTGCTCTGTGTGG + Intronic
1092026369 12:5244129-5244151 TCTGCTGAACTTCCTCTCTAAGG + Intergenic
1092644852 12:10559363-10559385 GCTGCAGCTCTTCCTCTGGTGGG - Intergenic
1093455708 12:19362977-19362999 TCTGCAGATTTTGCTATCTGTGG + Intronic
1095413739 12:41952725-41952747 TCTGGATCCCTTCCTCTTTGGGG - Intergenic
1096421278 12:51460059-51460081 TCTCCAGCTGTTCTTCTCTCAGG + Exonic
1096616596 12:52836547-52836569 GCAGCAGCTCTTCCTCTCTGTGG - Intergenic
1097147875 12:56954121-56954143 TCTGGGGCTCTTCCTCTCTAGGG - Intronic
1097510240 12:60529820-60529842 CCTGCAGCTGTTCCATTCTGAGG - Intergenic
1098504377 12:71232280-71232302 TGTACAGCTATTCCTCTCTCTGG + Intronic
1099690827 12:85949138-85949160 ACTGCTGCCCTTCCTCTCCGGGG + Intergenic
1099825068 12:87764947-87764969 TCTGATATTCTTCCTCTCTGTGG - Intergenic
1100278598 12:93095660-93095682 TCTGCGTCTCTTCCTGACTGTGG - Intergenic
1100886270 12:99073986-99074008 TCTCCAGCTCTTCCTCTCACTGG - Intronic
1100898829 12:99215422-99215444 TCAGTGGCTCTACCTCTCTGAGG - Intronic
1101651768 12:106683690-106683712 TCTCCAGCTCTTGGTCTTTGAGG + Intronic
1102628018 12:114251754-114251776 GCTGCAGCTCTGGCTCTCTGTGG - Intergenic
1103964514 12:124630297-124630319 TCTGGAACTCTTCCTGGCTGAGG - Intergenic
1104861170 12:131924676-131924698 AGTGCAGCTGTTCCTGTCTGAGG - Intergenic
1105220406 13:18321298-18321320 CCTGCCTCTCGTCCTCTCTGTGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106105731 13:26731959-26731981 TCTTCAGCCCTTCCTCTCACTGG + Intergenic
1107110775 13:36695353-36695375 TCTGCAGCATTTCCTCTCAGAGG + Exonic
1107298235 13:38937440-38937462 TCTGCCTCTCTTGCTTTCTGGGG - Intergenic
1110688321 13:78401646-78401668 TCTACATTTATTCCTCTCTGAGG - Intergenic
1111047758 13:82837648-82837670 TCTGCAGCAGTTGCTCTCTTAGG + Intergenic
1111265897 13:85812996-85813018 TCTGCAGCTCTTATCATCTGTGG - Intergenic
1112429215 13:99335704-99335726 TCTGCAGCTGTTCCCCTCTTGGG + Intronic
1116073076 14:40074047-40074069 ACTACAGCTCTTCGTCCCTGAGG + Intergenic
1116521478 14:45852831-45852853 TGTGCAGCTATTACTCTCAGTGG + Intergenic
1117581909 14:57159825-57159847 ACCGCAGCTCTTCCTAGCTGGGG - Intergenic
1119014137 14:71031620-71031642 TCTGCAGCTCAACAGCTCTGTGG + Intronic
1119292459 14:73506411-73506433 TCTGTAGCTCAGCCTCTCTTAGG + Intronic
1119309115 14:73631857-73631879 TATACAGCTCTTCGGCTCTGTGG + Intergenic
1121000959 14:90451764-90451786 TCTGCTGCTCATCTTCTCTCTGG + Intergenic
1121241006 14:92430182-92430204 ATGGCAGCTCTTCCTCTCAGAGG - Intronic
1123006375 14:105325733-105325755 TCTGCAGGTCTGCCTCGCTGTGG - Intronic
1123159719 14:106266761-106266783 TCAGCAGCTTTGCCTCTCTCTGG + Intergenic
1123502564 15:20903251-20903273 ACTGGTGCTCTTCCTCTCTTTGG - Intergenic
1123559813 15:21476918-21476940 ACTGGTGCTCTTCCTCTCTTTGG - Intergenic
1123596049 15:21914217-21914239 ACTGGTGCTCTTCCTCTCTTTGG - Intergenic
1125791580 15:42370594-42370616 CCCCCAGTTCTTCCTCTCTGTGG - Intronic
1126171871 15:45701906-45701928 TCTTCTTCTCATCCTCTCTGTGG - Intergenic
1127473229 15:59308902-59308924 TCTGCAATTCTGCCTCTCTGGGG - Intronic
1129194854 15:73957662-73957684 TCTTTTCCTCTTCCTCTCTGGGG + Intergenic
1129198473 15:73984749-73984771 TCTACAGCCCTTCCTGTCTGAGG - Exonic
1129799027 15:78399647-78399669 TTTGCAGCTGTTTCTCACTGGGG - Intergenic
1130026753 15:80276959-80276981 CCTGCTTCTCTTCCTGTCTGAGG + Intergenic
1130377936 15:83346676-83346698 CCATCAGCTCCTCCTCTCTGGGG + Intergenic
1130709745 15:86268180-86268202 TTTGAAGTTCTTCCTCTTTGGGG + Intronic
1130866519 15:87937865-87937887 TCTAAAGCTTTTCCTGTCTGTGG - Intronic
1130910195 15:88265469-88265491 TCTGCCCATCTTCATCTCTGGGG - Intergenic
1131459437 15:92607999-92608021 TCTGCATCTATACCTCTCTTGGG + Intergenic
1131513205 15:93060970-93060992 TCTCCAGCTGCTCCTCTCTTTGG + Intronic
1131779719 15:95843368-95843390 TCTGCTCCTTATCCTCTCTGGGG - Intergenic
1202968156 15_KI270727v1_random:204080-204102 ACTGGTGCTCTTCCTCTCTTTGG - Intergenic
1132621935 16:871875-871897 TCTCCTGCTGTTCATCTCTGTGG - Intronic
1133548665 16:6832913-6832935 TCTGCAGCTTTCAATCTCTGGGG + Intronic
1133745035 16:8679873-8679895 GCTATAGCTCTTCCTCCCTGGGG + Intronic
1137640448 16:50024480-50024502 GCTGTAGCCCTTCCTCTTTGCGG + Exonic
1137686193 16:50388602-50388624 TCTGTGGCACTGCCTCTCTGTGG + Intergenic
1137698422 16:50478458-50478480 TATGCATTTCTTCCCCTCTGAGG - Intergenic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1138414041 16:56861112-56861134 TCTGCCCCTCTGCCTCTCTATGG - Intergenic
1138882987 16:61038800-61038822 CCTGCAGATCTTTCACTCTGTGG - Intergenic
1139039973 16:62987832-62987854 TCTACATCTCTTTCTCTCTCTGG + Intergenic
1139298876 16:65927008-65927030 TCTCCACCTCTTCATCTCTGTGG + Intergenic
1139430281 16:66907455-66907477 TCTGGAGCTGCCCCTCTCTGAGG - Intergenic
1140219907 16:73036304-73036326 TGTGCAGCTTTTCTTCTTTGAGG - Intronic
1140854946 16:78969786-78969808 TCTGCAGATTTGCCTCTTTGGGG - Intronic
1141717547 16:85735486-85735508 TCTGCAGCCCTGGCTCTGTGAGG + Intronic
1141831539 16:86512134-86512156 TCTGCAGCTCTGACCCTCCGGGG - Intronic
1142056844 16:88003041-88003063 TCTCCAGTTCTACATCTCTGAGG + Intronic
1142921191 17:3188329-3188351 TCTGCAGGTTTTTCTCTTTGGGG + Intergenic
1144095884 17:11900383-11900405 TCTCCAGCTGTTCCTGTCGGTGG + Intronic
1144738735 17:17569379-17569401 TGTGCAGCTCCTCCCCTCTGAGG - Intronic
1144788291 17:17843914-17843936 TCACCAGCCCTTCCTATCTGTGG - Intronic
1146517385 17:33499835-33499857 TCGGCAATGCTTCCTCTCTGTGG - Intronic
1146681941 17:34814876-34814898 TGAACATCTCTTCCTCTCTGTGG - Intergenic
1147176447 17:38658957-38658979 GCAGCAGCACCTCCTCTCTGGGG - Intergenic
1147258401 17:39195435-39195457 TTGGCAGTTCCTCCTCTCTGGGG - Intronic
1147342892 17:39765389-39765411 TGGTCAGCTCTTCCTCTTTGTGG + Exonic
1147952625 17:44115550-44115572 CCCCCAGCTCTTCCTTTCTGAGG - Intronic
1148343681 17:46889384-46889406 TCTCCAGCTCTGCTTCCCTGTGG - Intergenic
1150830019 17:68511513-68511535 TCTGCACTTCTCCCTCTGTGAGG + Intergenic
1150942479 17:69707652-69707674 TCTGCACCGCTTCCTGCCTGTGG - Intergenic
1151535859 17:74738408-74738430 ACAGCAGCTCCTCCTCTCCGAGG - Intronic
1151805528 17:76402684-76402706 TCTGCAGCCCTTCATGTATGGGG - Exonic
1151908639 17:77066544-77066566 ACTGCAGCTCTTCCCCACAGGGG - Intergenic
1152342582 17:79733486-79733508 TCTGCACCTCTTCCTCCCTCAGG + Exonic
1152495713 17:80669772-80669794 CCAGGAGCTCTTCCCCTCTGTGG + Intronic
1152689412 17:81711293-81711315 GCTGCAGGTCTTCATCCCTGTGG + Intergenic
1153239441 18:3017016-3017038 TCTGCATCTCTTTCTCTGTGAGG + Intergenic
1153579879 18:6562240-6562262 TGTACAGCTCTCTCTCTCTGTGG + Intronic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1153832329 18:8934955-8934977 TCTGGTCCTCTTCCACTCTGTGG - Intergenic
1154199353 18:12288452-12288474 GCTGCAGCTCGTCCTCTCTCAGG - Intergenic
1155120650 18:22816107-22816129 TCTCCAGGGCCTCCTCTCTGGGG - Intronic
1156244421 18:35284220-35284242 CATGCACTTCTTCCTCTCTGAGG - Intronic
1156587904 18:38452659-38452681 TCTCTCGCTCTTCCTCTCTTTGG - Intergenic
1156640847 18:39096116-39096138 TCTCCAACTCTTCATCTCAGTGG + Intergenic
1157800851 18:50619844-50619866 TCTGCAGTCCTTTCTCTCTGCGG + Intronic
1158305327 18:56099197-56099219 TCTGCAGCACTGCCTCTGTGGGG + Intergenic
1160196222 18:76757992-76758014 TCTTCACCTTTTCCTCTCTGAGG + Intergenic
1160295735 18:77635067-77635089 TCTGCATCTCATGGTCTCTGAGG - Intergenic
1161686988 19:5707810-5707832 TCTGCAGCACTGACTCCCTGGGG + Exonic
1162477387 19:10908759-10908781 TCTGCTTCTCTTCTTCTTTGGGG + Intronic
1163367492 19:16883867-16883889 TTCCCAGCGCTTCCTCTCTGGGG - Intergenic
1163403016 19:17105765-17105787 TCAGTTCCTCTTCCTCTCTGAGG + Intronic
1163796691 19:19342091-19342113 TCTGCAGCCCTTGCACCCTGAGG - Intronic
1163817323 19:19474873-19474895 TCTGGACCTCAACCTCTCTGGGG - Intronic
1164590615 19:29504958-29504980 TCTGCAGCTGCTTCTCTCTGTGG + Intergenic
1167095271 19:47372086-47372108 CCTGCCACTTTTCCTCTCTGTGG + Intronic
1167166646 19:47803503-47803525 CCTGCAGCTGTTGCTCCCTGAGG + Exonic
1167175191 19:47860261-47860283 CCTGCAGCTGTTGCTCCCTGAGG - Intergenic
1167775528 19:51552158-51552180 TCTACAACTCCTCCCCTCTGTGG + Intergenic
1202678616 1_KI270711v1_random:30323-30345 TCCAGAGCTCTTCCTCTATGTGG + Intergenic
926228479 2:10985087-10985109 ACTGCAGCCCTTCATCTCTAAGG + Intergenic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
926812883 2:16772088-16772110 TCTGCAGCTGATCACCTCTGGGG + Intergenic
926844330 2:17118537-17118559 TCTGCAGTTATTTTTCTCTGTGG + Intergenic
926920135 2:17931986-17932008 TCTGCTTCTCTTCCTCTCTGTGG + Exonic
927007091 2:18861881-18861903 TCTGAAGTTCTTCCTGGCTGTGG + Intergenic
927031045 2:19121003-19121025 TCTCCTGCACATCCTCTCTGTGG + Intergenic
927348017 2:22070050-22070072 TCTGGTGCTCTACCTTTCTGTGG - Intergenic
927828361 2:26326191-26326213 TCTCCAGGTCTACCTGTCTGGGG + Intronic
927883750 2:26706294-26706316 TCTCCAGCTCCTCCTCTGGGGGG - Intronic
928235725 2:29537728-29537750 TCTGCAGCTTTTCCATGCTGAGG - Intronic
928424138 2:31164156-31164178 TATTCTGCTCTGCCTCTCTGGGG + Intergenic
928493219 2:31804636-31804658 TCTGGAGCTGTTCCTCGCGGTGG - Intergenic
930052371 2:47226262-47226284 GCTGAAGGCCTTCCTCTCTGTGG - Intergenic
931620578 2:64205839-64205861 GCAGCAGCTCTTCCTCTCCAGGG + Intergenic
932320571 2:70819509-70819531 TCTGGAACTCTACCTCTGTGTGG - Intronic
932336329 2:70933284-70933306 GCTGCAGCCCCTCCTCTCCGGGG - Exonic
932407278 2:71521907-71521929 TGTGCAGCTCTGCCTCTCCAAGG - Intronic
932924677 2:75959075-75959097 GCTGCAATTCTTCCTCTTTGAGG + Intergenic
934019180 2:87926799-87926821 ACTGCAGCTCTTTCTCACTACGG - Intergenic
934293936 2:91725347-91725369 CCTGCCTCTCGTCCTCTCTGTGG + Intergenic
934480575 2:94638239-94638261 TCTGAAACTCTTTCTCTCTGAGG - Intergenic
934676620 2:96253906-96253928 CCTGCTCCTCTTCCTCTGTGGGG + Exonic
936001544 2:108835951-108835973 TCTCCTGCTCTTCCACCCTGTGG - Intronic
936035889 2:109110896-109110918 TCTGCTGCTCTGCCACACTGTGG - Intergenic
938108738 2:128550514-128550536 TTTGCAGTTCTTCCTCTTAGTGG + Intergenic
939154761 2:138511618-138511640 TCCGCAGTTCTCTCTCTCTGCGG - Intronic
939882757 2:147649068-147649090 ATTACAGCTTTTCCTCTCTGAGG - Intergenic
941110507 2:161415321-161415343 TCTGCATTTCCTTCTCTCTGAGG - Intergenic
941500553 2:166270397-166270419 TCTGCAGATTTTAGTCTCTGTGG + Intronic
942001249 2:171649815-171649837 TCTCCAGCTCTTACTGTTTGGGG + Intergenic
943488987 2:188525966-188525988 TTTGAAGCTATTCTTCTCTGGGG - Intronic
944639082 2:201704222-201704244 TCAGCATCTTTTTCTCTCTGGGG - Intronic
945005525 2:205401079-205401101 TCTCCAGCTCTTCTTCTCTCAGG - Exonic
945670103 2:212792410-212792432 TCTACAGTTTTCCCTCTCTGTGG - Intergenic
947392172 2:229650797-229650819 TCTGAATCTCTTCCTCTCCAGGG + Intronic
947800990 2:232928359-232928381 TCCGCAGCTCTGCCCCTCTCCGG - Intronic
947949663 2:234136192-234136214 TCAAGAGCTCTTCCTCCCTGAGG - Intergenic
948209918 2:236185329-236185351 CCTGCAGCTTTTCCACACTGAGG - Intergenic
948344015 2:237280079-237280101 TCTGCAGCTCTGTGTCACTGGGG - Intergenic
1169464546 20:5825996-5826018 TGTGCAGCCCTTCCTTCCTGTGG - Intronic
1170148743 20:13205853-13205875 ACTGGAGCTCATCCCCTCTGAGG + Intergenic
1171040687 20:21759757-21759779 TCCACAGGTCTTCCTCTCTCAGG - Intergenic
1172846362 20:37931872-37931894 TCTGCCCCTCTTCTCCTCTGAGG + Intronic
1174503867 20:51004422-51004444 CCTGCTGCTCTTCCTCTGCGTGG - Exonic
1174581108 20:51572440-51572462 TTTCCAGCTCTTCCACTATGTGG - Intergenic
1175384204 20:58583826-58583848 TCAGCAGCTCGACCCCTCTGAGG - Intergenic
1175532648 20:59684723-59684745 TCAGCAGATCCTCCTCTCTAGGG - Intronic
1176044726 20:63086644-63086666 TCTGCAGGTCGGCCTCTATGGGG + Intergenic
1176069669 20:63219506-63219528 TCTGGAGGGCTCCCTCTCTGAGG - Intergenic
1176179769 20:63743807-63743829 TCTGCCGTCCTGCCTCTCTGTGG - Exonic
1176997777 21:15577367-15577389 TCTACAGCTCTTTCTCACTCAGG - Intergenic
1177438141 21:21082860-21082882 TGAGGAGCTCTTCCACTCTGCGG + Intronic
1178640861 21:34343887-34343909 TCTGGAGCTCTTGCTGGCTGAGG + Intergenic
1178670122 21:34582743-34582765 TCTGGAGCTCTGCCTCTCAATGG - Intronic
1178738849 21:35177780-35177802 TCTGGAGCGCTTCTTTTCTGAGG + Intronic
1179461916 21:41541714-41541736 TTTGAAGCTCTTCCTCTTTCCGG - Intergenic
1179949559 21:44702179-44702201 TCTGGAGCTTTTGCTCTGTGGGG - Intronic
1180128336 21:45806913-45806935 TATGCAGCACTCACTCTCTGTGG + Intronic
1180238034 21:46477096-46477118 CCTCCTGCTCTTCCTCTGTGTGG + Intronic
1180998998 22:19979264-19979286 TCTGCACCTCCTCCCCTTTGGGG - Intronic
1181309771 22:21938291-21938313 GCTGCTGCTCCTCCGCTCTGCGG - Intronic
1182074159 22:27483652-27483674 TCTCCAGCATCTCCTCTCTGCGG - Intergenic
1182718161 22:32376588-32376610 TCTGTAACTCCTCCTCTGTGAGG + Intronic
1183569677 22:38643366-38643388 TCTGCAGATCTTCCTTGTTGAGG - Intronic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
950136026 3:10581486-10581508 TCTGCAGTTCCTCATCACTGTGG - Intronic
950747185 3:15099798-15099820 TCTGCAGCTCTTGCTCCTAGAGG - Intergenic
950764041 3:15260181-15260203 TCAGCTGCTCTTCATCCCTGGGG - Intronic
950891979 3:16412390-16412412 CCTTCAGCTCTTCCTCTGTGAGG - Intronic
951241161 3:20287741-20287763 TCTGCAGCTTTTCCAGGCTGAGG + Intergenic
951618564 3:24575766-24575788 TCTGCAACTCTTGCTCTATGTGG + Intergenic
951822771 3:26831580-26831602 CCTGCTTCTCTTCCTCACTGAGG - Intergenic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
954099366 3:48357714-48357736 TGTGCACTTCTTCCCCTCTGAGG - Intergenic
954237394 3:49267289-49267311 TCTGCATCTCTGGCTCCCTGAGG - Intergenic
954645101 3:52126432-52126454 CCTTCGGCTCTTCCTCTCAGAGG + Intronic
955359246 3:58258820-58258842 TCTTTTGCTCTTGCTCTCTGGGG + Intronic
955581733 3:60430342-60430364 TCTGTGGTTCTTCCTCTCTGTGG - Intronic
956255394 3:67278129-67278151 CCTGCAGGTCTTACTCACTGGGG + Intergenic
956467990 3:69537361-69537383 TCTGCAGCTCTTCAGCCTTGAGG - Intronic
957585990 3:82132673-82132695 CATGCAGCTATTCCTTTCTGAGG + Intergenic
959387462 3:105728548-105728570 TCTGCACATCTTCCTTTGTGAGG - Intronic
961038704 3:123661852-123661874 TTTGCAGTACTTCCTCTCTGGGG + Intronic
961127739 3:124435722-124435744 TCTGCAGCTCCTCACTTCTGTGG - Intronic
961478108 3:127161165-127161187 GCAGCAGCTCTTCCCCTATGTGG - Intergenic
961992341 3:131205386-131205408 TCTCCAGCTCTACCTGTTTGTGG - Intronic
962309415 3:134314669-134314691 TGTCCAGCTCTTCATCCCTGCGG + Intergenic
962361170 3:134744012-134744034 TCTGCACCTCTAGGTCTCTGTGG + Intronic
962423789 3:135251026-135251048 AGTCCAGCTCTACCTCTCTGAGG + Intronic
962959461 3:140297058-140297080 CCTCCAGCTCTTCCACTATGAGG + Intronic
963446847 3:145422393-145422415 TTTGCAGCTCTTCTTTTCTCAGG + Intergenic
963815061 3:149820572-149820594 TAAGCAGCTCTTCCTCTTTGAGG - Intronic
963860529 3:150305250-150305272 TCTGTACCTCTTCCTCGGTGAGG + Intergenic
964174556 3:153810386-153810408 TCTGGAGCTTTTTCTCTGTGCGG - Intergenic
965473784 3:169129234-169129256 ACTACAGCTCTACCTTTCTGTGG - Intronic
966473706 3:180320799-180320821 TCTCCAGCTCAGCCTCCCTGTGG - Intergenic
966945444 3:184774166-184774188 TCTGCAGATCTTCCTCCTGGCGG - Intergenic
968644886 4:1735477-1735499 TCTGCAGCACCTCCTCTAAGTGG + Intronic
968891956 4:3374215-3374237 TCGGCAGCTCCTGCTGTCTGCGG - Intronic
969351747 4:6602097-6602119 GCTCCACCTCTTCCTCACTGGGG - Intronic
969475179 4:7418298-7418320 TCCGCAGCACTTCCTCCCTATGG - Intronic
969641457 4:8401576-8401598 TCTTCAGCCCATCCTCCCTGTGG + Intronic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
970100425 4:12515085-12515107 TCAGCAGCTCCCCCTCACTGTGG - Intergenic
970300348 4:14674849-14674871 TCTGCATGAATTCCTCTCTGTGG + Intergenic
971306274 4:25484682-25484704 GCCACAGCTCTTCCTGTCTGTGG + Intergenic
973721014 4:53723783-53723805 TGTGCACCTCTTCTTCTCTCTGG + Intronic
975040843 4:69743391-69743413 ACTGCACTTCTTCCCCTCTGAGG - Intronic
976453566 4:85219691-85219713 GCTGCAGCTTTTCCACACTGAGG - Intergenic
976852425 4:89562795-89562817 TGTGTAGCTCAACCTCTCTGAGG - Intergenic
977064445 4:92296027-92296049 TATACAACTCTTCCTCTCTTAGG + Intergenic
979652628 4:123153288-123153310 TCTGCAGCTTTTCCTTTCCAAGG - Intronic
981091533 4:140737268-140737290 CCTGCAGATCTTCCGCTCAGGGG - Intronic
981188424 4:141833553-141833575 TCTTGAGTTCTTCCTCTCTCAGG - Intergenic
983552036 4:169027277-169027299 TCTGCATCTCTTGTTCTGTGAGG + Intergenic
985077501 4:186231012-186231034 ACTGCCTCTCTCCCTCTCTGAGG - Intronic
985107865 4:186516323-186516345 TCTGCTGGGCTTCCTTTCTGAGG - Intronic
985373842 4:189313934-189313956 ACTGCAGCTTTTCTACTCTGAGG + Intergenic
985485236 5:145089-145111 AGTCCAGCTCTTGCTCTCTGGGG + Intronic
985551075 5:533929-533951 GCTGCAGGCGTTCCTCTCTGTGG - Intergenic
985853667 5:2408295-2408317 TCTGGAGCTCTTCCTTTATTTGG - Intergenic
985860973 5:2470573-2470595 TCTGCCCCTCTGCTTCTCTGGGG + Intergenic
986682816 5:10249520-10249542 TCTGCCGCTCTTCCTAGCTGTGG - Intronic
988034182 5:25804048-25804070 TCAGCAGATCTACCACTCTGGGG + Intergenic
988094830 5:26592248-26592270 TCTTCAACTATTCATCTCTGCGG + Intergenic
992382894 5:76256058-76256080 TCTGCAGCCCTTGCTCTCAAGGG + Intronic
993858942 5:93110723-93110745 ACTTCAGCTCTTTCGCTCTGGGG - Intergenic
995096327 5:108239870-108239892 CCTGCTGCTCTACCTCACTGGGG - Intronic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
997283938 5:132665099-132665121 TCAGCAGCTCTGCCTCTCTTGGG + Intergenic
998200063 5:140112475-140112497 TCTGCAGCCCTGGCACTCTGGGG - Intronic
998467732 5:142358919-142358941 TCTGCAGTTCCTCAACTCTGAGG + Intergenic
998482600 5:142475150-142475172 AATGCAGCCCTGCCTCTCTGAGG + Intergenic
1000009188 5:157215859-157215881 GCTGCAGCTATTCCTCTTCGGGG + Intronic
1002607021 5:180389540-180389562 ACTGCAGCTCAGCATCTCTGCGG - Intergenic
1002687348 5:181024151-181024173 ACTGCACCTTTTCATCTCTGAGG + Intergenic
1003023286 6:2530538-2530560 TCTGCAGCTCCTTTGCTCTGAGG - Intergenic
1003133196 6:3413243-3413265 ACAGCACCTCTTTCTCTCTGGGG - Intronic
1003162991 6:3651878-3651900 TCTGCACCCCTTCCTCTTTGGGG - Intergenic
1004148832 6:13095249-13095271 TCTACAGGGCTTCCTCTCTTAGG - Intronic
1005357364 6:24997368-24997390 TCTGAGGCTCTTCCTCTTTCTGG - Intronic
1005497823 6:26404128-26404150 TCTGCAGATCTTGTTCTCAGAGG + Intronic
1005959893 6:30687159-30687181 TCTCCTCCTCTTCCTCTCTCTGG - Exonic
1006481844 6:34301347-34301369 TCTGCAGCTCTTCCCATCAAGGG + Intronic
1007586695 6:42994917-42994939 ACTTCAGCTTGTCCTCTCTGAGG + Intronic
1008261872 6:49376599-49376621 TCTGCACATTTTTCTCTCTGAGG - Intergenic
1011411092 6:87067233-87067255 TTTGCAACTCTTCCTTTCAGGGG - Intergenic
1012057939 6:94439088-94439110 CCTCCAGCTCTTCCCCTCAGTGG + Intergenic
1014281747 6:119449264-119449286 ACTGTAACTCTTCCTCTCAGAGG - Intergenic
1017490640 6:154941687-154941709 TCTCCAGCTCTTCCTATCTCTGG + Intronic
1019922554 7:4172192-4172214 CCAGCAGCTGTCCCTCTCTGAGG - Intronic
1020901235 7:14005751-14005773 TCTTCAGGTCTTCATTTCTGAGG + Intergenic
1021055846 7:16044845-16044867 TCTGCAGTTCTGCCTCTGGGTGG - Intergenic
1022649596 7:32262406-32262428 TTTGGAGTTCTTGCTCTCTGGGG - Intronic
1022809500 7:33855134-33855156 TCCTCCGCTCTTCCACTCTGGGG - Intergenic
1022847520 7:34225960-34225982 CCTTCAGCTCCTGCTCTCTGTGG + Intergenic
1023107580 7:36777510-36777532 TCTTCAACTCTTTTTCTCTGAGG - Intergenic
1023260553 7:38354177-38354199 ACTGCATGCCTTCCTCTCTGAGG + Intergenic
1023261527 7:38363322-38363344 ACTGCATGCCTTCCTCTCTGGGG + Intergenic
1023855783 7:44182910-44182932 TCTGCAGCTGCTGCTCACTGCGG - Intronic
1024145889 7:46515924-46515946 TCTGCAGAGCTACCTCTGTGAGG + Intergenic
1025212216 7:57026260-57026282 TCTGCAGCTCACCCAGTCTGTGG - Intergenic
1025659738 7:63550568-63550590 TCTGCAGCTCACCCAGTCTGTGG + Intergenic
1025757567 7:64359094-64359116 TCTGAAACTCTTCCTCACTATGG - Intergenic
1027180012 7:75932047-75932069 TCTGCAGCTCTTCCTCTTCAAGG - Intronic
1028226275 7:88255767-88255789 ACTGCATCTTTTCATCTCTGAGG - Intergenic
1029089971 7:98040474-98040496 CCTGCAGCCCTGCCTCTCAGTGG - Intergenic
1029551117 7:101237612-101237634 TCTGCCCCTCCCCCTCTCTGGGG - Exonic
1029675395 7:102065026-102065048 TCTGCAGCTCACCCAGTCTGTGG - Intronic
1031426909 7:121616293-121616315 TCTGAAGCATTTCCCCTCTGTGG + Intergenic
1033040156 7:137910111-137910133 ATTGCTGCTCATCCTCTCTGAGG - Intronic
1033390542 7:140924223-140924245 TATCCAGCTCTGCATCTCTGTGG - Intronic
1035373387 7:158392998-158393020 TGTGCAGCCCTTTCTCTCTGTGG - Intronic
1035485291 7:159218743-159218765 TCTGCATCGCTTCCTGCCTGAGG - Intergenic
1035742638 8:1939682-1939704 GATGCATCTCTCCCTCTCTGAGG - Intronic
1036648475 8:10626445-10626467 CCTGCAGCTCTTGTTCTCTCCGG - Intronic
1036814815 8:11894194-11894216 TTTGGTGCTCTTCCTCACTGCGG + Intergenic
1037568912 8:20141932-20141954 TCTGTAGCTCTGGCTTTCTGTGG - Intergenic
1037987979 8:23301523-23301545 TCTGCAGATCCTCCTCTATGAGG + Intronic
1037993215 8:23335408-23335430 TATGTAGCTCTTCCTATCTCTGG - Intronic
1039431458 8:37528441-37528463 TCTCCATATCTTCCTCTCAGGGG - Intergenic
1039474847 8:37834207-37834229 TCTGCTGCTCTTGCTAGCTGGGG - Intronic
1041639170 8:60178463-60178485 TCTGCAGCTCTTCCTCACGAAGG - Intergenic
1041942612 8:63405342-63405364 TCTGCAGCTCTTACTTTCTCTGG + Intergenic
1042559345 8:70061295-70061317 TTGGCTGCTCTTCCTCCCTGGGG - Intronic
1043508816 8:80930221-80930243 CCTGCAGCTCTCACGCTCTGTGG + Intergenic
1044392138 8:91663612-91663634 ACAGCAGCTGTTCCTCCCTGTGG - Intergenic
1045225421 8:100239626-100239648 ACTGCAGTTCTTCCTTTCTTTGG + Intronic
1045323664 8:101101023-101101045 TCTACAGCTGTTCCTCCCTCAGG + Intergenic
1046225250 8:111270184-111270206 TTTGCAACTCTTCTTCTCAGTGG - Intergenic
1047780078 8:128103961-128103983 TCTGCTGAACTTCCTCTCTTTGG + Intergenic
1048288161 8:133158515-133158537 TCAGCAGATCTTCCCCTCTGAGG - Intergenic
1049283790 8:141763665-141763687 TCTCCATCTCTGTCTCTCTGTGG + Intergenic
1049400531 8:142424767-142424789 TCTGCATTTCTCCATCTCTGCGG + Intergenic
1049424776 8:142533140-142533162 CAAGCAGCCCTTCCTCTCTGGGG - Intronic
1050260801 9:3838826-3838848 TGTGGAGCCCTTGCTCTCTGGGG + Intronic
1051490274 9:17655783-17655805 TCTGAACCTGTTGCTCTCTGAGG + Intronic
1051609596 9:18948362-18948384 TCTGCTCCTTTTCCTCCCTGTGG + Intronic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1053344042 9:37364919-37364941 TGTGCAGCACTGCCTCCCTGTGG + Intergenic
1053664169 9:40305890-40305912 CCTGTAGCTTTTCCTCACTGAGG + Intronic
1053665136 9:40312095-40312117 CCTGTAGCTTTTCCTCACTGAGG + Intronic
1053677259 9:40445700-40445722 TCTGAAACTCTTTCTCTCTGAGG + Intergenic
1053914715 9:42937142-42937164 CCTGTAGCTTTTCCTCACTGAGG + Intergenic
1053927017 9:43071856-43071878 TCTGAAACTCTTTCTCTCTGAGG + Intergenic
1054286460 9:63179220-63179242 TCTGAAACTCTTTCTCTCTGAGG - Intergenic
1054290332 9:63281227-63281249 TCTGAAACTCTTTCTCTCTGAGG + Intergenic
1054376296 9:64452125-64452147 CCTGTAGCTTTTCCTCACTGAGG + Intergenic
1054388355 9:64585763-64585785 TCTGAAACTCTTTCTCTCTGAGG + Intergenic
1054507363 9:65930595-65930617 TCTGAAACTCTTTCTCTCTGAGG - Intergenic
1054519481 9:66064189-66064211 TCTGTAGCTTTTCCTCACTGAGG - Intergenic
1054520447 9:66070395-66070417 CCTGTAGCTTTTCCTCACTGAGG - Intergenic
1054842732 9:69760417-69760439 TCTGGACCTCTTCATCTCTCAGG - Intergenic
1056269958 9:84937690-84937712 TCTGCTTCTCCTCCTCTCTATGG - Intronic
1056427437 9:86491197-86491219 TCTGCAGCTGTACTGCTCTGAGG - Intergenic
1056702584 9:88923533-88923555 ACTGCAGCCCTACATCTCTGCGG + Intergenic
1056751188 9:89352500-89352522 TTTGCACCTCGTGCTCTCTGGGG + Intronic
1056983551 9:91339979-91340001 ACTGGAGCTCTTCCTCTGAGAGG - Intronic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1057905357 9:98978392-98978414 TCTGGTGCTTTTACTCTCTGTGG + Intronic
1058117367 9:101099461-101099483 TATCCAGCTCTCCCTGTCTGTGG + Intronic
1058323124 9:103658747-103658769 TCAGCAGATCTTCCATTCTGGGG - Intergenic
1058886946 9:109328985-109329007 TCTGCTGCTCTTCATCCCTTTGG - Intergenic
1059077522 9:111209928-111209950 CCTGATGCTCTTCCTCCCTGTGG - Intergenic
1061370406 9:130194463-130194485 TCTGCAGCTCTGGCTCTCTGGGG + Intronic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1185864080 X:3607281-3607303 TCTGCAGATCTTCCTCGCGCAGG + Exonic
1185988801 X:4869411-4869433 TGTTCAGCTCTTCCTTTCTTTGG - Intergenic
1187228071 X:17393544-17393566 GCTTCAGCTCTTCCTCTGTGAGG + Intronic
1190411604 X:50141749-50141771 CCTGCAGCTCTGCCTCTGGGCGG - Intergenic
1190445540 X:50520294-50520316 TCTGAGACTATTCCTCTCTGAGG + Intergenic
1192620234 X:72672066-72672088 TCTGCAGCTCTTGCATTCTGTGG + Intronic
1193198721 X:78663081-78663103 CCTGGACCTCTTACTCTCTGAGG + Intergenic
1193655503 X:84192006-84192028 TCTGTCTCTCTTTCTCTCTGTGG - Intergenic
1194182006 X:90722818-90722840 TCTGCTACTACTCCTCTCTGAGG - Intergenic
1195159262 X:102155451-102155473 TCTGCAGCAATTCCTCTCCTCGG + Intronic
1195275272 X:103275327-103275349 TCTGCAGGTCTTCAAGTCTGTGG - Exonic
1195379619 X:104257870-104257892 TCTGCAGGCCTTCTTCTCTTTGG + Intergenic
1196711678 X:118769900-118769922 GCTGCAGCTCTTCTTCTACGTGG + Intronic
1196897380 X:120350538-120350560 TCTGCCACTGTTCCTCTATGAGG - Intergenic
1199125348 X:144112340-144112362 ACTGCAGCTCTTTCTCACTACGG + Intergenic
1199241499 X:145553312-145553334 TCTCCCTCTCTCCCTCTCTGGGG - Intergenic
1199800925 X:151249951-151249973 TTTGCAGCTCTGCATCTCTTGGG + Intergenic
1200070671 X:153527524-153527546 TCTGCAGCTCTTGCCTTCTCTGG + Intronic
1200213460 X:154357036-154357058 GCTCCAGCTCTTCCCCTCTCTGG - Intronic
1200528633 Y:4304728-4304750 TCTGCTACTACTCCTCTCTGAGG - Intergenic
1200838027 Y:7752252-7752274 CCTTCAGCTCTTCTTCTATGAGG - Intergenic
1200972184 Y:9164420-9164442 TCTGCATCTCATCCTTACTGAGG + Intergenic
1201391401 Y:13501588-13501610 TCTCCCGCTCTAACTCTCTGGGG - Intergenic