ID: 901229583

View in Genome Browser
Species Human (GRCh38)
Location 1:7634347-7634369
Sequence TTCCCACAGCTGCCCAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 287}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901229583_901229596 14 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229596 1:7634384-7634406 AGGGTGCTGAGCAGGAGGTCGGG 0: 1
1: 0
2: 2
3: 47
4: 672
901229583_901229598 22 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229598 1:7634392-7634414 GAGCAGGAGGTCGGGAGGCGAGG 0: 1
1: 1
2: 2
3: 49
4: 651
901229583_901229592 6 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229592 1:7634376-7634398 AGGGGCCAAGGGTGCTGAGCAGG 0: 1
1: 0
2: 3
3: 42
4: 377
901229583_901229593 9 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229593 1:7634379-7634401 GGCCAAGGGTGCTGAGCAGGAGG 0: 1
1: 1
2: 2
3: 41
4: 404
901229583_901229595 13 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229595 1:7634383-7634405 AAGGGTGCTGAGCAGGAGGTCGG 0: 1
1: 1
2: 5
3: 41
4: 503
901229583_901229590 -5 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229590 1:7634365-7634387 GGGAAGCCTGGAGGGGCCAAGGG 0: 1
1: 0
2: 1
3: 39
4: 387
901229583_901229599 26 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229599 1:7634396-7634418 AGGAGGTCGGGAGGCGAGGTCGG 0: 1
1: 0
2: 2
3: 45
4: 582
901229583_901229597 17 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229597 1:7634387-7634409 GTGCTGAGCAGGAGGTCGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 343
901229583_901229589 -6 Left 901229583 1:7634347-7634369 CCAGACCTGGGCAGCTGTGGGAA 0: 1
1: 0
2: 7
3: 28
4: 287
Right 901229589 1:7634364-7634386 TGGGAAGCCTGGAGGGGCCAAGG 0: 1
1: 0
2: 3
3: 67
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901229583 Original CRISPR TTCCCACAGCTGCCCAGGTC TGG (reversed) Intronic
900079021 1:841846-841868 TGCCGACGGCCGCCCAGGTCTGG - Intergenic
900897709 1:5495420-5495442 TTCCCAAAGCGGCCCTGGACTGG - Intergenic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
901247608 1:7745001-7745023 TTCCCAGTGCTGCCCAGATCCGG + Exonic
901500011 1:9646514-9646536 TTCCCACAGTTCCCCACCTCTGG - Intergenic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
902254535 1:15179137-15179159 GTGCCACAGCTGCCCAGTTGGGG - Intronic
902740800 1:18436661-18436683 TTTCCACAGGTGCCCAAGCCAGG + Intergenic
903450557 1:23451209-23451231 TTCCCATCCCTGCCCATGTCTGG + Intronic
903642197 1:24867723-24867745 CTCCCACATCTGTGCAGGTCAGG - Intergenic
904404634 1:30278045-30278067 TTCCCTCAGCTGCCAAGAGCAGG + Intergenic
904470000 1:30730281-30730303 TGCCCTCACCTGCCCAGGCCTGG + Intergenic
904541689 1:31238167-31238189 TTTCCACCACTGCCCAGGCCAGG + Intronic
905013702 1:34763088-34763110 TTCACCCAGCTGCCCAAGCCAGG + Exonic
905915227 1:41679740-41679762 TTCCCACATCCTCCCAGGTCTGG - Intronic
906797154 1:48707369-48707391 TTCCCACAATTGCCCAGTGCTGG - Intronic
907369613 1:53992500-53992522 TCCCAACATCTGCCCAGCTCTGG + Intergenic
907405204 1:54249822-54249844 TTCCAACAGCCCTCCAGGTCAGG + Intronic
908912194 1:69084964-69084986 TTCCCACAGTTTCCCACCTCTGG + Intergenic
908963098 1:69725796-69725818 TCCCCAGAGCAGCACAGGTCTGG - Intronic
910888688 1:91994502-91994524 TTCCCAGATCTGCTCAGATCTGG - Intronic
911150556 1:94593813-94593835 TGCCCGCAGCTGCCCATGTCAGG + Intergenic
911647752 1:100353435-100353457 TTCTCGCAGCTGCTGAGGTCTGG + Intronic
911993783 1:104736716-104736738 CTGCCACAGCTGCTCAAGTCTGG + Intergenic
913221913 1:116667128-116667150 TTCCCACTGTTGCCCTGCTCTGG - Intronic
913278687 1:117164330-117164352 TTTCAACAGCTTCCCAGTTCTGG + Intronic
913424634 1:118713599-118713621 TTCTCATAGCTGCTCATGTCAGG - Intergenic
915891320 1:159776729-159776751 TTCCCAAAGCTTCCCATGGCAGG + Intergenic
915970145 1:160349205-160349227 TTCCCTTGGCTGCCCTGGTCTGG + Intronic
916424105 1:164664387-164664409 TTCCCACAGCTTCCCAATTGTGG - Intronic
918190379 1:182168351-182168373 TTTGCACAGCTGCCCTGCTCTGG + Intergenic
920244265 1:204576193-204576215 GTCCCTGAGATGCCCAGGTCAGG + Intergenic
920385488 1:205568336-205568358 TTCCCGCACCTGGCCAGGTGGGG + Intergenic
921650274 1:217670658-217670680 TTCCCACACCTGGCCGGGTATGG + Intronic
923265934 1:232314258-232314280 TTGCCACAGCTGGCCAGGGGTGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924706440 1:246506790-246506812 TTTCCACCGCAGCCCAGGTTGGG + Intronic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1064587065 10:16849802-16849824 TTCCCACAGCTGCTGATTTCAGG + Intronic
1065962303 10:30743645-30743667 GTCCCACAGCTGCCCCATTCTGG + Intergenic
1067427240 10:46219635-46219657 TTCCCACAGATGCCCAGGGCAGG + Intergenic
1067459873 10:46450426-46450448 TGCTCACAGCTGCCCAGTTAAGG + Intergenic
1067582671 10:47455519-47455541 TTCCCACAGATGCCCAGGGCAGG + Intergenic
1067627314 10:47934187-47934209 TGCTCACAGCTGCCCAGTTAAGG - Intergenic
1070401364 10:76056216-76056238 TTCCATCAACTGCCCAAGTCTGG + Intronic
1070648871 10:78220681-78220703 CTCCCACAGCAGGCCAGGGCGGG - Intergenic
1071751166 10:88477806-88477828 TTCACACAGCTGTCCAGAGCAGG + Intronic
1072223558 10:93347818-93347840 TTCTCAAAGCTGCCCTCGTCTGG - Intronic
1073626005 10:105097771-105097793 TTCACAAAGCAGCCCAGGTCAGG - Intronic
1074190030 10:111127625-111127647 TTCCCACAGATGCTCAGCCCTGG - Intergenic
1074311158 10:112324479-112324501 TTCCCGGAGATGCCCTGGTCGGG - Intergenic
1075455249 10:122580857-122580879 TTCTCACAGCTCCCCAGTCCCGG + Exonic
1075455835 10:122584313-122584335 TTCTCACAGCTGCCCACTCCTGG + Exonic
1075456883 10:122590656-122590678 TTCTCACAGCTGCCCAGTCCCGG + Exonic
1075457958 10:122597016-122597038 TTCTCACAGCTGCCCACTCCTGG + Exonic
1075458447 10:122600055-122600077 TTCTCACAGCTTCCCAGTCCCGG + Exonic
1075796161 10:125121182-125121204 TTCCCCCAGGAGCCCAGGTGTGG + Intronic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077076614 11:705218-705240 TTCCCACCCCTACCCAGGACCGG + Intronic
1077211063 11:1371160-1371182 TTCCCGCCGCTGCCCAGCCCTGG - Intergenic
1078467126 11:11558699-11558721 TTTCCACAGCTTCCCTGGCCAGG + Intronic
1080417269 11:32080487-32080509 TTCCCACAGTTTCCCACCTCTGG - Intronic
1081612492 11:44570941-44570963 TTCCCAGAGCTGCCCACCTGGGG - Intronic
1083400020 11:62417067-62417089 TTCCCCCAGCTGCCCAAGTCAGG + Intronic
1083454528 11:62769834-62769856 GTCAGCCAGCTGCCCAGGTCTGG + Intergenic
1083664016 11:64265088-64265110 CTCCCTCAGCAGCCCAGGTAAGG + Exonic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1085519978 11:77132002-77132024 TTCCCACAGCTGCCGATGAGAGG + Intronic
1087526344 11:99318707-99318729 TTTCCACAGCTGAGCAGGTTTGG + Intronic
1088695764 11:112364557-112364579 ATCCCACAGGTGGCCACGTCAGG - Intergenic
1089004046 11:115075857-115075879 TTCTGGAAGCTGCCCAGGTCAGG - Intergenic
1089170944 11:116511131-116511153 TTGCCACAGCAGCCCTGGTCAGG + Intergenic
1089537383 11:119169023-119169045 TACCCGCGGCTGCCCAGTTCCGG - Exonic
1089583469 11:119495764-119495786 CTCCCACAGCTTCCCCGGCCTGG + Intergenic
1089666013 11:120019752-120019774 TTTCCCCAGCTGCCTAGTTCTGG + Intergenic
1090385634 11:126356186-126356208 CTCCCACAACTACCCCGGTCAGG + Intronic
1090387807 11:126366675-126366697 AACCCTCAGCTGCACAGGTCTGG + Intronic
1090931191 11:131299439-131299461 TTCCCACCTCTGTGCAGGTCTGG + Intergenic
1093653834 12:21673956-21673978 TTCCACCTGCTGCCCAGGTGCGG - Intronic
1096067884 12:48755520-48755542 TTCCCCAAGCTGCCAAGGTTTGG - Intergenic
1096917025 12:55044390-55044412 TGCTCACAGCTGCTCAGGGCAGG + Intergenic
1098029043 12:66235386-66235408 TTCCCAAAGCTGCCTCGGCCCGG - Intronic
1100660470 12:96692819-96692841 TTCCCATAGCTCCACAGCTCTGG - Intronic
1103599265 12:122043830-122043852 ATCCCACAGCTGCCAAGGACGGG - Intronic
1104943422 12:132405236-132405258 CTCCCTCAGCTGCCCTGGTCTGG + Intergenic
1105633902 13:22199023-22199045 TGCCCACAGCTGCACAAGTAAGG - Intergenic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1108609151 13:52067430-52067452 TGCCCACAGCTGCACAGATAAGG + Intronic
1112587944 13:100736467-100736489 TTCTCACAGGTAACCAGGTCAGG - Intergenic
1112789559 13:102988045-102988067 TTCCCAAAGCTGCACAGAGCAGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113614369 13:111670468-111670490 TTCCCACAGCTGCACCGCCCAGG + Intronic
1113619837 13:111755382-111755404 TTCCCACAGCTGCACCGCCCAGG + Intergenic
1113769149 13:112897501-112897523 GTCCCACAGCTTCCCAGCTCTGG - Intronic
1118241993 14:64069080-64069102 TTGCTACAGCTGCCCATTTCTGG + Intronic
1118360686 14:65054071-65054093 TTCCCACTGCTGGGCAGGGCTGG + Intronic
1118617843 14:67587150-67587172 TTCCCACAGCTGGCAGGCTCCGG - Exonic
1118976066 14:70677564-70677586 TCTCCACAGCAGCCCAGGGCGGG + Intergenic
1119510622 14:75208249-75208271 GTCCCACAACAGCCCAGATCTGG - Intergenic
1119671920 14:76526519-76526541 TTCTGACAGCAGCCCAGGTGTGG + Intergenic
1119771910 14:77225358-77225380 TTCCCAGAGCTGGGCAGGGCAGG + Intronic
1120730483 14:87995515-87995537 TACCCACAGCTGCACAGATAAGG - Intergenic
1121412357 14:93756786-93756808 TTCACCCAGCTGCTCAGTTCAGG + Intronic
1122215274 14:100199591-100199613 TTCCCTCTGCTGCCCAGGTTGGG + Intergenic
1122393072 14:101403579-101403601 TTCCCACCGCAGCCCTGCTCCGG - Intergenic
1122694013 14:103544194-103544216 GGTCCACAGCTGCCCAGGGCGGG + Intergenic
1122746504 14:103900061-103900083 TGCCCACATCCGCCCAGGTGGGG + Intergenic
1122787610 14:104171197-104171219 TTCCCTCAGCTGGCCAGGGTCGG + Intronic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1122860290 14:104579488-104579510 TTCCAAGAGCTGCACAGCTCTGG + Intronic
1122893268 14:104742734-104742756 CTCCCCCAGCTGCCCATGGCAGG + Intronic
1122924863 14:104894878-104894900 TTCCCACAGCGGGCCAGCTGTGG + Exonic
1122946513 14:105013067-105013089 ATCCCGGAGTTGCCCAGGTCTGG - Intronic
1123108731 14:105855353-105855375 TTCCCAGAGCGGCCAAGGGCAGG - Intergenic
1123438283 15:20271810-20271832 TGCCCTCAGCAGCCCAGCTCAGG + Intergenic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1124411117 15:29438097-29438119 TCTACACAGCTGCCCAGGGCCGG - Intronic
1127842793 15:62845434-62845456 TCCCCACAGCTGCGGAGGGCTGG - Intergenic
1129161737 15:73751647-73751669 TCCCCAGAGCTGCCCATATCCGG - Exonic
1129364807 15:75047693-75047715 TCCTCACAGCTGCCCAGGGAGGG + Intronic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1131793600 15:95990952-95990974 TTCTCACTGCTCCCCAGCTCAGG - Intergenic
1132525908 16:414646-414668 CTCCCACAGCTGCCGTGGCCTGG + Intergenic
1134227141 16:12399876-12399898 TTCCCACAGCTGCCCTCCGCCGG - Intronic
1136273068 16:29159775-29159797 CTCTCACAGCGGCCCAGGGCCGG - Intergenic
1136298850 16:29319873-29319895 CTCCCATCGCTGCTCAGGTCCGG - Intergenic
1136552708 16:30990097-30990119 GGCCCACAGCTGCCCATCTCTGG - Exonic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137773318 16:51035866-51035888 ATCCCAGAGCTGCACAGATCAGG + Intergenic
1138423037 16:56912257-56912279 TGGCCACAGCTGCCCAGCTCTGG - Intronic
1139601155 16:67988068-67988090 TTCCCATACCTGACCAGGGCTGG - Intronic
1140277770 16:73526142-73526164 ATCTCACAGCTGCCCTGGACTGG - Intergenic
1141681558 16:85547175-85547197 TGCCCAGAGCTTCCCAGGGCTGG + Intergenic
1142060520 16:88026371-88026393 CTCCCATCGCTGCTCAGGTCCGG - Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142470535 17:161067-161089 CTCCTACCGCTGCCAAGGTCAGG + Intronic
1143388869 17:6548393-6548415 TTCCCATTACTGCCCAGTTCGGG - Intronic
1143460669 17:7101526-7101548 ACCCCACACCTGCCCAGCTCTGG - Exonic
1143558124 17:7675171-7675193 AACCCACAGCTGCACAGGGCAGG + Exonic
1143764691 17:9129831-9129853 TTCCCACACCTTGCCAGGTCTGG - Intronic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1144704039 17:17355746-17355768 TATCCAGAGCTGCCCAGGCCTGG + Intergenic
1145299558 17:21622528-21622550 TTCCCACAGCAGCACAGTGCTGG - Intergenic
1145350724 17:22080746-22080768 TTCCCACAGCAGCACAGTGCTGG + Intergenic
1147200286 17:38797062-38797084 TTCCCACCACTGCCCTGGACAGG - Intronic
1151338867 17:73456959-73456981 TTCTGACAGGTGCCCAGGTGTGG - Intronic
1151557575 17:74854390-74854412 TTCCCTCAGCTTCCTAGGTCAGG - Intronic
1151782810 17:76258542-76258564 GGCCCCCAGCTGCCCAGGCCAGG - Intergenic
1152208983 17:78992983-78993005 TGCCCACAGCTGCACAGGCCAGG - Exonic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1203173749 17_GL000205v2_random:175717-175739 TTTCCACACCTGCGCAGGACTGG - Intergenic
1155268655 18:24118285-24118307 TTCTCCCATCTGCCCACGTCAGG - Intronic
1158408025 18:57177746-57177768 TTTCCACAGCTGCCCTGTTGTGG - Intergenic
1160005463 18:75065697-75065719 TTGCCACAGCTGCCCACCACTGG - Intergenic
1161358872 19:3834869-3834891 TTCCCCCAGCTGCCCCGGCAGGG - Exonic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1164792634 19:31001370-31001392 GTCCCACAGCTGCCTCTGTCCGG + Intergenic
1165315836 19:35054874-35054896 TTCCCACAGCCCCGCAGGTTGGG - Intronic
1165341863 19:35218322-35218344 GACCCACAGCTGGCCAGGTGTGG - Intergenic
1165791593 19:38496051-38496073 TTCCTACAGCTGGCCGGGTGCGG - Intronic
1166884867 19:45954217-45954239 TGCCCACAGCAGCCCTGGGCAGG + Intronic
1167423587 19:49417752-49417774 TGCCCACAGCTGCCCTCGCCAGG - Exonic
1168119235 19:54242444-54242466 CTCCCCCAGCTGCCCATGTGTGG + Intronic
925153706 2:1634750-1634772 TTCCCAAACCTGACCAGCTCAGG + Intronic
925294996 2:2770292-2770314 TTCCCTCCTCTGCCCAGGTCAGG + Intergenic
925712844 2:6758403-6758425 TTTCAACAGCTTCCCAGCTCTGG - Intergenic
926075665 2:9940991-9941013 CTCCCACTGCTGCCCAGGAAGGG + Intergenic
926682894 2:15677441-15677463 TTTCCAAAGCTGCCCAGAGCAGG + Intergenic
927889678 2:26740536-26740558 TGCCGACAGCTGGCCTGGTCTGG - Intergenic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
932314812 2:70772908-70772930 TATCCACAGCTCTCCAGGTCTGG - Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932595205 2:73089067-73089089 TTGCCCAGGCTGCCCAGGTCAGG + Exonic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
932924714 2:75959642-75959664 ATCCCACAGCTGGCCAGATTTGG + Intergenic
935274435 2:101463781-101463803 CTCCCACAGCTCACCAGGTGTGG - Intronic
935702223 2:105822483-105822505 TTCCCACAGCGCCCCTGTTCAGG + Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937363784 2:121246449-121246471 TGCCCACAGGTGCTCACGTCTGG - Intronic
937430400 2:121833049-121833071 TTCCCAAGGCTTCCCAGCTCAGG - Intergenic
938088332 2:128416475-128416497 TTCACACTGCTGCCCGGGGCAGG + Intergenic
938950346 2:136249381-136249403 TGCCCACAGCTCCCCAGCTAAGG - Intergenic
940302499 2:152189872-152189894 TTCCCACAGCTCCAAAGGCCTGG + Intergenic
941363253 2:164579575-164579597 TTCCCAAAGATGTGCAGGTCAGG - Intronic
942954074 2:181753650-181753672 ATCCCAGATGTGCCCAGGTCCGG + Intergenic
943180202 2:184530847-184530869 TCCCAACATCTGCCCATGTCTGG + Intergenic
943954226 2:194165424-194165446 GTCCCACAGTTGCCCAGTTAAGG - Intergenic
944146772 2:196514652-196514674 TTCCATCATCTGCCCAAGTCTGG - Intronic
948604194 2:239124306-239124328 TGCCCGCAGCAGCCCAGGCCTGG + Intronic
948665803 2:239534157-239534179 GTCCCAGAGCTGCTCAGCTCAGG + Intergenic
948794214 2:240393882-240393904 GTCACACAGCTGCCAAGGTGCGG - Intergenic
1169837438 20:9896146-9896168 CTCCCACAGCAGCCATGGTCTGG + Intergenic
1169993860 20:11534771-11534793 TCCCAACAAGTGCCCAGGTCTGG + Intergenic
1170582655 20:17710860-17710882 TTCCCGCAGCAACCCAGGGCTGG + Intronic
1172193695 20:33077687-33077709 TTCCCAGAGCTTTGCAGGTCAGG + Intergenic
1172903159 20:38349539-38349561 TTTCCACAGCGGCCCAGGAGGGG + Exonic
1173247724 20:41347902-41347924 ATCCCACAGGGGCCCAGCTCAGG - Intronic
1175181787 20:57153678-57153700 TTCCCACAGCTGTCGTGGTGTGG + Intergenic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175746280 20:61459518-61459540 TTCCCACAGCAGCTGAGGCCAGG + Intronic
1175940218 20:62534342-62534364 TTCCCACGCCTGCCCAAGCCAGG - Intergenic
1176171350 20:63697736-63697758 TTCCCAGAGCTCCCCAGGGGAGG - Intronic
1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG + Intergenic
1180004762 21:45015254-45015276 TGCCCTGAGCTGCCCAGCTCTGG + Intergenic
1180713848 22:17858296-17858318 TTGGCACTCCTGCCCAGGTCAGG - Intronic
1180998198 22:19975869-19975891 CTCCCACAGGTGCCCAGGCCTGG - Intronic
1181158201 22:20938595-20938617 TTCTCACAACTGACAAGGTCAGG + Intronic
1181407557 22:22695432-22695454 TTTCCAGAACTGCCCAGCTCAGG + Intergenic
1181419799 22:22789833-22789855 TCCCCAGAACTGCCCAGCTCAGG + Intronic
1181423844 22:22820112-22820134 TCCCCAGAACTGCCCAGCTCAGG + Intronic
1183175871 22:36224431-36224453 GTTCCACAGCAGTCCAGGTCTGG - Intergenic
1184019852 22:41813640-41813662 GGCCCACATCTGCCCAAGTCAGG + Intronic
1184267497 22:43357005-43357027 TCCCCACAGCTGCGCATGCCGGG + Intergenic
1184489679 22:44801412-44801434 TCCCCACAGCTGTCCATGTGTGG + Intronic
1184555958 22:45233228-45233250 TTCACTCAGATGCCCAGGTCGGG + Intronic
1185220843 22:49628450-49628472 TTCCCACAGAGGGCGAGGTCTGG - Intronic
950500305 3:13359446-13359468 ATGCCACAGCTGCCCTGGTATGG - Intronic
952937585 3:38412343-38412365 TTCACACAGCTGTCCAGGAGAGG - Intronic
955214406 3:56972925-56972947 TTCCTACAGCAGCCCAGATGAGG + Intronic
956292481 3:67676027-67676049 TTCCCACACCGGACCAGGTGCGG - Intergenic
960994587 3:123332510-123332532 CTCCCTCAACAGCCCAGGTCAGG + Intronic
961325854 3:126108926-126108948 TTCACACAGCTGCCAGGGTCTGG - Intronic
961798348 3:129425788-129425810 TTCAATCACCTGCCCAGGTCAGG + Intronic
961829480 3:129616112-129616134 TTCCCAGAGCTGTCCAGGAAGGG + Intergenic
964470876 3:157054203-157054225 TTCTCACTGCTGCCAAGGGCTGG - Intergenic
967826326 3:193880493-193880515 TGTCCTCAGCTGCCCAGGCCAGG + Intergenic
968028123 3:195460198-195460220 TTCCCACTGCTGCCGATGCCTGG + Intergenic
968313986 3:197706980-197707002 GTCCCACGGCTGCCCAGCCCTGG - Intronic
968450817 4:675163-675185 CTCCCACAGCTGCCCAGAGATGG + Intronic
968662927 4:1806240-1806262 TTCCCACACCCTCCCAGGGCCGG + Exonic
970186162 4:13455660-13455682 TTCACACAGCTGCCTTGCTCCGG - Intronic
970239345 4:13992164-13992186 TTCTCACAGCAGCCCTGGGCAGG + Intergenic
970641428 4:18070608-18070630 TGCTCACAGATGCCCAGCTCAGG + Intergenic
973978556 4:56286764-56286786 CTCCCACTGCTGCCGTGGTCAGG + Intronic
974144208 4:57926303-57926325 TTCCCTAAGCTGTCCTGGTCTGG - Intergenic
975544544 4:75547841-75547863 TTTCCACAGCTGTGCAGGTTAGG - Intronic
975903929 4:79187334-79187356 GGCCCACTGCTGCCCAGGGCTGG + Intergenic
976645558 4:87384024-87384046 TCCCCACAGCTGTCCAGATTTGG - Intronic
979137300 4:117125589-117125611 TTCCAGCAGCTGCTGAGGTCTGG - Intergenic
980911169 4:138995942-138995964 TACCCACATCTTCCCAGGTGTGG + Intergenic
985166990 4:187107164-187107186 TGCCCACATCTGCACAGCTCTGG + Intergenic
985703506 5:1387465-1387487 TTCCCCCAGCTCCCCAAGTCAGG + Intergenic
988486992 5:31675411-31675433 TGGCCTCAGCTGCCCAGCTCAGG + Intronic
989344583 5:40415630-40415652 TTCGCACAGATTCCCAGTTCTGG + Intergenic
992753052 5:79878887-79878909 TTCCCACATATGGCCAGGTGAGG + Intergenic
995796846 5:115950315-115950337 TTCCCACAGAAGGCCAGGTGGGG - Intergenic
995931925 5:117455981-117456003 TTACCACTGCAGCTCAGGTCTGG + Intergenic
997590919 5:135071665-135071687 GCCCCACAGCAGCCCTGGTCTGG - Intronic
1003620297 6:7693539-7693561 TGCCCAAAGCTGCCCAGCTGTGG + Intergenic
1004424951 6:15501018-15501040 TCCCCAGAACTGCCCAGGACCGG + Exonic
1005495015 6:26380850-26380872 TCCCAACAGCTGCCCAGTCCTGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1008639367 6:53445806-53445828 TTCCCACAGTCTCCCAGGACTGG - Intergenic
1008896361 6:56560896-56560918 TTTCTACAGCTGCCAAGGTTGGG - Intronic
1010087461 6:71937541-71937563 TTCCCACCTCTGGCCAGGTGTGG - Intronic
1010348496 6:74841859-74841881 TTCCCACAGCTTCTCAGGCATGG - Intergenic
1011606443 6:89110823-89110845 TTCCCACTGTTGCCCAGGCATGG + Intronic
1011938380 6:92811509-92811531 TGCCCACAGCTGCCAAGTTCAGG + Intergenic
1013823036 6:114178514-114178536 TTCCCAGAGCTGCCCTAGACAGG + Intronic
1014418722 6:121215097-121215119 TCCCAACATCTGCCCAAGTCTGG + Intronic
1014818762 6:125961985-125962007 TCCCCTCACCTGCCCAAGTCAGG - Intronic
1015828577 6:137342971-137342993 TTCACACATTTGCCCAGCTCTGG + Intergenic
1019938297 7:4270423-4270445 AGCCCCCAGCTGCCCAGGTTTGG - Intergenic
1020009569 7:4800687-4800709 TTCCCACCGCTGACCAGACCGGG + Intronic
1021340441 7:19457443-19457465 GTCCCACAGCTGCCCATAGCAGG + Intergenic
1022092324 7:27115699-27115721 CTCCCACGGCTCCTCAGGTCTGG - Intronic
1022185285 7:27961408-27961430 TTCCGACTGCTGCCCAAGGCTGG + Intronic
1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG + Intronic
1022497782 7:30863976-30863998 TGCTCAGTGCTGCCCAGGTCTGG - Intronic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1023231519 7:38035480-38035502 GTCCCCCAGCTCCCCAGCTCTGG - Intergenic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1024272735 7:47655004-47655026 TTCCCACAGGCGCCCAGCCCTGG + Intergenic
1024283736 7:47739470-47739492 TCCCCACTGTGGCCCAGGTCAGG - Intronic
1027355305 7:77348485-77348507 TTCCCCCAGCTGTCCAGGCCCGG + Intronic
1029578525 7:101419918-101419940 TTCCCAGAGCTGCCAACTTCGGG - Intronic
1029611302 7:101627909-101627931 GTCCCACAGCTCCAGAGGTCCGG - Intronic
1029629215 7:101739930-101739952 TTTGCACAGCTGTCCAGGCCTGG + Intergenic
1029682892 7:102124403-102124425 TTCACACAGCAGCCTAGGTGAGG + Intronic
1030250459 7:107438358-107438380 TTCCCACAGTTTCCCACCTCTGG + Intronic
1031969116 7:128051117-128051139 TTCCCACAGCTTCCCAGTGCAGG + Intronic
1032742063 7:134749037-134749059 TTCTCACAGCTCCCGAAGTCGGG - Intronic
1033113696 7:138606450-138606472 TACCCACAGCTGCACAGATAAGG - Intronic
1033434113 7:141316969-141316991 TTGCCACAGTTCCCCAGTTCTGG + Intronic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1034969571 7:155410660-155410682 ATCCCCCAGTTGGCCAGGTCTGG - Intergenic
1035218608 7:157390707-157390729 TTCCCACAGCTGCCCTGAGTTGG + Intronic
1035635145 8:1138784-1138806 TCCCACCAGCTGCACAGGTCAGG - Intergenic
1036700158 8:11008082-11008104 TTCCCCCAGGTGCACAGGTGAGG - Intronic
1037826272 8:22162472-22162494 CTCCCACGGCTGCCTAGGGCTGG - Intronic
1038697279 8:29817798-29817820 TGCCCAAAGCTGCACAGGTGTGG + Intergenic
1040994796 8:53390806-53390828 TTCCAACCTCTGCCCAGGACTGG - Intergenic
1042202756 8:66297103-66297125 TTCTGACACCTGCCCAGGTAAGG + Intergenic
1043914754 8:85908761-85908783 AGCCCACAGCTTCCCAGGTAAGG - Intergenic
1044755451 8:95457077-95457099 TTCTCACACCTTGCCAGGTCTGG - Intergenic
1046114582 8:109769379-109769401 TTTCCACAGCTGCCCAGGTAGGG + Intergenic
1048138124 8:131766059-131766081 TGGCCACAGCTGCCAAGGACTGG - Intergenic
1048314559 8:133352491-133352513 TTCCCCAACCTGCCCTGGTCTGG - Intergenic
1049475594 8:142795664-142795686 TTCCCACAGCCGCCCTGGTCCGG - Intergenic
1052699676 9:31922520-31922542 ATCCCACAGTGGCCCAGGTTAGG - Intergenic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1057186850 9:93061939-93061961 ATCCCACAGCAGGCGAGGTCAGG + Intronic
1057906976 9:98990713-98990735 TGTCCAAAGCTGCCCAGCTCTGG - Intronic
1058085100 9:100740063-100740085 TTTCCACTCCTGCCCAGTTCTGG + Intergenic
1059187378 9:112287032-112287054 TCCCCACCCCTGCCCAGCTCTGG + Intronic
1060023334 9:120150714-120150736 TTCCCCCAGTTGCCCAGGCTGGG - Intergenic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060969597 9:127730572-127730594 TTCCCAGAGCTGTCCAGGGCAGG + Intronic
1061520537 9:131114878-131114900 GTGCCACACCTGCCCAGGGCTGG + Intronic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1061761736 9:132856297-132856319 CTCCCACCTCTGCCCAGGGCAGG + Intronic
1185432966 X:19962-19984 TTCCCGCAGCGGCCCAGCCCCGG + Intergenic
1186484501 X:9923578-9923600 TTCCCACCTCTGCCCAGGCCTGG + Intronic
1186998504 X:15149836-15149858 TTGCCAGTGCTGACCAGGTCAGG - Intergenic
1187019897 X:15370092-15370114 CTCCCACCCCTGCCTAGGTCTGG + Intronic
1187739522 X:22340571-22340593 TTCCCATACCTGCCTAGCTCTGG + Intergenic
1189304775 X:39978857-39978879 TTTCCACAGCTGCCCAAGCATGG + Intergenic
1195206449 X:102604398-102604420 TCCCCAGAGCTGCCCAGATAGGG - Intergenic
1195655664 X:107329315-107329337 TTGCCACCCCTGCCCAGGCCTGG + Intergenic
1195924805 X:110014828-110014850 TTCCAACAGTTACCCAGCTCTGG - Intronic
1199585572 X:149412727-149412749 TTCCCACAGCTTCACAAGGCAGG - Intergenic
1199675885 X:150189028-150189050 TTCCCTCAACAGCCCAGGCCTGG + Intergenic
1201065897 Y:10093311-10093333 TTCCTCCAGCTCCCCAGCTCCGG + Intergenic