ID: 901233097

View in Genome Browser
Species Human (GRCh38)
Location 1:7652064-7652086
Sequence CACGACAGGGCCTCCTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901233097_901233105 15 Left 901233097 1:7652064-7652086 CCAAATGAGGAGGCCCTGTCGTG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 901233105 1:7652102-7652124 CCCACACATCCTGTACCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901233097 Original CRISPR CACGACAGGGCCTCCTCATT TGG (reversed) Intronic
900168835 1:1256433-1256455 CCCGCCAGGGGCTCCTCCTTGGG - Intronic
901233097 1:7652064-7652086 CACGACAGGGCCTCCTCATTTGG - Intronic
901677011 1:10891332-10891354 CACCTCAGTGCCTCCTCCTTAGG + Intergenic
902115538 1:14117870-14117892 CCAGACTGGGCCTTCTCATTTGG - Intergenic
903240050 1:21976753-21976775 CAGGACAAGACCTCCTCTTTCGG - Intergenic
903243797 1:22001389-22001411 CAGGACAAGACCTCCTCTTTCGG - Intergenic
907509748 1:54949379-54949401 CAGGGCAGGGCCTGCTCTTTTGG + Intergenic
919927487 1:202199698-202199720 CCCAGCAGGGCCTCCCCATTGGG - Intronic
923019958 1:230155554-230155576 CAGGACAGGGTCTCCTCCTTTGG + Intronic
923727244 1:236517249-236517271 CACAAGAGGACCTCCTCTTTCGG - Intergenic
924547435 1:245042966-245042988 CACGATTGGGCCACCTTATTGGG + Intronic
1072954770 10:99878664-99878686 CACGACTGGGCCTTCCCATGAGG + Intronic
1075532638 10:123242923-123242945 CATGGCTGGGTCTCCTCATTTGG + Intergenic
1076677834 10:132156623-132156645 CATGTCAGGGCCACCTCACTGGG - Intronic
1077499405 11:2902439-2902461 CACGTCAGGGGCACCTCATTGGG - Exonic
1080114329 11:28605196-28605218 CACAAAAGGCCCTACTCATTTGG - Intergenic
1082006160 11:47420300-47420322 CTGGCCCGGGCCTCCTCATTGGG + Exonic
1083619631 11:64042469-64042491 CATCACAGGGCCTCCTCTATTGG - Intronic
1090428908 11:126629662-126629684 CCTGCCAAGGCCTCCTCATTGGG - Intronic
1091555895 12:1573275-1573297 CAGGTCAGGGCCTCCTGATTTGG + Intronic
1095098779 12:38161356-38161378 CACCCCAGGGCCTCCTCGTGGGG - Intergenic
1103450085 12:121022571-121022593 CATGGGTGGGCCTCCTCATTTGG + Intronic
1103741583 12:123095077-123095099 CACGGCAGTGCGTCCACATTAGG + Intronic
1104253534 12:127119732-127119754 CACCACATGGCCTCCCCACTGGG - Intergenic
1107016645 13:35712696-35712718 CGGGACAGGGCCTCCTCACCTGG + Intergenic
1118647276 14:67851886-67851908 CAGGGCAGGGCCTCCTGACTTGG - Intronic
1119954290 14:78778964-78778986 CACGACAGAGCATCCATATTTGG - Intronic
1121416966 14:93786462-93786484 CTCGGCAGGGCCCCATCATTTGG + Intronic
1125283182 15:38065098-38065120 GAGGACAGGGCCTTCTTATTAGG - Intergenic
1131449665 15:92528799-92528821 CTAAACAGGGCCTCCACATTTGG + Intergenic
1133322750 16:4924599-4924621 CAGGACAGGGTCTCCTCTGTGGG + Intronic
1134842099 16:17409985-17410007 CACAGCAGAGCCTCCACATTTGG - Intronic
1157334228 18:46725779-46725801 CTCCACAGGCCTTCCTCATTGGG - Intronic
1160909388 19:1467802-1467824 CAGTACACGGCCTCCTCAGTGGG - Exonic
1168667885 19:58218148-58218170 CCCGCCCGGGTCTCCTCATTAGG + Intergenic
925552029 2:5086814-5086836 CCAGACAGGGCCTCCTCAGTTGG - Intergenic
938060787 2:128252739-128252761 CACTGCAGGGCCTCGTCATATGG - Intronic
940906294 2:159172920-159172942 CCCCACAGGGCCTCCTCACAAGG - Intronic
947959729 2:234225711-234225733 CAGACCAGGGCCTCCTCACTTGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
1178339633 21:31775092-31775114 CAAGACACGGCCTCCTTTTTGGG - Intergenic
1178367373 21:31998930-31998952 CAACACAGGCCCTCCTCTTTTGG - Exonic
1180213104 21:46307584-46307606 CACTCCAGGGGCTCCTCATATGG + Intronic
1184108723 22:42383241-42383263 CAGGAGAGGGCCACCTCACTGGG - Exonic
950737828 3:15024947-15024969 CATTACAGGGCATCCTCTTTTGG + Intronic
953046025 3:39294754-39294776 GACTGCAGGGCCTGCTCATTGGG - Intergenic
962849689 3:139299200-139299222 CAGGACAGGATATCCTCATTGGG - Intronic
977607176 4:98995428-98995450 CTCGGCAGGGCCCCCCCATTCGG - Intergenic
984881425 4:184413060-184413082 AACGCCGGGGCCTCCTCTTTAGG + Intronic
985670825 5:1205802-1205824 CCCAGCAGGGCCTGCTCATTAGG - Intronic
997337867 5:133120556-133120578 CAGGCCAGGGCCTCATCAGTAGG + Intergenic
999437506 5:151574599-151574621 CAGGACAGGGCTACATCATTGGG + Intergenic
1018471875 6:164104834-164104856 CACGACAGGGGCTCTTAACTAGG - Intergenic
1022412415 7:30149335-30149357 CACGTCAAGGCCTCCTCACCTGG - Intronic
1023327440 7:39075287-39075309 CATGCCAGGCCCTCCCCATTTGG - Intronic
1026472508 7:70706241-70706263 CACGATGGGGACTCCTCCTTTGG - Intronic
1033244771 7:139708435-139708457 CCCCAGAGGGCCTGCTCATTAGG + Intronic
1044533555 8:93334807-93334829 CAGGCCTGTGCCTCCTCATTTGG + Intergenic
1047543116 8:125789953-125789975 CAGGACAGCTGCTCCTCATTAGG - Intergenic
1049343084 8:142124204-142124226 GACGAAGGGGCCTCCCCATTGGG + Intergenic
1049782292 8:144434550-144434572 CATGCCAGGCCCTCCTCCTTGGG + Intronic
1050703749 9:8370982-8371004 TATGACAGGGCCTCTTCAGTTGG + Intronic
1056680737 9:88715602-88715624 CTTGACAGGGCCTCTTCATCAGG - Intergenic
1058473695 9:105307722-105307744 CAGCACAGGGCTTCCTAATTTGG + Intronic
1061595093 9:131623801-131623823 CACGACGTGTCCTCATCATTTGG - Intronic
1192763201 X:74118263-74118285 CATGACAGGGCCTCCCAAATGGG + Intergenic
1198910594 X:141609128-141609150 CATAACACTGCCTCCTCATTTGG + Intronic