ID: 901234138

View in Genome Browser
Species Human (GRCh38)
Location 1:7658510-7658532
Sequence CTGCCTGTGCAGCGGTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901234134_901234138 -3 Left 901234134 1:7658490-7658512 CCCACAGCTGGAACAGACCACTG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 131
901234132_901234138 10 Left 901234132 1:7658477-7658499 CCAGAGTAGGGGACCCACAGCTG 0: 1
1: 0
2: 2
3: 13
4: 162
Right 901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 131
901234135_901234138 -4 Left 901234135 1:7658491-7658513 CCACAGCTGGAACAGACCACTGC 0: 1
1: 1
2: 0
3: 24
4: 174
Right 901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 131
901234130_901234138 21 Left 901234130 1:7658466-7658488 CCTGGGTACAGCCAGAGTAGGGG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901234138 Original CRISPR CTGCCTGTGCAGCGGTACAG AGG Intronic
901234138 1:7658510-7658532 CTGCCTGTGCAGCGGTACAGAGG + Intronic
901563178 1:10089462-10089484 ATACCTGGGCTGCGGTACAGTGG - Intronic
902138226 1:14329451-14329473 CTTCCTATGAAGCGGTATAGTGG - Intergenic
902212456 1:14913705-14913727 CTGCCTGTGCAGGGGTGGTGGGG + Intronic
902642135 1:17773896-17773918 CTGTCTGTGCAGGGCCACAGAGG + Intronic
902845780 1:19109772-19109794 CTGCATGTGCAAAGGCACAGGGG + Intronic
903390545 1:22960575-22960597 CTGCCTGGGCTGGAGTACAGTGG - Intronic
907242997 1:53090917-53090939 CTGCCGGAGCAGCGCTGCAGAGG - Intronic
915030983 1:152880319-152880341 GTGCCCCTGCAGCTGTACAGTGG - Intronic
915316100 1:155029992-155030014 CTGCCTGTGCAGGGGCTTAGGGG + Intronic
919993688 1:202728130-202728152 CTGGCTGTGCAACAGTAGAGGGG + Exonic
920670286 1:207998891-207998913 CTGCCAGTGCCGAGGTTCAGAGG - Intergenic
922025238 1:221743089-221743111 CGCCCTGAGCAGCGGTGCAGAGG + Intergenic
922108435 1:222533075-222533097 CTGCCTGTGAATGGGTGCAGTGG + Intronic
1062940384 10:1416591-1416613 CTGCCTGTGCAGCCTCACAAGGG - Intronic
1063362166 10:5467805-5467827 CTGCATGTGGAGGGGTACAGGGG - Intergenic
1063726520 10:8643048-8643070 CTGCCTGTCCAGTGGAACACAGG - Intergenic
1064980467 10:21161626-21161648 CTGCCTGTGAACAGGAACAGGGG - Intronic
1065260088 10:23914861-23914883 CTGCCTGTGGAGCAGGACTGTGG + Intronic
1065866123 10:29916907-29916929 CTGGCTGTGCAGAGAAACAGGGG - Intergenic
1069229647 10:65993773-65993795 TTGCCTGGGCTGCAGTACAGTGG + Intronic
1072611565 10:97020662-97020684 CTTTATGTGCAGGGGTACAGCGG - Intronic
1075374990 10:121971877-121971899 TTGCCTGTGAAGCCATACAGAGG - Intronic
1075906191 10:126083801-126083823 CTGCCTGCCCAGCGGTGCACAGG + Intronic
1076438640 10:130463852-130463874 CTGGCTGTGCAGCTGTGCATGGG - Intergenic
1076573118 10:131445451-131445473 CTGTCTGTGCAGTGGTCCTGTGG - Intergenic
1077462358 11:2716968-2716990 GTGCCTGTGGAGCTGTTCAGTGG + Intronic
1078064059 11:8066418-8066440 CAGGCTGTGGAGCTGTACAGGGG - Intronic
1084457386 11:69275931-69275953 CTTCCTGTGCAGTGGAGCAGAGG + Intergenic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1091111309 11:132971617-132971639 CTCCTTATGCAGCTGTACAGAGG + Intronic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1102360270 12:112280826-112280848 CTGCCTGGGCTGCAGTACAATGG + Intronic
1103003916 12:117406814-117406836 CAGCATGTGCAAAGGTACAGAGG - Intronic
1104167437 12:126247252-126247274 CTGCCTGTGCAAAGGCTCAGTGG + Intergenic
1105553268 13:21418711-21418733 CTGCCTGGGCTGCAGTGCAGTGG + Intronic
1107758734 13:43653083-43653105 CTGCCTGTGCTGCGCAACTGAGG - Intronic
1113670239 13:112171136-112171158 CTCCTTCTGCAGCGGTGCAGGGG + Intergenic
1114437918 14:22723556-22723578 CTGGCTCTGCAGGGGAACAGGGG + Intergenic
1115714313 14:36085851-36085873 CTGCCAGTGAAGAGGTTCAGAGG + Intergenic
1119731410 14:76953607-76953629 CTGCCTGGGCAGCGGGAGAGTGG - Intergenic
1122744653 14:103890656-103890678 CTGCCCATGTAGCAGTACAGAGG - Intergenic
1126213873 15:46132159-46132181 CAGTCTGTGCAGTGGTAGAGCGG + Intergenic
1128889435 15:71317701-71317723 CTGCCTGTGTAGGGGGACAGTGG + Intronic
1129224670 15:74162039-74162061 CTGCCTGTGGAGCGGAAGAATGG + Intergenic
1133760649 16:8796046-8796068 GTGCGTATCCAGCGGTACAGTGG - Exonic
1135279611 16:21142691-21142713 CTGCCTGTGCTGGAGTGCAGTGG + Intronic
1138600068 16:58048891-58048913 CTGCCGGAGCATCGGGACAGGGG + Intergenic
1141603496 16:85140041-85140063 CTGCCTGTGCAAGAGGACAGAGG + Intergenic
1144517453 17:15928506-15928528 CAGCCGGTGCAGCTGTACAAGGG + Intergenic
1146460832 17:33044979-33045001 CTGCATGTGCAGAGATACAGAGG + Intronic
1147924719 17:43939192-43939214 CTGTCTGTGCAGGACTACAGGGG - Intergenic
1148158395 17:45436389-45436411 ATGCCTGTGCAGCAGAACAGAGG - Exonic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1152230258 17:79110792-79110814 CTGCCCGTGCCACGGTGCAGAGG - Intronic
1152356080 17:79808138-79808160 CTCCCTGAGCAGCTGGACAGAGG - Intergenic
1155334068 18:24747142-24747164 CAGCCTGTGCAGAGGTTCTGAGG - Intergenic
1157200062 18:45652431-45652453 CAGCCTGTGCAGCGGTAGAAGGG - Intronic
1160586540 18:79916404-79916426 CTGCCTGGGCAGGTGAACAGAGG - Intronic
1161668612 19:5591694-5591716 ATGCCTGCACAGCAGTACAGTGG + Intronic
1162887796 19:13709093-13709115 TTGCCTGGGCAGCAGTGCAGTGG - Intergenic
1166751860 19:45167956-45167978 TTGCCTGGGCTGCAGTACAGTGG - Intronic
1168262950 19:55207178-55207200 GGGCCTGTGCAGCTGGACAGGGG - Exonic
926060627 2:9802582-9802604 CTGGCTGTGCAGCGTTTGAGGGG + Intergenic
934588347 2:95525763-95525785 CTGCCTGTGCAGCTGTATTTAGG - Intergenic
936057634 2:109272792-109272814 CTGCGTGTGCGGCAGTACCGGGG - Intronic
936795938 2:116204255-116204277 GTGCTTGTGCAGTGGTGCAGAGG + Intergenic
938119846 2:128625682-128625704 CTGCCTGTTCAGCTGGACACTGG - Intergenic
940979472 2:159985360-159985382 CTGCCTGTGCAGAGATGCTGGGG + Intronic
941631368 2:167888614-167888636 CTGCCTTTGCTGCGTCACAGAGG + Intergenic
944839085 2:203608210-203608232 TTGTCTGAGCAGTGGTACAGTGG - Intergenic
947735952 2:232455673-232455695 CTACCTGTGCAAGGGAACAGGGG + Intergenic
948978021 2:241475819-241475841 CTGCCTGTACACCTGTACTGAGG + Intronic
1169112496 20:3043174-3043196 CAGGCTGTTCAGAGGTACAGGGG - Intergenic
1170508166 20:17050254-17050276 CTCCCTGCACAGCGGTGCAGAGG + Intergenic
1174410562 20:50332228-50332250 CTGCATGTGCAGAGGTCCCGAGG - Intergenic
1174677420 20:52371881-52371903 CTGCCTGTGCAGTGGGAGACTGG - Intergenic
1175070760 20:56331943-56331965 CTGCCTGTGCAGTGGGCGAGGGG + Intergenic
1180181863 21:46121664-46121686 CTGCCTGAGGAGCAGGACAGGGG + Intronic
1182087406 22:27570801-27570823 CAGCATGTGTAGCGGTCCAGGGG - Intergenic
1182795053 22:32985799-32985821 AGGCCTGTGCAGAGGTTCAGAGG - Intronic
1183251021 22:36730425-36730447 CTGCCTGTGCTGTGTTCCAGGGG + Intergenic
950643803 3:14365195-14365217 CAGCTTGTGCAGAGGTTCAGAGG - Intergenic
953795480 3:45982554-45982576 CTGCCTCTGCTGTGGGACAGAGG + Intronic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
961782811 3:129331099-129331121 CTTCCTGGGCACAGGTACAGGGG + Intergenic
961997037 3:131257022-131257044 TTGCCTGTGCTGGAGTACAGTGG + Intronic
969671444 4:8592467-8592489 CAGCCTGTGCAGGGGACCAGGGG + Intronic
971036909 4:22703709-22703731 CAGCATGTGCAAAGGTACAGAGG - Intergenic
977905051 4:102467683-102467705 CTGCCTGTGCATCTGCACAGAGG - Intergenic
980788400 4:137584983-137585005 CTACCTGTGCAGAGTGACAGTGG + Intergenic
980859561 4:138482826-138482848 CTGGCTCTGCAGAGGTAGAGAGG - Intergenic
982392275 4:154877581-154877603 CTGGCTGTGCAGCTGTGCATGGG + Intergenic
987390186 5:17368209-17368231 CTGCCGGTGCAGCAGGACATGGG + Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992066410 5:73113895-73113917 CTCCCTGTGCACCTGTCCAGTGG + Intergenic
993022941 5:82613519-82613541 TTACCTGTGAAGTGGTACAGGGG + Intergenic
997101689 5:130976271-130976293 CTGGTTGTGCAGCAGCACAGTGG + Intergenic
997304098 5:132825811-132825833 CTGCCTGTTCAGTGGTCCCGGGG + Exonic
998085684 5:139320561-139320583 CTGCCTATGCTGAAGTACAGTGG - Intronic
1002339079 5:178502877-178502899 CAGCGTGTGCTGCGGTTCAGGGG - Intronic
1002601305 5:180355215-180355237 CAGCCTGGGCAGTGGTTCAGAGG + Intergenic
1010366440 6:75057525-75057547 ATGTCTGTGCAGCGCTGCAGTGG + Intergenic
1010375158 6:75160213-75160235 CTGGCTTAGCAGTGGTACAGTGG - Intronic
1019566248 7:1680506-1680528 CTTCCTGAGCAGCTTTACAGAGG + Intergenic
1020959880 7:14788756-14788778 CTGCCTGTCCCATGGTACAGTGG + Intronic
1021939424 7:25665122-25665144 CTGCCTGTGCAAAGGTCCTGAGG + Intergenic
1027355369 7:77349057-77349079 CAGCCTGTTCTGAGGTACAGTGG + Intronic
1029553045 7:101248330-101248352 CTGCCTGTGTAGCGGAGCTGTGG - Intronic
1032084091 7:128874548-128874570 CTCCATCTGCAGCAGTACAGGGG + Intronic
1033559658 7:142519582-142519604 CTGAGTGGCCAGCGGTACAGAGG - Intergenic
1036734374 8:11297643-11297665 CTGCCTGTGGTGAGGCACAGTGG + Intronic
1044337569 8:91005322-91005344 CTACCTGTGCAAAGGTACAAAGG - Intronic
1045181290 8:99785932-99785954 CTGTGTGTGCATCGGTAAAGTGG - Intronic
1046149749 8:110208135-110208157 CGGCATGTGCAGAAGTACAGTGG + Intergenic
1049657242 8:143804294-143804316 CTGCCTGGGCAGCAGAACACTGG - Intronic
1049756494 8:144313383-144313405 CAGCCTGTGCAGGCGTACACGGG + Intronic
1054736955 9:68763209-68763231 CAGCCTGTGCAGAGGAAAAGAGG + Intronic
1054851073 9:69847290-69847312 CTGCCTGAACAGCTGTCCAGAGG - Intronic
1055069905 9:72155502-72155524 CTGCCTGTGCAAAGGTCCTGGGG + Intronic
1060413304 9:123413894-123413916 CAGCCTGTGCACCGGTGGAGGGG - Intronic
1185908579 X:3960946-3960968 CTGCCTGTGAAGGGGTCCACAGG - Intergenic
1186429672 X:9494105-9494127 CTGCATGTGGTGCGGTCCAGTGG + Intronic
1186801216 X:13093834-13093856 CTGCCTGTACATCAGAACAGGGG + Intergenic
1190872973 X:54440359-54440381 CTGCCTGGGCCGAGCTACAGAGG + Intergenic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1196487187 X:116225776-116225798 CTGCTTGTGGAGAGGTACATTGG + Intergenic
1198341656 X:135720063-135720085 CTGCCTGCGCAGAGGCAGAGGGG - Intronic
1198346342 X:135763298-135763320 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198348248 X:135780583-135780605 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198350150 X:135797846-135797868 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198352060 X:135815119-135815141 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198353968 X:135832387-135832409 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198355876 X:135849637-135849659 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198357787 X:135866916-135866938 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198359705 X:135884198-135884220 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198366559 X:135945976-135945998 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1200035032 X:153321351-153321373 CTGCCGTTGCAGAGGTGCAGGGG - Intergenic