ID: 901234667

View in Genome Browser
Species Human (GRCh38)
Location 1:7661516-7661538
Sequence CAGAACCCCCGATGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901234656_901234667 20 Left 901234656 1:7661473-7661495 CCACTCCCTGGGCTGCACCATAG 0: 1
1: 0
2: 1
3: 25
4: 228
Right 901234667 1:7661516-7661538 CAGAACCCCCGATGGGAGCAGGG 0: 1
1: 0
2: 2
3: 10
4: 111
901234659_901234667 14 Left 901234659 1:7661479-7661501 CCTGGGCTGCACCATAGTGAGGG 0: 1
1: 0
2: 3
3: 7
4: 210
Right 901234667 1:7661516-7661538 CAGAACCCCCGATGGGAGCAGGG 0: 1
1: 0
2: 2
3: 10
4: 111
901234657_901234667 15 Left 901234657 1:7661478-7661500 CCCTGGGCTGCACCATAGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 131
Right 901234667 1:7661516-7661538 CAGAACCCCCGATGGGAGCAGGG 0: 1
1: 0
2: 2
3: 10
4: 111
901234663_901234667 3 Left 901234663 1:7661490-7661512 CCATAGTGAGGGGGAGCTAAAGA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 901234667 1:7661516-7661538 CAGAACCCCCGATGGGAGCAGGG 0: 1
1: 0
2: 2
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901234667 Original CRISPR CAGAACCCCCGATGGGAGCA GGG Intronic
900112808 1:1015653-1015675 CTGAACCCCCAACGGGGGCAGGG + Intergenic
900934025 1:5754084-5754106 CAGAATCCCTGCTGGGAGGACGG - Intergenic
901234667 1:7661516-7661538 CAGAACCCCCGATGGGAGCAGGG + Intronic
901751869 1:11414977-11414999 CAGAGCCCCTGCTGGGAGCTGGG + Intergenic
902259128 1:15210885-15210907 CAGATGCCCCGCTGGGAGCTGGG + Intronic
904462398 1:30687914-30687936 CAACACCCCCCATGGGTGCATGG + Intergenic
905371002 1:37482674-37482696 CAGAACCAGGGATGAGAGCAGGG - Intronic
905651685 1:39661040-39661062 CAGAACCCCTGAGAGGAACAAGG - Intronic
908809138 1:67961017-67961039 CTGAACCCCTGATGGGAGGTTGG + Intergenic
911202637 1:95061119-95061141 CAGAACCTCCGGAGGGAGTATGG + Intronic
911337030 1:96593760-96593782 GAGAGCCCCCTATGGGAACAAGG + Intergenic
920351714 1:205342363-205342385 CAGAATCCCCCAGGGCAGCATGG - Intronic
922768819 1:228170986-228171008 CAGAAGCCCCGGTGGGAGCAAGG - Intronic
1070642555 10:78180134-78180156 CCGAACCCCCTCTGTGAGCAGGG - Intergenic
1070849238 10:79550138-79550160 CAGAACCCCCGCTGCTAGCCAGG - Intergenic
1070924615 10:80210952-80210974 CAGAACCCCCGCTGCTAGCCAGG + Intergenic
1071481811 10:86070306-86070328 ATGCACCCCTGATGGGAGCAGGG + Intronic
1074428790 10:113375060-113375082 CAGAACCCCAGAGAGAAGCAAGG - Intergenic
1075728652 10:124623448-124623470 CAGGACCCCCGCTGGGACCCCGG - Exonic
1077009480 11:373836-373858 CAGAAGCCCCCAGGGGAGGAAGG - Intronic
1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG + Intergenic
1082004499 11:47412194-47412216 CAGAACTCCCACTGGGACCAGGG - Intronic
1083710061 11:64542635-64542657 CAGACCCCAAGAAGGGAGCATGG + Intergenic
1084578988 11:70010719-70010741 CAGGACCCCTGGTGGGAGCGGGG - Intergenic
1089622539 11:119729873-119729895 AGGAACCCCCGAAGGGAGCAGGG - Intergenic
1095984197 12:47988791-47988813 CAGAAACCCAGAGGGGAGCAGGG + Intronic
1096217295 12:49804972-49804994 CAGAGCCCCGGAGGGGTGCAGGG - Intronic
1098050838 12:66451141-66451163 CAGAACCCTCCATGTGAGAATGG - Intronic
1100305044 12:93342605-93342627 CAGAAGCCAGGATGGAAGCAAGG + Intergenic
1102244599 12:111347575-111347597 CAGGACCCCCGCTTGGATCAAGG - Exonic
1102692720 12:114773981-114774003 CAGAACCCAAGAGGGGAGCAAGG + Intergenic
1103087270 12:118071261-118071283 CAGAACTTCAGGTGGGAGCAAGG + Intronic
1104961741 12:132491273-132491295 CAGAGCCCTCGAAGGGAGGAGGG - Intronic
1105328796 13:19395047-19395069 CAAAACCTCTGATGGGATCAGGG - Intergenic
1105863140 13:24434787-24434809 CAAAACCTCTGATGGGATCAGGG + Exonic
1107444388 13:40457306-40457328 GAGAACCCTGGAAGGGAGCAGGG + Intergenic
1113705055 13:112424867-112424889 CATATCCCCCCATGGGAACAAGG + Intronic
1114630729 14:24157871-24157893 CAGAAACCCAGATGGGAGAGAGG - Intronic
1115191828 14:30754780-30754802 CAGAACCCACAGTGGCAGCATGG - Intergenic
1115414082 14:33111181-33111203 CAGAAAGCCTGAAGGGAGCAAGG + Intronic
1117493054 14:56271778-56271800 CAGCCTGCCCGATGGGAGCAGGG - Intronic
1118108533 14:62689386-62689408 CAGACTTCCAGATGGGAGCATGG - Intergenic
1119180078 14:72599748-72599770 CACAGCCCCTGATGAGAGCAGGG + Intergenic
1125577222 15:40764142-40764164 TAGAGCCCCCGGTGGGAGCCAGG + Exonic
1127287031 15:57541393-57541415 CAGAAACCACCTTGGGAGCAGGG + Intronic
1129955957 15:79637051-79637073 CAGTACCCCCTATAGGAGTATGG - Intergenic
1133108717 16:3532849-3532871 CAGAACCACTGAGGGGAGCGGGG - Intronic
1136049071 16:27637863-27637885 AAGGACCGCCCATGGGAGCAAGG + Intronic
1136271899 16:29153533-29153555 CAGAGCCCCCGGAGGGAGTACGG - Intergenic
1137008302 16:35298800-35298822 CAAAATCCCCCCTGGGAGCAGGG + Intergenic
1139357049 16:66372716-66372738 CCCAACCTCCCATGGGAGCATGG + Intronic
1140719691 16:77760253-77760275 CAGAGCCTCCGGAGGGAGCACGG - Intergenic
1142073765 16:88105730-88105752 CAGAAGCCCTGGTGGGAGCTCGG + Intronic
1142493531 17:293638-293660 CAGCACCGGTGATGGGAGCACGG + Intronic
1151759204 17:76091029-76091051 GAGAAACCCTGAGGGGAGCAGGG - Intronic
1153816218 18:8792663-8792685 CAGAAGCCACTGTGGGAGCAAGG + Intronic
1157095644 18:44683272-44683294 CAGAAGCCCTTATGGCAGCAGGG - Intronic
1160957238 19:1699370-1699392 GAGAACCCCCGCTGGGAGGGAGG + Intergenic
1163350029 19:16770728-16770750 CAGGACCCTCGATGGCAACACGG - Intronic
1164570225 19:29368965-29368987 CAGAGCCCCAGAAGGCAGCATGG + Intergenic
1166626027 19:44356711-44356733 CAGAATTCCCGACGGGATCAGGG + Intronic
1166790374 19:45395633-45395655 CAGAACGCCTTCTGGGAGCACGG - Exonic
928692442 2:33814550-33814572 TAGAAGCCCAAATGGGAGCAAGG - Intergenic
935145873 2:100395029-100395051 CGGAACCCCTGATCGCAGCAAGG - Intronic
940646697 2:156399632-156399654 CAGACACTCCGATGGGAGCAGGG - Intergenic
941380603 2:164787811-164787833 CAGAAGCTCCTATGGGAGCAGGG - Intronic
945693380 2:213070709-213070731 CAGAACGCCACATGGGAGCACGG + Intronic
947638685 2:231693903-231693925 AAGAACTCCCTCTGGGAGCAAGG + Intergenic
948932846 2:241143203-241143225 CAGAACCCGCAATGGGAGAATGG + Intronic
949034291 2:241809574-241809596 CAGAGCCCCAGATGGGCCCAGGG + Intronic
1170524696 20:17226604-17226626 CAGAGGCCCCGAGGGGAGCAGGG - Intronic
1170883738 20:20319823-20319845 CAGAACCCCCTAGGGAATCATGG + Intronic
1171014492 20:21527740-21527762 CATAACCCCCAAAGGGAGGAAGG - Intergenic
1174552664 20:51373021-51373043 CAGAATCCCTGTTGGGGGCAAGG + Intergenic
1176197612 20:63844611-63844633 CAGGACCCCCCAAGGGAGGAGGG - Intergenic
1176265419 20:64206640-64206662 CAGAGCCCCCCAAGGGAGCTGGG - Intronic
1176366161 21:6034121-6034143 CAGAACCCCCACTGGCTGCACGG - Intergenic
1179757356 21:43504424-43504446 CAGAACCCCCACTGGCTGCACGG + Intergenic
1182803714 22:33052921-33052943 CAGAACCTACAAAGGGAGCATGG + Intronic
1183091488 22:35525297-35525319 CAGGACCCCAGGTAGGAGCAGGG + Intergenic
950408134 3:12817172-12817194 CAGAACCCCGGCTGGCAACAGGG - Exonic
952901635 3:38115213-38115235 CAGCAACCCTGATGAGAGCAGGG - Intronic
953778535 3:45844255-45844277 CAGAACCCCTGTTGTGTGCAAGG + Intronic
968427276 4:532370-532392 CAGATGCCACGATGGGAGCAGGG - Intronic
969927013 4:10594401-10594423 GAGAACCTCGGATGGAAGCATGG - Intronic
981859064 4:149333206-149333228 CAGAAATCAAGATGGGAGCAGGG + Intergenic
981934779 4:150227969-150227991 CAAAACCCCCAAAGGAAGCATGG - Intronic
982206615 4:153001553-153001575 CAGAACCCCACATGGGTGGATGG + Intergenic
982240572 4:153295714-153295736 GAGCACCCCCGACGGGAGCGTGG + Exonic
985685794 5:1280870-1280892 CAAAACCACCCATGGGGGCACGG + Intronic
986710769 5:10486571-10486593 CAGAGCCTCCGATGGGAGGGCGG + Intergenic
987502565 5:18732423-18732445 CAAGACCCCCCATGGGTGCATGG + Intergenic
990332611 5:54742561-54742583 CAGAAACCCGGAAGGGTGCACGG - Intergenic
991119947 5:63001073-63001095 CAGAGCCTCCAAAGGGAGCATGG - Intergenic
992911689 5:81401401-81401423 CAGCACCTCCCAGGGGAGCAGGG - Intergenic
999975912 5:156911989-156912011 CAGGACCTCAGATGGGAGCCAGG + Intergenic
1002375976 5:178789427-178789449 CAGAACCCAGGATCGGAGCTGGG - Intergenic
1011386243 6:86801672-86801694 CAGAAGCCCCCATGGGATGATGG - Intergenic
1019412449 7:912193-912215 CAGAAGCTCCGACAGGAGCACGG + Intronic
1019995857 7:4724138-4724160 CAGAATCCCAGCTGGGAGCACGG - Intronic
1020012868 7:4816012-4816034 CTGAAACCCCGATGGGACCCTGG + Intronic
1022522631 7:31017811-31017833 CAGAACCTCCTGTGGCAGCAGGG - Intergenic
1024617989 7:51132156-51132178 CAGAACCCCGGCTGGGGCCATGG + Intronic
1027363482 7:77433114-77433136 CAGAACTCCCCAGGGGAGCTGGG + Intergenic
1034229082 7:149506358-149506380 CAGAACCTTTGATGGGAGCGTGG - Intergenic
1035300757 7:157896027-157896049 CAGACCCCCCGATCCAAGCAGGG + Intronic
1037615732 8:20517537-20517559 CAGATCCCCTGAAAGGAGCATGG + Intergenic
1039885180 8:41650324-41650346 CGGAACCCCCCACGGGATCACGG - Intronic
1040884009 8:52239759-52239781 TAGGACCCCAGATGGGAGAACGG + Intronic
1045059619 8:98400438-98400460 CAGAGCCCGGGATGGGTGCAGGG - Intergenic
1048465888 8:134664379-134664401 CAAAACTCCCCAAGGGAGCAGGG + Intronic
1049687552 8:143944972-143944994 TAGAACCCCCTGTGGGAGCTGGG - Intronic
1053268592 9:36734420-36734442 CAAACCCACCGATGGGAGAATGG - Intergenic
1056452443 9:86729242-86729264 CAGAACCCTGGGAGGGAGCAGGG + Intergenic
1057466414 9:95317881-95317903 CGGAAGCCCCGGCGGGAGCAGGG + Intergenic
1185722882 X:2396015-2396037 GAGAGCCCCCGGAGGGAGCATGG - Intronic
1189465745 X:41276447-41276469 CAGAACCCGCGGAGGGAGGAGGG + Intergenic
1190146120 X:47893119-47893141 GAGAGCCCCTGATGGGAGGAGGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197887452 X:131233572-131233594 CAGAACACCCGCTGTGAGAAGGG - Intergenic
1199768236 X:150956249-150956271 CCGAACCCCAGATGTCAGCAGGG + Intergenic
1200144635 X:153920389-153920411 CAGGGGCCCCGCTGGGAGCATGG + Intronic
1201489309 Y:14524226-14524248 CCGAACCCCCGATGGGAGAAGGG - Intronic
1202603090 Y:26614524-26614546 CAAAACCTCTGATGGGATCAGGG + Intergenic