ID: 901238749

View in Genome Browser
Species Human (GRCh38)
Location 1:7680976-7680998
Sequence TGCCCCCCGGCCCCAACGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901238749_901238759 9 Left 901238749 1:7680976-7680998 CCCCACGTTGGGGCCGGGGGGCA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 901238759 1:7681008-7681030 CGTCCCCAAAATCTCAGCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 109
901238749_901238757 7 Left 901238749 1:7680976-7680998 CCCCACGTTGGGGCCGGGGGGCA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 901238757 1:7681006-7681028 GACGTCCCCAAAATCTCAGCTGG 0: 1
1: 0
2: 2
3: 2
4: 87
901238749_901238758 8 Left 901238749 1:7680976-7680998 CCCCACGTTGGGGCCGGGGGGCA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 901238758 1:7681007-7681029 ACGTCCCCAAAATCTCAGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
901238749_901238763 23 Left 901238749 1:7680976-7680998 CCCCACGTTGGGGCCGGGGGGCA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 901238763 1:7681022-7681044 CAGCTGGGGCGCAGCCATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 247
901238749_901238764 24 Left 901238749 1:7680976-7680998 CCCCACGTTGGGGCCGGGGGGCA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 901238764 1:7681023-7681045 AGCTGGGGCGCAGCCATCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901238749 Original CRISPR TGCCCCCCGGCCCCAACGTG GGG (reversed) Intronic