ID: 901240408

View in Genome Browser
Species Human (GRCh38)
Location 1:7689760-7689782
Sequence GAGAGCATGCAGAAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901240408 Original CRISPR GAGAGCATGCAGAAGGAGTC AGG (reversed) Intronic
900250554 1:1666568-1666590 GAGAGCAGGCTGAAGTACTCAGG - Intronic
901240408 1:7689760-7689782 GAGAGCATGCAGAAGGAGTCAGG - Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
902399303 1:16149277-16149299 GTGAGCCTGCAGGTGGAGTCCGG + Intronic
903064309 1:20690187-20690209 GAGAACCTGCGGAAGGAGACAGG - Exonic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903745697 1:25585278-25585300 GAGAGCACGCAGCAGGTGTGTGG + Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
906702889 1:47872600-47872622 GAGAGAATGAAGATGGAGTGAGG + Intronic
907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG + Intergenic
911204643 1:95080084-95080106 GAAAGCATGGAGAATGAATCTGG - Intergenic
911551014 1:99280662-99280684 GAGAGCCTGGAGAAGGTTTCAGG + Intronic
912259987 1:108101285-108101307 GAGAGCATGAAGAAAGAGCAAGG - Intergenic
913045341 1:115069188-115069210 AAGAGCAAGCAGGAGGATTCAGG + Intronic
915557924 1:156670388-156670410 GAGAGCGAGCAGGAGGAGTTGGG - Exonic
916177282 1:162053035-162053057 GAAGGCATGCAGAGGAAGTCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917483451 1:175433120-175433142 GAGAGAAGACAGAAGGAGCCTGG + Intronic
918401243 1:184164674-184164696 GTGAGCATGCAGAGGGAGTAGGG + Intergenic
919425272 1:197422026-197422048 CATAGCAGGCAGAAGCAGTCTGG - Intronic
920585724 1:207158085-207158107 GAGGGCATGAAGAGGGAGTAGGG + Intergenic
920834585 1:209497893-209497915 GAGAGCAGGCAGCAGGTGCCAGG + Intergenic
921313104 1:213864872-213864894 GACAGCACCAAGAAGGAGTCTGG + Intergenic
921488701 1:215747657-215747679 GAGAGATTGAAGAAGGAATCGGG + Intronic
922473045 1:225888335-225888357 GAGAGGCTGCAGGAGGATTCAGG + Intronic
922481048 1:225940305-225940327 GAGAGGCTGCAGGAGGATTCAGG + Intronic
922754652 1:228089011-228089033 GAGAACACGCAGGAGGAGGCTGG + Intronic
1063468667 10:6266333-6266355 GAGAGCATGCCGAAGGATACAGG - Intergenic
1065651656 10:27899155-27899177 GAGGGCAAGCAGAAGCAGACTGG + Intronic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1066068274 10:31778412-31778434 GAGTGCATGCATGAGGAGTGTGG - Intergenic
1066518457 10:36189764-36189786 GAGAGCATGGAGGAGGCCTCAGG + Intergenic
1067516081 10:46945946-46945968 TAGAGGAGGCAGAAGGAATCTGG + Intronic
1067646167 10:48105864-48105886 TAGAGGAGGCAGAAGGAATCTGG - Intergenic
1069209130 10:65733954-65733976 TAGAGCATGCAGTGGGGGTCTGG - Intergenic
1070279085 10:75035838-75035860 GAGAGCATGAGGAAGGTGTGGGG + Intergenic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070730690 10:78826166-78826188 GAGAGGATGCAGATGAGGTCAGG - Intergenic
1070797933 10:79227944-79227966 GAGAGCTGGCAGAGGGAGGCTGG + Intronic
1070940184 10:80337651-80337673 GAGAGCGTGTAGAGGGAGTGAGG - Intronic
1071359994 10:84837194-84837216 GAGGTCATGCAGTAGGAGACTGG - Intergenic
1072076859 10:91984717-91984739 GAGAGCAGGAAGAAGTACTCAGG - Intronic
1072717153 10:97759745-97759767 GAGAGCCTGCAGAAGGGCTTGGG + Exonic
1073424813 10:103449971-103449993 GAGAGGAGGCAGGAGGAGACGGG + Exonic
1073661546 10:105481367-105481389 GAGAGCATACATAAGGATTTGGG - Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1075808108 10:125204663-125204685 AATAGAATCCAGAAGGAGTCTGG - Intergenic
1076799905 10:132816260-132816282 GAGAACATGCAGAAGACGCCAGG - Intronic
1076838561 10:133033379-133033401 CAGAGCATGCAGACAGGGTCAGG - Intergenic
1077020154 11:413779-413801 GAGAGCGTGCAGGGGGAGGCAGG - Intronic
1077251572 11:1563130-1563152 GAGGCCAGGCAGAAGGAGCCTGG + Intronic
1077344835 11:2041931-2041953 TAGAGCATGGAGAATGAGTATGG - Intergenic
1077363397 11:2151222-2151244 GAGAGCAGGGAGAAGCGGTCAGG + Intronic
1077923238 11:6656318-6656340 GAGATCAAGCAGAAGGGGTAAGG - Intergenic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1078252392 11:9627032-9627054 GTGAGCAGAAAGAAGGAGTCAGG + Intergenic
1078386411 11:10896846-10896868 GAAAGCAGGAAGAAGGAGACGGG - Intergenic
1078933175 11:15928840-15928862 GAGAGCCTCGGGAAGGAGTCTGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081755815 11:45543531-45543553 GGGATCATGCAGAAGATGTCAGG + Intergenic
1083334215 11:61913408-61913430 GAGACCATGGAGGAGGAGTGGGG + Intronic
1084452724 11:69249719-69249741 GACAGAATGCAGCAGGACTCAGG - Intergenic
1084764291 11:71298098-71298120 GAGAGGAAGCAGAGGCAGTCAGG - Intergenic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1086092677 11:83020292-83020314 TAGAGCAGGCATAAGGAGTGGGG - Intronic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1089175108 11:116542917-116542939 GACACCATGAAGAAGCAGTCCGG + Intergenic
1090596292 11:128324419-128324441 GTGAGCATTCACATGGAGTCAGG - Intergenic
1091025170 11:132135485-132135507 GAGAACAGGCAGAAGGTGTAAGG + Intronic
1202827820 11_KI270721v1_random:97121-97143 TAGAGCATGGAGAATGAGTATGG - Intergenic
1092167931 12:6354509-6354531 GAGAGCATGATCAAGGAGTGTGG - Exonic
1093257377 12:16886700-16886722 GGGAGCAGGTAGAAGGAGCCAGG - Intergenic
1093530390 12:20154951-20154973 GAGAGTATGCAAAATGAGACAGG - Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096997901 12:55850708-55850730 GAGAGCATAAAAAAGCAGTCTGG - Intergenic
1098562671 12:71893398-71893420 GAGAGTATGCAAAATGAGACAGG + Intronic
1099888126 12:88556668-88556690 GAGAAGAGGCAGCAGGAGTCTGG + Intronic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1100764277 12:97846212-97846234 AAGAGCAGGCAGAAGGGCTCTGG - Intergenic
1101122015 12:101591978-101592000 TAGAGCAAGAAGGAGGAGTCTGG + Intronic
1101320249 12:103667249-103667271 GACAGCATCCTGAAGGACTCAGG - Intronic
1103777822 12:123379596-123379618 GAGAGCAGATAGAAGCAGTCTGG - Intergenic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1105450726 13:20496933-20496955 GAAATCATGCAAAAGTAGTCAGG + Intronic
1105594832 13:21827640-21827662 AAGAGCATCCACCAGGAGTCAGG - Intergenic
1106388514 13:29312149-29312171 GGGAGCATGGAGGAGGAGCCAGG - Intronic
1106505143 13:30364670-30364692 GAGAGCATGCAGAGGGGATAGGG - Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107965947 13:45598440-45598462 CAAAGCAAGCAGAAGGATTCTGG - Intronic
1112120147 13:96401111-96401133 GGGAGGGTGCAGAAGGAGGCTGG + Intronic
1112182929 13:97103195-97103217 GAGAGAAAGCAGGAGGTGTCAGG + Intergenic
1113964148 13:114142967-114142989 GAAAGCCTGCAGCAGGAGCCAGG - Intergenic
1115739049 14:36368075-36368097 GAAATCATGCAGAAGCAGTCTGG - Intergenic
1116150912 14:41141205-41141227 CAGAGCCTTCAGAAGGAGTATGG - Intergenic
1116185404 14:41594141-41594163 GAGAGCTAAGAGAAGGAGTCAGG + Intergenic
1116934747 14:50727991-50728013 GAGAGCCTGCAGTAGCATTCTGG + Intronic
1117335646 14:54755172-54755194 GAGATCATTTAGAGGGAGTCTGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1122011740 14:98755339-98755361 GTGATCATGCATAAGAAGTCAGG + Intergenic
1122052582 14:99070149-99070171 GTGAGCATGGAGAGAGAGTCAGG - Intergenic
1122521691 14:102348573-102348595 GAGAGCATGCTGCTGGAGACAGG - Exonic
1123435890 15:20254147-20254169 GACAGCAGGCAGAAGGACTGAGG + Intergenic
1123860443 15:24460718-24460740 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1123864073 15:24499337-24499359 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1126322676 15:47442453-47442475 GTGAGCATGAATAAGGACTCAGG - Intronic
1126466668 15:48966873-48966895 TCGAGCATGCAGTAGGAGTTAGG - Intergenic
1126489258 15:49218514-49218536 AAGAGCATGAAGAATGAGTTGGG + Intronic
1127218911 15:56856377-56856399 GAGAATATTCAGAAGGAGTGAGG - Intronic
1127376529 15:58389823-58389845 GAGAGCATGAAGAAGAATCCTGG + Intronic
1128730956 15:70020808-70020830 AAGAGCCTGCAGGAGGAGGCTGG - Intergenic
1130441384 15:83957495-83957517 GAGAGAATGAAGAAGCAGTTGGG + Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130857365 15:87852640-87852662 GAGAGCAAGGATAAAGAGTCTGG - Intergenic
1130936308 15:88473757-88473779 GAGAGCTCACAGAAGGAGGCAGG - Intronic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133345321 16:5065965-5065987 GAGGGCGTGCAGAGGCAGTCTGG - Exonic
1133409954 16:5559833-5559855 GTGAGCTTGCAGAAGTAGGCAGG - Intergenic
1134567579 16:15264659-15264681 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1134734909 16:16492011-16492033 GAGAGAAGGAAGAAGGAGACAGG + Intergenic
1134932613 16:18220208-18220230 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136360818 16:29778581-29778603 GAGAAGTTGCAGAAGGAGTCGGG - Intronic
1136848710 16:33596838-33596860 GAGAGCAGGCACAAGGACTGAGG - Intergenic
1137488892 16:48914224-48914246 GAAAGAATGCAGAAGGGCTCAGG + Intergenic
1137520780 16:49193752-49193774 GGAAGCATGCAGATGGAGGCCGG + Intergenic
1137525973 16:49236634-49236656 GAGAGTATCCAGAATCAGTCAGG + Intergenic
1137751135 16:50861874-50861896 GTGATGATGCAGAAGGAGTGGGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1139216046 16:65124238-65124260 GAGAGGATGGACAAGGGGTCCGG + Intronic
1139424494 16:66870964-66870986 GAGAACCTGCAGAAGAAGGCCGG + Intronic
1139447558 16:67007214-67007236 GAGAGCATAGAGGAGGTGTCTGG + Intronic
1139648789 16:68351365-68351387 GGGAGAGTGCAGAAAGAGTCCGG - Intronic
1140266231 16:73423525-73423547 GAAAGCCTGCTGAAGGATTCTGG + Intergenic
1141127430 16:81410791-81410813 GAGAGCATGCAGATGGTGAGTGG + Intergenic
1141127920 16:81414388-81414410 GAGACCAGGCAGAAGGAGGTTGG - Intergenic
1141305796 16:82862787-82862809 CAGATCATGCAGATGCAGTCGGG + Intronic
1141379698 16:83565250-83565272 GATGGCATCCAGTAGGAGTCTGG - Intronic
1141394452 16:83692279-83692301 AAGAGCATGGGGAGGGAGTCTGG + Intronic
1203110417 16_KI270728v1_random:1445488-1445510 GAGAGCAGGCACAAGGACTGAGG - Intergenic
1142524201 17:527165-527187 GAGAGCATGAGGAAGGCTTCAGG - Intronic
1142796786 17:2314152-2314174 TTGAGAATGCAGAAGGAGCCGGG + Intronic
1146260264 17:31416225-31416247 GAAAGCATCCTGGAGGAGTCAGG - Intronic
1146380410 17:32323378-32323400 GGGAGGATGCAGAAGGAGTCAGG + Exonic
1146688798 17:34858925-34858947 GACAGAAGTCAGAAGGAGTCAGG - Intergenic
1146969292 17:37059467-37059489 GTGAGCATGGAAAAGGACTCTGG - Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152386952 17:79980426-79980448 GGGAACATGCAGTGGGAGTCTGG + Intronic
1157394909 18:47333479-47333501 GAGAGGATGCAGAAGTGGGCAGG - Intergenic
1158152563 18:54388933-54388955 GTGAGAATGCAGAAAGAGTTGGG + Intergenic
1158159348 18:54462426-54462448 GAGTGCATGCACAGTGAGTCAGG - Intergenic
1158788414 18:60744030-60744052 GAGAGAATGTAAAAGGAGTGAGG - Intergenic
1159868868 18:73738022-73738044 GAGAGCAAGCAGCAGGACTGGGG - Intergenic
1160816525 19:1038540-1038562 GGGAGCATGGAGAGGGGGTCAGG - Exonic
1161080256 19:2307010-2307032 GAGAGGATGCAGAAGGTGTGAGG - Intronic
1161201287 19:3016236-3016258 GAGAGGTTGCAGAAGAAGTAAGG - Intronic
1161218484 19:3106559-3106581 GAGAGGTTGCAGAGGGAGGCAGG - Intronic
1162890078 19:13726447-13726469 AAGAGCCTGCAGAGGGAGTGTGG - Intergenic
1164927505 19:32141509-32141531 GAATGCTTGCAGAAGGTGTCTGG - Intergenic
1165476419 19:36033206-36033228 GTGAGCTTGGAGAAGGGGTCCGG - Intronic
1165731856 19:38151036-38151058 GAGAGGAGGCAGAAGGAATCTGG - Intronic
1166147680 19:40848646-40848668 GAGCGCATCCAGGAGGAGGCGGG - Exonic
1166151814 19:40880511-40880533 GAGCGCATCCAGGAGGAGTCGGG - Exonic
1167049857 19:47071795-47071817 GAGGGCATGGAGATGGAGCCCGG - Exonic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
1168670621 19:58238518-58238540 GAGAGCACGCAGGAGGCGTCAGG + Intronic
926500675 2:13649181-13649203 GAGAGGATGGAGAAGGAAACAGG + Intergenic
927229249 2:20803612-20803634 GAGAGCATGCAGAGGGAATCAGG - Intronic
927501463 2:23586035-23586057 GAGAGCACACAGAAGGCCTCTGG + Intronic
927612821 2:24558890-24558912 GACAGCATACAGCAGGATTCAGG - Intronic
927907620 2:26872179-26872201 GAGAGCAGGGAGCATGAGTCTGG + Intronic
929869587 2:45747055-45747077 GAGCGCACGCAAAAGGAGGCAGG - Intronic
929955114 2:46451873-46451895 GAGTGCCTGCAGGAGCAGTCAGG + Intronic
930844373 2:55885891-55885913 GAGAGAAAGCAGCATGAGTCAGG - Intronic
932295358 2:70619830-70619852 GAGAGCTTGCAGGAGGAGAGAGG + Intronic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
933938087 2:87223244-87223266 GATAGCATGCAGGAGGAGAGAGG - Intergenic
935942394 2:108254288-108254310 GAGAGCATGTGGAAGGTGTGGGG - Intronic
936355051 2:111742534-111742556 GATAGCATGCAGGAGGAGAAAGG + Intergenic
937964393 2:127491388-127491410 GAGAGCATGGAGAAAGAGAGGGG - Intronic
938263876 2:129912728-129912750 GGCAGGATGCAGCAGGAGTCCGG + Intergenic
938754747 2:134369264-134369286 GAGACCAGGAAGAGGGAGTCTGG + Intronic
938945804 2:136211018-136211040 CAGAGCTTGCAGTAGGTGTCTGG + Intergenic
939257520 2:139763814-139763836 AAGAGCAGGCAGAAGGGGTGAGG + Intergenic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940855798 2:158727813-158727835 CAGAGCTTCCAGATGGAGTCAGG - Intergenic
942065846 2:172270703-172270725 GAGGGCAAGCAGAAGCAGTGTGG - Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942853807 2:180522584-180522606 TAGAACATGCAGAAGGAATGAGG - Intergenic
942995937 2:182260354-182260376 GAGATTATGTAAAAGGAGTCAGG - Intronic
946282960 2:218679715-218679737 GAGGCCATGCAGAAGGTGTGTGG + Exonic
946308553 2:218870319-218870341 GAGAGCAGGAAGAAGGAGCTGGG - Intronic
947908575 2:233785568-233785590 GTGAGGAGGCAGAGGGAGTCAGG + Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1171287572 20:23954373-23954395 CAGAGCATGCAGGAGGAGAGTGG - Intergenic
1174280816 20:49437799-49437821 GACAGCATCCAGATGGATTCAGG - Intronic
1174469579 20:50746696-50746718 GAGAGCATTCAAATGGAGTCTGG + Intronic
1178617160 21:34144496-34144518 GAGAGCATTAGGAAGGAGGCTGG + Intergenic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1179070579 21:38067184-38067206 TAGAGCATTCAGAGGGAGTATGG - Intronic
1179732765 21:43376638-43376660 GGGAGCATGCAGGTGGAGTAGGG - Intergenic
1182080341 22:27524365-27524387 GACAGCATGCCCTAGGAGTCAGG - Intergenic
1183514925 22:38259629-38259651 CAGAGCCTCCAGAAGGAGTATGG + Intronic
1183658150 22:39202751-39202773 GAGAGCATCCAGACGCAGCCAGG + Intergenic
1184369971 22:44076031-44076053 GAGAGGATGCTGAAGGGGGCAGG + Intronic
1184894091 22:47397074-47397096 GGGAGCCTCCAGAAGGAGCCAGG - Intergenic
1185188704 22:49418925-49418947 TAGAGCCTCCAGAAGGAGTGTGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954634381 3:52063647-52063669 GAGGCCCTGCAGAAGGAGCCCGG - Intergenic
955551366 3:60088551-60088573 GAGACCTTGCTGAAGAAGTCAGG - Intronic
955756819 3:62233345-62233367 GAGAGCATGGGGAAGGAGAGGGG - Intronic
956056058 3:65300351-65300373 CAGAGCCTCCAGAAGGAGCCAGG - Intergenic
957359952 3:79142145-79142167 GTGTGCATGCAGAAGGAGTGAGG + Intronic
957624250 3:82638951-82638973 GAGAGCATGAAGAAGCAGTATGG + Intergenic
959610849 3:108293260-108293282 GAGAGCATCTAGAAGGCCTCAGG + Intergenic
961357032 3:126345800-126345822 GAGGGCCTGCAGGAGGAGACAGG + Intronic
961478143 3:127161375-127161397 GAGAGCAGACAGAAGGGGCCAGG - Intergenic
962274256 3:134000269-134000291 GAGCACATGCAGATGCAGTCAGG + Intronic
962389182 3:134957402-134957424 GAGGGGATGAAGAAGGAGTCTGG + Intronic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
963074376 3:141332690-141332712 AAGAGCCTGCAGATGGAGTGGGG + Intronic
965596156 3:170413396-170413418 GACACCATGCAGAAGAAATCAGG - Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
969523332 4:7691535-7691557 TAGAGCATGCAGAGGAACTCCGG - Intronic
970366854 4:15368250-15368272 AAAAGCATGCTGAAAGAGTCGGG - Intronic
971869721 4:32219057-32219079 GAGTGAAAGCAGAAGCAGTCAGG + Intergenic
972274335 4:37542992-37543014 GATAGCAAGCAGTAGGAATCTGG - Intronic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
977033270 4:91915712-91915734 GAGATCATGTAGAAGGAGGGAGG + Intergenic
977495614 4:97771578-97771600 GTGAGCATGTAGAAGGAATGGGG + Intronic
982497572 4:156110029-156110051 GTGAGGAGGCAGAAGGAGTTGGG + Intergenic
982745831 4:159103464-159103486 GAGGGGATGCAGCAGCAGTCGGG + Intergenic
985659689 5:1150883-1150905 GAGGGCACGCAGAAGCAGCCTGG + Intergenic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
990995711 5:61730392-61730414 GAGAGAGAGCAGAAGGTGTCAGG + Intronic
992075103 5:73184815-73184837 GAGAGCCTCCAGATGGAGTGTGG + Intergenic
992330321 5:75710498-75710520 GAGAGCATGCACAAGGTTCCTGG - Intronic
992749255 5:79847520-79847542 GAAAGCCTGCAGAAGGAAACCGG + Intergenic
992991461 5:82287926-82287948 GTGAGCATGAAGAAGCAGTGAGG + Intronic
995356553 5:111243692-111243714 GAGAGGATGAGGAAGGATTCAGG + Intronic
995915998 5:117245624-117245646 GAGAGAATGAAGAAGGAGATGGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
998077895 5:139251237-139251259 TAGAGGATGCAGAATGAATCGGG - Intronic
1001340556 5:170840268-170840290 GAGAGCATGCATCAGGACACTGG - Intergenic
1001765108 5:174239623-174239645 TAGAGCCTGCAGAAGGAGTGCGG + Intronic
1002021679 5:176367652-176367674 GAGAGCATGCTGGAAGTGTCTGG - Intronic
1002370570 5:178750017-178750039 GAGAGCATGCATTAGGACACTGG + Intergenic
1002482155 5:179509331-179509353 GAGAGCATGCATTAGGACACTGG - Intergenic
1002806085 6:575452-575474 GAGAGGATGGAGAGGGAGTGAGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1006077759 6:31545372-31545394 GGGAACTGGCAGAAGGAGTCAGG + Exonic
1006380120 6:33692460-33692482 GGAGGCCTGCAGAAGGAGTCTGG - Intronic
1007159550 6:39777959-39777981 GAGAACATGGAGAAGGTCTCAGG - Intergenic
1007972651 6:46068190-46068212 TAGAGCCTTCAGAAGGAGTGTGG + Intronic
1009035955 6:58117392-58117414 GAGCCCATGCAGGAGGAGTGTGG + Intergenic
1010345586 6:74806420-74806442 GAGATGATGTAGAAGTAGTCAGG - Intergenic
1011034697 6:82960383-82960405 GAGAGCATGAGGAAGGGGTGTGG - Intronic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1013512872 6:110859788-110859810 GTTAGCATGGAGAAGGAGTCAGG - Intronic
1014049867 6:116939179-116939201 GAGAGCGGCCAGAACGAGTCGGG + Intergenic
1015454746 6:133413930-133413952 GAGAGCATGAAAAAAGAATCAGG - Intronic
1016215274 6:141592524-141592546 AACAGCATGCATAAAGAGTCAGG - Intergenic
1017562760 6:155647793-155647815 GAGAGCATGCAGGTGGAGAAAGG - Intergenic
1017575572 6:155798651-155798673 GCAGGCATACAGAAGGAGTCAGG + Intergenic
1017781467 6:157718858-157718880 GAGAGGAGGAAGAAGGAGTTGGG - Intronic
1017824073 6:158068870-158068892 GTGAGCATAGAGAAGGAGCCAGG - Intronic
1018557464 6:165063987-165064009 GCAAGAATGCAGAAGGAGGCCGG + Intergenic
1018908535 6:168088922-168088944 GAGAGCAGGCCCAAGGAGTGGGG - Intergenic
1022345889 7:29514463-29514485 GGGAGCTTGCAGAAGGAGTGGGG - Intergenic
1022918774 7:34990998-34991020 GGGAGTATCCAGAAGGAGACAGG + Intronic
1023849459 7:44141981-44142003 GAGAGCATTCTGAAGTAGTGTGG - Intergenic
1027453141 7:78355982-78356004 GAGGGCATGAATGAGGAGTCAGG + Intronic
1029290463 7:99498733-99498755 GAGAGTGCGCAGAAGGATTCCGG - Exonic
1030362665 7:108611098-108611120 GAGAGAAAGCACAAGGATTCTGG - Intergenic
1030577096 7:111301986-111302008 GTGAGCCTGGATAAGGAGTCAGG - Intronic
1031135949 7:117884239-117884261 GTGAGCATGCAGCAGGAAGCTGG - Intergenic
1031754614 7:125622560-125622582 GAGAGCTTGTTGAAGGAGTCTGG + Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1033652688 7:143354539-143354561 CAGAGCCTGCAGCAGGAGACGGG + Exonic
1034461315 7:151199513-151199535 GAGAGCAGGCCGAAAGAGGCAGG - Intronic
1034564110 7:151899738-151899760 GTGGGCATGCAGAAGGAATGAGG - Intergenic
1035463108 7:159058096-159058118 AAGAGCATGAAGGTGGAGTCAGG - Intronic
1035544280 8:467693-467715 GAGATCATGAAGAAAGAATCAGG - Intronic
1036608224 8:10327015-10327037 AAGAGCTGGCAGAAGGAGCCAGG - Intronic
1036943337 8:13071678-13071700 AAGCGCCTGCAGAAGGAGGCAGG - Intergenic
1037583611 8:20261546-20261568 GGGAGAATGCAGAAGGGGGCTGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037823593 8:22147663-22147685 GTGAGCATGCAGACGGGGTGGGG + Exonic
1040677337 8:49766184-49766206 TAGAGGGTGCAGAAGAAGTCAGG + Intergenic
1041702469 8:60806665-60806687 GAAATCATCAAGAAGGAGTCTGG - Intronic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042156519 8:65850052-65850074 TAGAGCATTCAGAGGGAGCCTGG + Intergenic
1043305921 8:78795023-78795045 GAGAGCATGGACAAAGATTCTGG + Intronic
1044693967 8:94904749-94904771 GAGGGCATGAAAAAGGAGCCTGG - Intronic
1045085437 8:98677861-98677883 AAGAGGTTGCAGAAGGAGTCAGG + Intronic
1045573422 8:103393402-103393424 GTGGGCATACAGAGGGAGTCAGG - Intergenic
1047372443 8:124267103-124267125 GAGAGGGTGCAGAGGGAATCTGG - Intergenic
1048045186 8:130766397-130766419 GTGAGGATGCAGGAGGAGTCAGG + Intergenic
1049405616 8:142450683-142450705 GAGGGCTTCGAGAAGGAGTCTGG - Intronic
1049496746 8:142939201-142939223 GGGAGCCTGCAGGAAGAGTCCGG - Intergenic
1050730043 9:8698709-8698731 GAGAGCATACAGAAATACTCCGG + Intronic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051365948 9:16321588-16321610 GAGAGCAGGCAGAGTGAGTGGGG + Intergenic
1052842464 9:33304414-33304436 GAGAGCATGCAGAAACAAACAGG - Intronic
1056543844 9:87596647-87596669 GAGAGCATGGGAAAGGAGTGAGG - Intronic
1056886370 9:90447815-90447837 AAGAGCTGGCAGAAGGACTCAGG + Intergenic
1057540203 9:95960630-95960652 TAGAGCCTCCAGAAGGAGTGTGG + Intronic
1058840633 9:108904638-108904660 GAGATCATGCAGGTGGAGCCAGG - Intronic
1059397736 9:114048980-114049002 GTGAGGATGTAGCAGGAGTCAGG - Exonic
1060700429 9:125746395-125746417 AAAAGCATGGAGCAGGAGTCGGG + Intergenic
1062189776 9:135242083-135242105 GGGAGCAGGCAGCAGGAGTGTGG - Intergenic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1189367863 X:40403040-40403062 GAGACCATGCAGATGAAGTGCGG + Intergenic
1190066062 X:47242523-47242545 GTGAGACTGCAGAAGGAGGCTGG + Intronic
1190284042 X:48950428-48950450 GAGAGCTTCCAGAAGGAGTGTGG + Intronic
1191108426 X:56786990-56787012 TAGAGCATCCAGAAGGAGAACGG - Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1192278858 X:69662677-69662699 TAGAGCACTCAGAAGAAGTCAGG + Intronic
1192451695 X:71248854-71248876 GAGAGCACACAGAAGGTGTAAGG + Intronic
1193998419 X:88395431-88395453 GAAAGCATGGAGAAGGAACCTGG - Intergenic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1195329603 X:103786312-103786334 GAAAGCATGCAGGAGGAACCTGG + Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1198438703 X:136640989-136641011 GGGAGCATGCAGAAGGAGTGAGG - Intergenic
1198501496 X:137253604-137253626 GAGAGCATGAGAAAGGAGTTAGG - Intergenic
1199019992 X:142868173-142868195 GAGAGCATGCAGATGGACTGGGG + Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1199840235 X:151639002-151639024 CAGACCATACAAAAGGAGTCTGG - Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic