ID: 901243448

View in Genome Browser
Species Human (GRCh38)
Location 1:7709197-7709219
Sequence AGCTGTTTATGGGGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901243442_901243448 -7 Left 901243442 1:7709181-7709203 CCCAGATTAGATTAACAGCTGTT 0: 1
1: 0
2: 2
3: 17
4: 165
Right 901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165
901243441_901243448 -4 Left 901243441 1:7709178-7709200 CCTCCCAGATTAGATTAACAGCT 0: 1
1: 0
2: 2
3: 32
4: 358
Right 901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165
901243439_901243448 -2 Left 901243439 1:7709176-7709198 CCCCTCCCAGATTAGATTAACAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165
901243443_901243448 -8 Left 901243443 1:7709182-7709204 CCAGATTAGATTAACAGCTGTTT 0: 1
1: 0
2: 2
3: 28
4: 195
Right 901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165
901243440_901243448 -3 Left 901243440 1:7709177-7709199 CCCTCCCAGATTAGATTAACAGC 0: 1
1: 0
2: 2
3: 13
4: 216
Right 901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901243448 Original CRISPR AGCTGTTTATGGGGTGCAGA GGG Intronic
900276093 1:1829591-1829613 GGCTGTTTATGGGAACCAGAAGG - Intronic
900615564 1:3564193-3564215 AGCTGAGTCGGGGGTGCAGAAGG + Intronic
900725783 1:4215683-4215705 AGCTGGTTTTGGGCTGGAGATGG + Intergenic
901024818 1:6273627-6273649 AGCTGTTACTGGAGTGCAGAAGG - Intronic
901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG + Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
904604554 1:31691566-31691588 GGATGTTTGTGGGGTGGAGATGG - Intronic
904739241 1:32660173-32660195 ACCTATTTATTGGGTGGAGAAGG - Intronic
906913541 1:49982715-49982737 GGGTTTTTATGGGGTTCAGAGGG - Intronic
916085599 1:161266800-161266822 AGCTGTTTAAGGACTGCAGCTGG + Intronic
918731396 1:188001693-188001715 AATTATTTTTGGGGTGCAGACGG + Intergenic
920382164 1:205541469-205541491 AGGTGTTCCTGGGCTGCAGAGGG + Intergenic
1063142184 10:3265158-3265180 AGCTGTTCATGGCATGCAGTAGG - Intergenic
1063615624 10:7597504-7597526 GGGTGTCTATGGGGTACAGAGGG - Intronic
1065100067 10:22322568-22322590 AGCTTTTTGTGGAGTGAAGATGG + Intronic
1068904067 10:62302972-62302994 AGCAGGTTATGGGAGGCAGAGGG - Intergenic
1069229004 10:65982740-65982762 AGAGGTTTTTGGGGAGCAGATGG - Intronic
1072848028 10:98854566-98854588 AGCTGTTTATGTGTAGCAGTAGG - Intronic
1077187735 11:1242996-1243018 AGCTGTTCCTGGGGTGGAGGAGG - Exonic
1077188158 11:1244667-1244689 AGCTGTTCCTGGGGTGGAGGAGG - Exonic
1077188691 11:1246767-1246789 AGCTGTTCCTGGGGTGGAGGAGG - Exonic
1077189676 11:1250622-1250644 AGCTGTTCCTGGGGTGGAGGAGG - Exonic
1081326790 11:41754681-41754703 TGCTGTTTGTGGGGTACAGTGGG - Intergenic
1082963187 11:58938766-58938788 ACGTGCATATGGGGTGCAGAGGG - Intronic
1083582268 11:63832592-63832614 AGCTGTGTGTGGGGTGGAGGTGG - Intergenic
1088346866 11:108836182-108836204 AGCTTTATATGGGTTGGAGATGG + Intronic
1088529866 11:110797292-110797314 AGGTGTTTATTGGGTGCCTATGG + Intergenic
1088864668 11:113836342-113836364 AGCAGCTGATGGGGTGCTGATGG - Intronic
1090397035 11:126425721-126425743 AGCCTTTTTTGGGTTGCAGATGG - Exonic
1095965252 12:47863174-47863196 CGCTGTTTATGGGGACCAGGAGG + Intronic
1099453636 12:82838135-82838157 AGCCATTTTTGGGGTCCAGATGG + Intronic
1100613587 12:96213078-96213100 AGCTGTTTATGTGTTGTGGAAGG + Intronic
1101944951 12:109129702-109129724 AACTGCTTTTGGGGGGCAGAGGG - Intronic
1102746108 12:115250545-115250567 AGCTGTTTATGTGGTGGTTATGG - Intergenic
1104144462 12:126019188-126019210 AGATGTTTAGGAGCTGCAGAGGG + Intergenic
1105293813 13:19071506-19071528 AGCTGCTTCTGGGCAGCAGAAGG - Intergenic
1106124528 13:26889491-26889513 AGCTGTCTTTTGGGTGCAGAGGG + Intergenic
1106295228 13:28407164-28407186 AAATGTTTATGGGGCGCCGACGG - Intronic
1107566225 13:41607628-41607650 AGCTGTCTGTGGGGTGGGGAGGG + Intronic
1108937542 13:55902326-55902348 AGTAGTTCATGGGGTGCAGCTGG - Intergenic
1109012621 13:56970723-56970745 AACTGCTGATGGGGTGGAGAAGG - Intergenic
1109348481 13:61145628-61145650 AGGTTTTTATGGGCTTCAGATGG - Intergenic
1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG + Intergenic
1114919830 14:27312536-27312558 AAATCTTTATGGGGGGCAGAGGG - Intergenic
1115468965 14:33747924-33747946 AGCAGATGATGGGGTGCAGAAGG - Intronic
1115687363 14:35809827-35809849 ATCTTTATGTGGGGTGCAGATGG - Intergenic
1118473105 14:66093582-66093604 AGCTTTTTATGGGTCTCAGAGGG + Intergenic
1119162849 14:72467618-72467640 ACCTGTGAATGGGGTGCAGGGGG + Intronic
1120152336 14:81050715-81050737 ATCTATTTATGGGGTACAGTAGG + Intronic
1122386051 14:101349046-101349068 AGGTTTTTATGGGCTTCAGAAGG + Intergenic
1123409200 15:20044552-20044574 ATCTGTTTAGGGGGTGAGGAAGG + Intergenic
1123518531 15:21051260-21051282 ATCTGTTTAGGGGGTGAGGAAGG + Intergenic
1127295549 15:57605738-57605760 AGCTAGTTCTGGGTTGCAGAAGG + Intronic
1131163525 15:90125811-90125833 CGCTGTTCATGTGGGGCAGATGG + Intergenic
1137583635 16:49650679-49650701 AGCTGTTTATGAGGGTGAGAGGG - Intronic
1138903541 16:61302871-61302893 AGCACTTTGTGGGGTGGAGATGG - Intergenic
1139009591 16:62616030-62616052 AGCTGTTTAATGTGTGTAGAAGG - Intergenic
1140465185 16:75175413-75175435 ACCTGTTGATTGGGTGCATAGGG - Intergenic
1141268848 16:82521093-82521115 GGCTATTTTTGGGGGGCAGAAGG - Intergenic
1141324865 16:83046963-83046985 AGCTGTTTATGGAAATCAGATGG + Intronic
1142656268 17:1396599-1396621 ACCCGTTTTTGGGGAGCAGAGGG - Intronic
1144553334 17:16260399-16260421 AGGTTTTTATGGGCTTCAGAGGG - Intronic
1147517911 17:41139793-41139815 AGTTGTTTATGAGATGCACAAGG + Exonic
1148251561 17:46085600-46085622 AGCTATTTATGGGGTTGAGGTGG - Intronic
1148691390 17:49528933-49528955 AGGTGTTTATAGGATGAAGAAGG - Intergenic
1149521147 17:57319080-57319102 AGCTGGTGATGGGGAGCAGCCGG + Intronic
1149659425 17:58326601-58326623 AGATGTTCATGGGGTGAGGAGGG + Intronic
1151717181 17:75836842-75836864 TGCTGGTGATGGGGTGCAGGAGG + Exonic
1152452360 17:80389818-80389840 ATCTGTTTAAGGCCTGCAGAAGG - Exonic
1154027657 18:10723820-10723842 ATCTGCTTTTGGGGAGCAGAGGG - Intronic
1158292611 18:55958090-55958112 AGCTTCTTTTGGGTTGCAGATGG + Intergenic
1158640988 18:59203286-59203308 AACTGCTGATGGGGTGGAGAAGG - Intergenic
1159879599 18:73845943-73845965 AGCTCTCTATGGGGCACAGAGGG - Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160314222 18:77825411-77825433 AGATATTTTTGGGGTGGAGAAGG + Intergenic
1161628171 19:5338895-5338917 TGCTGTCCTTGGGGTGCAGAGGG - Intronic
1166353521 19:42213039-42213061 AGCTGATTCTAGGGTGCGGAAGG + Intronic
927236866 2:20882618-20882640 AGATGCTTCTGGGATGCAGACGG - Intergenic
928307156 2:30179608-30179630 AGCTTCTTCTGGGTTGCAGATGG + Intergenic
935284148 2:101548987-101549009 AAGTGTTTATGGAGTGCATATGG + Intergenic
941276153 2:163493184-163493206 ACCAGCTTATGGGGGGCAGATGG - Intergenic
942585046 2:177466307-177466329 GGGTTTTTATGGGGTTCAGAGGG + Intronic
945240155 2:207669177-207669199 AGTTGTTTAATGGGTGTAGATGG - Intergenic
947438176 2:230091287-230091309 GACTGTTTATGGGGTGGAGTGGG + Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
1169464566 20:5826174-5826196 AGCTGTTTATTGTTTGCAGATGG + Intronic
1169805496 20:9555262-9555284 AGCTCTTTACAGGGTGCACAGGG + Intronic
1170530784 20:17288723-17288745 TGCTGTCTGTGGGTTGCAGATGG - Intronic
1177184920 21:17782588-17782610 AGGTGTTTGTGGGGTACAGAGGG + Intergenic
1178101073 21:29269341-29269363 AGGTGTTTATGGGGTACATGAGG + Intronic
1178382524 21:32122650-32122672 AGCTGCTTCTGGGGTACAGAGGG - Intergenic
1179559842 21:42208560-42208582 AGGTATTTATTGGGTGAAGACGG - Intronic
1181634752 22:24169374-24169396 AGCTGCCTTTGGGGTCCAGACGG + Intronic
1182581864 22:31318476-31318498 AGCTGTTTAGGAGGTGGAGACGG + Intergenic
1185305413 22:50112686-50112708 ATCTGTTTCTAGAGTGCAGAGGG - Intronic
1185309881 22:50148354-50148376 ATCTGTTTCTAGAGTGCAGAGGG - Intronic
1185338807 22:50282665-50282687 AGCTGGGTGTGGGGAGCAGAGGG + Intronic
951373872 3:21889091-21889113 AACAGTTTAGGGGATGCAGAGGG + Intronic
952657350 3:35801966-35801988 GGGTTTTTATGGGGTTCAGAAGG + Intergenic
953494693 3:43375960-43375982 ACCTTTTAATGGGGTGCAGTTGG - Intronic
953882311 3:46696919-46696941 AACTGATTTTGGGGTGCAGGGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956948799 3:74256192-74256214 AGCTTTTTCTGAGGTTCAGAGGG - Intergenic
957121814 3:76103455-76103477 AGCTGTGTATTGTGAGCAGAGGG - Intronic
957962566 3:87276729-87276751 AGCTGATTCTGGGGTATAGATGG + Intergenic
962935358 3:140075688-140075710 AGTTGTTGTTGGGATGCAGAAGG + Intronic
964303019 3:155310067-155310089 AGCTGCTAATGGGCTGCAGCGGG + Intergenic
965115061 3:164477892-164477914 AGGTTTTTATGGGCTTCAGAAGG - Intergenic
966226005 3:177598759-177598781 GTCTGTTTATGCTGTGCAGACGG + Intergenic
967473759 3:189892001-189892023 AGTGATTTATGGGGTGAAGAGGG - Intronic
972607849 4:40630362-40630384 ACTTGTTTATGGGGGGAAGAAGG - Intronic
974674902 4:65076717-65076739 AACTGCCTATGGGGTGGAGAAGG - Intergenic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
976646961 4:87396664-87396686 ACTTGTTTATGGGATGGAGATGG + Intergenic
977059187 4:92235759-92235781 AGATTTTTATGGGGTTCTGATGG + Intergenic
977637776 4:99320064-99320086 AATAGTTTTTGGGGTGCAGATGG + Intronic
982086692 4:151842815-151842837 AGCTGTGGAGAGGGTGCAGAGGG + Intergenic
982932213 4:161422942-161422964 AGCTGTTTATGGAGACCACAAGG + Intronic
984144719 4:176046257-176046279 AGGTGTTTCTGGCATGCAGAGGG + Intergenic
986062453 5:4204399-4204421 GGCTGTGAATGGGGTGCACATGG - Intergenic
986923541 5:12717538-12717560 AGGTTTTTATGGGCTTCAGAGGG - Intergenic
989646595 5:43640187-43640209 AGCTGTCTCTGGGGTGTAGAGGG + Intronic
990177635 5:53125843-53125865 AGCTATTTCTGGGTTTCAGACGG - Intergenic
992243444 5:74793682-74793704 AGTAGTTTTTGGGGAGCAGATGG - Intronic
992483752 5:77176245-77176267 AGCTGTGAATGGGGTGAAGTTGG + Intergenic
994856009 5:105119957-105119979 AGCTTTTTATTGACTGCAGATGG - Intergenic
995100578 5:108297561-108297583 AACTGTTTATTCTGTGCAGAGGG + Intronic
995298053 5:110542610-110542632 AAATCTTTATGGGGAGCAGAAGG - Intronic
995753478 5:115477337-115477359 GGCTGTTGATGTGGTGCTGATGG + Intergenic
996635401 5:125683008-125683030 ACATGTTTATGGGGTACATAGGG - Intergenic
1000267169 5:159648528-159648550 AGATGTTGATGAGGTGCAGCAGG - Intergenic
1004255041 6:14055817-14055839 ATCTGTTTGTGGGTTACAGAAGG + Intergenic
1004551515 6:16652672-16652694 GGCTGTTTTTGGGTTGCAGAAGG - Intronic
1005691962 6:28315235-28315257 GGGTCTTTATGGGCTGCAGATGG + Intergenic
1007124420 6:39413412-39413434 TTCAGTTTATGTGGTGCAGATGG + Intronic
1009357588 6:62770467-62770489 AGCTCTTTCTGGCTTGCAGATGG - Intergenic
1010009523 6:71034226-71034248 AGCTGTTTATAGGCCTCAGAGGG + Intergenic
1010308783 6:74357803-74357825 AGCTGTGTTCTGGGTGCAGAAGG - Intergenic
1010636017 6:78260229-78260251 AGCTGTTTGTGGGGTCTGGAGGG + Intergenic
1012379128 6:98599240-98599262 AGTTGTTTTGGGGGTGCAGGTGG - Intergenic
1013104769 6:107017631-107017653 AGCTGTTTATGGGTTGGGCATGG - Intergenic
1015307781 6:131729627-131729649 AGCTGTTTATGTGTTGGAGGCGG + Intronic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1017367612 6:153663303-153663325 TGGTGTTTGGGGGGTGCAGAAGG - Intergenic
1017793521 6:157822693-157822715 AGCTGTTTATGTGGTACTCAGGG + Intronic
1019120037 6:169794890-169794912 AGCTGTTGAGTGGGTGCAGGAGG + Intergenic
1020955090 7:14730564-14730586 AGTTGGATATGGGGTGCATAGGG + Intronic
1022281562 7:28916068-28916090 ACATGTTTATGGGGTACAGGGGG + Intergenic
1023219689 7:37906956-37906978 ATGTGTTTATGGTCTGCAGAAGG - Exonic
1023346838 7:39279231-39279253 AGATGTTTGCTGGGTGCAGAAGG - Intronic
1024020876 7:45367610-45367632 ATGTATTTATGGGGTGCAAATGG + Intergenic
1025947505 7:66115474-66115496 GGCTGGTTTTGGGGTGGAGAAGG + Intronic
1033911472 7:146268594-146268616 AGCTGTTTTGGTGGTGGAGATGG - Intronic
1034333706 7:150306539-150306561 AGTTGTTTATGTGGAGCAAATGG - Intronic
1034664340 7:152803351-152803373 AGTTGTTTATGTGGAGCAAATGG + Intronic
1037433198 8:18835860-18835882 AGCGGTGTATGCGGTGTAGATGG + Intronic
1037670548 8:21011727-21011749 AGCGGTGTATGGGGTGGGGAGGG - Intergenic
1042439659 8:68810843-68810865 AGGTTTTTATGGGCTTCAGAAGG + Intronic
1043781758 8:84345224-84345246 ACATGTTTATGGGGTGTAGTGGG + Intronic
1045528937 8:102965870-102965892 AGATGATTATGGGCTGCAGAGGG + Intronic
1046453132 8:114420055-114420077 AGCTGTTTATCAGATGCTGAAGG - Intergenic
1047520855 8:125594401-125594423 ACATGTGGATGGGGTGCAGAGGG - Intergenic
1047614849 8:126555949-126555971 AGCTGTGTATGGGATCCAGGAGG - Exonic
1048331970 8:133476800-133476822 AGGTTATTATGGGATGCAGAAGG + Intronic
1053443210 9:38132415-38132437 AGGTCTCTATGAGGTGCAGAGGG - Intergenic
1053527007 9:38840479-38840501 AGCTCCTTCTGGGGTGCAGGTGG + Intergenic
1054199233 9:62064910-62064932 AGCTCCTTCTGGGGTGCAGGTGG + Intergenic
1054639123 9:67523447-67523469 AGCTCCTTCTGGGGTGCAGGTGG - Intergenic
1054720997 9:68603650-68603672 AGCTGATTATGGCATACAGAAGG - Intergenic
1055768500 9:79691147-79691169 AGCTGTTGCTGTGGTCCAGAGGG - Intronic
1187430145 X:19215519-19215541 GCCTGTTTATGGGGTGAAGTGGG - Intergenic
1188304112 X:28541506-28541528 ATATATTTATGGGGTGCAGAAGG - Intergenic
1189910514 X:45806166-45806188 AGTTGAGTATGGGATGCAGAGGG - Intergenic
1193915363 X:87356566-87356588 AGCTGCTTCTGGGGTGGAGAAGG - Intergenic
1197227646 X:123969892-123969914 AGCACTTTGTGGGGTGGAGATGG - Intronic
1198984325 X:142431861-142431883 AGGTGTGTATGGGGAGCATATGG - Intergenic
1199702846 X:150397742-150397764 AGCTGGTAAGGGGGTGTAGAGGG - Intronic
1200274881 X:154722752-154722774 AGTTATTTATGGGGAGAAGAAGG + Intronic