ID: 901244171

View in Genome Browser
Species Human (GRCh38)
Location 1:7715590-7715612
Sequence CTGTGAAAGGGGGATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1286
Summary {0: 1, 1: 0, 2: 12, 3: 394, 4: 879}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901244171_901244180 19 Left 901244171 1:7715590-7715612 CCAGCCACATCCCCCTTTCACAG 0: 1
1: 0
2: 12
3: 394
4: 879
Right 901244180 1:7715632-7715654 TGCTTTTTTACGTAATCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 120
901244171_901244179 18 Left 901244171 1:7715590-7715612 CCAGCCACATCCCCCTTTCACAG 0: 1
1: 0
2: 12
3: 394
4: 879
Right 901244179 1:7715631-7715653 TTGCTTTTTTACGTAATCCAAGG 0: 1
1: 0
2: 0
3: 4
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901244171 Original CRISPR CTGTGAAAGGGGGATGTGGC TGG (reversed) Intronic
900658066 1:3769942-3769964 CTGTGGTAGGGGGTTGTGGGGGG + Intronic
901207985 1:7508239-7508261 CTGTGACAGGGGTCTGTGGAGGG - Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901398889 1:9002588-9002610 CTTGGTGAGGGGGATGTGGCAGG - Intergenic
901601633 1:10427412-10427434 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
901870629 1:12136933-12136955 CTCAGAGAGGGGGATTTGGCAGG + Intronic
902248170 1:15135533-15135555 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
902253379 1:15171109-15171131 CTGGGGGTGGGGGATGTGGCGGG - Intronic
902281675 1:15379211-15379233 CTCCGAGAGGGGGATGTGTCAGG + Intronic
902351420 1:15858284-15858306 TTGGGAAAAGGGGATGTGGGAGG - Intronic
902435727 1:16397198-16397220 CTGTGGATTGAGGATGTGGCAGG + Exonic
902968581 1:20030226-20030248 CTCGGTGAGGGGGATGTGGCAGG + Intronic
903475806 1:23618553-23618575 CTGGGCAAGGGGGATCAGGCTGG - Intronic
903746218 1:25588600-25588622 CTCAGAGAAGGGGATGTGGCAGG - Intergenic
903811792 1:26038782-26038804 CTGAGAATGGGGCATGAGGCAGG + Exonic
904269208 1:29338273-29338295 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
904272575 1:29360077-29360099 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
904395793 1:30221003-30221025 CTGTGACACAGGGGTGTGGCCGG + Intergenic
904414300 1:30346951-30346973 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
904760851 1:32803781-32803803 CTCGGAGAGGGGGATTTGGCAGG + Intronic
904797042 1:33064263-33064285 CTCAGAGAGGGGGATGTGGCAGG - Intronic
904797526 1:33068456-33068478 CTCGGAGAGGGGGATGTGGCAGG - Intronic
904831482 1:33308809-33308831 CTCAGAGAGGGGGATTTGGCAGG + Intronic
904838681 1:33356333-33356355 CTCGGAGAGGGGGATTTGGCAGG + Intronic
904930495 1:34083022-34083044 CTCGGAGAGGGGGATTTGGCAGG - Intronic
905040122 1:34948705-34948727 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
905227568 1:36489165-36489187 CTCTGAGAGGGGGTTGTGGCAGG + Intergenic
905490993 1:38343641-38343663 CTGAGAAAATGGGCTGTGGCTGG + Intergenic
905628420 1:39504335-39504357 CTCAGCGAGGGGGATGTGGCAGG + Intronic
905628482 1:39504794-39504816 CTCGGTGAGGGGGATGTGGCAGG + Intronic
905762615 1:40572778-40572800 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
906151267 1:43588992-43589014 CAGTGAAAGGTGAGTGTGGCAGG + Exonic
906356159 1:45107165-45107187 CTCAGAGAGGGGGATGTGGCAGG - Intronic
906402352 1:45514254-45514276 CTCGGAGAGGGGGATGTGGCAGG - Intronic
906404225 1:45528852-45528874 CTCGGAGAGGGGGATGTGTCAGG - Intergenic
906432285 1:45765098-45765120 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
906498265 1:46321043-46321065 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
906499385 1:46330295-46330317 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
906508323 1:46396062-46396084 CTCGGTGAGGGGGATGTGGCAGG + Intronic
906564528 1:46789295-46789317 CTTGGAGAGGGGGATGTGGCAGG - Intronic
906998747 1:50827582-50827604 CTCGGAGAGGGGGATGTGGCAGG - Intronic
907009924 1:50953346-50953368 CTCGGAGAGGGGGATTTGGCAGG - Intronic
907046768 1:51304462-51304484 CAGAGAAAAGGGGATGAGGCTGG + Intronic
907111589 1:51931353-51931375 CTGTGACAGAGGGATGTTGGGGG - Intronic
907202965 1:52743352-52743374 CTCGGAGAGGGGGATTTGGCAGG - Intronic
907440965 1:54477977-54477999 CTGTGAAATGGAGATGAGGAAGG - Intergenic
907575032 1:55518711-55518733 CAGAGAAAGGGGGTAGTGGCTGG + Intergenic
908414928 1:63903995-63904017 TTGAGAATGGGGGATATGGCAGG + Intronic
908543153 1:65140545-65140567 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
909023757 1:70460625-70460647 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
909103426 1:71379309-71379331 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
909234062 1:73129492-73129514 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
910604328 1:89067057-89067079 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
910743507 1:90547886-90547908 CTGTAAAATGGGGCTGGGGCTGG + Intergenic
910891493 1:92025396-92025418 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
911118220 1:94268392-94268414 GTGTGCTGGGGGGATGTGGCAGG - Intronic
911473508 1:98347946-98347968 CTGTTAAAGGAGGATGTCCCAGG - Intergenic
911587273 1:99705215-99705237 GTGTGGAATGGGGATGTGGCTGG - Intergenic
911599831 1:99836015-99836037 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
911947800 1:104134939-104134961 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912301104 1:108518196-108518218 CTTGGAGAGGGGGATGTGTCAGG - Intergenic
912340176 1:108906895-108906917 CTTTGAAAGGCTGAGGTGGCAGG - Intronic
912355937 1:109054136-109054158 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
912642392 1:111359920-111359942 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
912642604 1:111361615-111361637 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
912802553 1:112729359-112729381 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
912942650 1:114058904-114058926 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
912966922 1:114243681-114243703 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
914097440 1:144555750-144555772 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
914252499 1:145933184-145933206 CCCGGAGAGGGGGATGTGGCAGG - Intergenic
914358253 1:146907433-146907455 CTCGGAGAGGAGGATGTGGCAGG + Intergenic
914374741 1:147062722-147062744 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
914393237 1:147240847-147240869 CTCAGAGAGTGGGATGTGGCAGG - Intronic
914444002 1:147734036-147734058 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
914495172 1:148189574-148189596 CTCGGAGAGGAGGATGTGGCAGG - Intergenic
914765648 1:150635663-150635685 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
914869196 1:151459039-151459061 CAATGAGAGGGGGATGGGGCCGG - Intronic
914985697 1:152455309-152455331 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
915397885 1:155599731-155599753 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
915673668 1:157511235-157511257 CTGTAAAATAGGGATGTGGCAGG + Intergenic
915992817 1:160533249-160533271 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
916005085 1:160652886-160652908 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
916010330 1:160699800-160699822 CTCCGAGAGGGGGATGTGTCAGG - Intronic
916034991 1:160913905-160913927 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
916037772 1:160936231-160936253 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
916039348 1:160949024-160949046 CTCAGAGAGGGGGACGTGGCAGG + Intronic
916048335 1:161017590-161017612 CTCTGAGAGGGGGATGTGTCAGG - Intronic
916050201 1:161030400-161030422 CTCGGAGAGGGGGATTTGGCAGG - Intronic
916092163 1:161315901-161315923 CTCGGAGAGGGGGATGTGGCAGG + Intronic
916103570 1:161413400-161413422 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
916222391 1:162457855-162457877 CTCGGAGAGGGGCATGTGGCAGG - Intergenic
916314699 1:163436390-163436412 CTGTAAAAATGGGATGTGACGGG + Intergenic
916324834 1:163545548-163545570 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
916468196 1:165093350-165093372 CTTGGTGAGGGGGATGTGGCAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916672075 1:167030376-167030398 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916756004 1:167771042-167771064 CTCGGAGAGGGGGATGTGGCAGG + Intronic
916759741 1:167805687-167805709 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
916864248 1:168838072-168838094 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
917029355 1:170671920-170671942 CTGAGAAATGGAGAAGTGGCTGG + Intronic
917291317 1:173475194-173475216 CTCGGTGAGGGGGATGTGGCAGG - Intergenic
917592098 1:176486913-176486935 ATGTGAGAGGGGGAAGTGGGTGG + Intronic
918045711 1:180939828-180939850 ATGAGAAAGGGGGAAGAGGCAGG - Intronic
918166641 1:181955423-181955445 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
918172643 1:182011695-182011717 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
918275738 1:182952776-182952798 CCGTATGAGGGGGATGTGGCGGG - Exonic
918327942 1:183427932-183427954 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
918702078 1:187617674-187617696 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
918812371 1:189139213-189139235 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
918819028 1:189226678-189226700 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
919326074 1:196108934-196108956 CTCAGAAAGGGGGATGTGGCAGG + Intergenic
919520691 1:198583665-198583687 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
919656284 1:200200490-200200512 ATAGGATAGGGGGATGTGGCAGG - Intergenic
919791426 1:201293201-201293223 CAGTGAAAGGGAGATGAGGGGGG + Intronic
920065417 1:203266174-203266196 CTCGGAGAGGGGGATTTGGCAGG + Intronic
920629226 1:207635305-207635327 CTCGGAGAGGGGGATGTGGCAGG + Intronic
920796439 1:209141957-209141979 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
922306394 1:224349262-224349284 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
922458336 1:225795634-225795656 CTCAGAGAGGGGCATGTGGCAGG + Intergenic
922645029 1:227277028-227277050 CTCGGAGAGGGGGATTTGGCAGG - Intronic
922715472 1:227868534-227868556 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
923175013 1:231454950-231454972 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
923183696 1:231549104-231549126 CTGAGAAAAGGGGATGTGGTGGG + Intronic
924634846 1:245775665-245775687 CTCGGAGAGGGGGATTTGGCAGG - Intronic
924667016 1:246083436-246083458 CTGGGAGAGCGGGATGTGGCAGG - Intronic
924764123 1:247015977-247015999 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
924954137 1:248911158-248911180 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1062964303 10:1595481-1595503 GTGTGGAGGGCGGATGTGGCAGG + Intronic
1063197369 10:3756105-3756127 TTTGGAAAGGGGGATGTGGGTGG + Intergenic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063347070 10:5321755-5321777 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1063475333 10:6323477-6323499 GTGAGAAAGGGGCATGAGGCTGG - Intergenic
1063530280 10:6824374-6824396 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1063531204 10:6832868-6832890 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1063776563 10:9272577-9272599 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1063822566 10:9855043-9855065 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1064070590 10:12225802-12225824 CTCAGAGAGGGGGATTTGGCAGG + Intronic
1064525425 10:16250757-16250779 CTTGGCAAGGGAGATGTGGCAGG - Intergenic
1064834429 10:19510007-19510029 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1065500505 10:26377084-26377106 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1065738196 10:28772612-28772634 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1066086703 10:31978691-31978713 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066115118 10:32232943-32232965 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1066140379 10:32499644-32499666 CTCTGAGAGGGGGATTTGGCAGG + Intronic
1066141074 10:32505227-32505249 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1066325474 10:34353669-34353691 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1066495646 10:35939262-35939284 CAGTGAGAGTGGGGTGTGGCAGG - Intergenic
1066646671 10:37617681-37617703 CAGTGAGAGTGGGGTGTGGCAGG + Intergenic
1067086769 10:43244339-43244361 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067100480 10:43330571-43330593 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1067129009 10:43544591-43544613 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1067145087 10:43688889-43688911 CTGGGAAAGGGGGAGGTTGCTGG + Intergenic
1067159842 10:43816501-43816523 CAGAGAATGGCGGATGTGGCTGG + Intergenic
1067912167 10:50356517-50356539 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1068536464 10:58244995-58245017 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1068673375 10:59745062-59745084 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1068967499 10:62928308-62928330 GTCGGAGAGGGGGATGTGGCAGG + Intergenic
1069184785 10:65409424-65409446 CTCGGAGAGGGGGATGTGTCAGG + Intergenic
1069674505 10:70238116-70238138 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1069951424 10:72021092-72021114 CTGTGAAATGGGGATAAAGCTGG + Intergenic
1070138248 10:73715058-73715080 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1070367230 10:75749670-75749692 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1070807354 10:79278479-79278501 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1070822660 10:79370627-79370649 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1071225238 10:83521137-83521159 CTTGGAGAGGGGGATATGGCAGG - Intergenic
1071289678 10:84179921-84179943 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1071476887 10:86032778-86032800 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1071509336 10:86251300-86251322 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1071538462 10:86455633-86455655 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1071916788 10:90301846-90301868 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1072143561 10:92612763-92612785 CTCTGAAAGCTGGATGTGGGTGG - Intronic
1072480749 10:95808764-95808786 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1072669228 10:97417032-97417054 CTCGGAGAGGGGGACGTGGCAGG + Intronic
1073238406 10:102036823-102036845 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1073298289 10:102454569-102454591 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1073974535 10:109085949-109085971 CTGTGGATTGAGGATGTGGCAGG + Intergenic
1074659453 10:115636308-115636330 CTGTGAGATAGGGATGTGGTGGG - Intronic
1074939720 10:118222945-118222967 CTCTGAAAGGTGGATGGGGAGGG + Intergenic
1075243499 10:120799268-120799290 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1075370423 10:121930129-121930151 CTCGGTGAGGGGGATGTGGCAGG + Intergenic
1075407127 10:122202700-122202722 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1075892848 10:125969667-125969689 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1075897877 10:126013671-126013693 CTGGGAAAGGGGCTTGTGTCTGG + Exonic
1076011661 10:126994361-126994383 CTCCGAGAGGGGGATTTGGCAGG + Intronic
1076459288 10:130628703-130628725 CTCAGAGAGGGGGATGTGTCAGG - Intergenic
1076930861 10:133530776-133530798 CGGTGTAAAGGGGGTGTGGCTGG + Intronic
1076932404 10:133541250-133541272 CTCAGAGAGGGGGATGCGGCAGG + Intronic
1077040304 11:518120-518142 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1077463077 11:2720686-2720708 CTGCAAAAGGGGGAAGGGGCTGG - Intronic
1077498475 11:2898089-2898111 CTGAGAAATGGGACTGTGGCTGG - Intronic
1077522523 11:3044808-3044830 CTTTGAAACAGGGATGTGGGAGG + Intronic
1077680876 11:4238531-4238553 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1077685165 11:4283968-4283990 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1077690023 11:4333961-4333983 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1077839826 11:5961701-5961723 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1078122570 11:8524269-8524291 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1078196329 11:9139973-9139995 TTGGGAAAGGGGGGTGTGGGGGG - Intronic
1078363091 11:10685198-10685220 CTTTGAAAGGAGGCTGAGGCAGG + Intronic
1078905646 11:15685856-15685878 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1079357328 11:19740514-19740536 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1080518913 11:33049516-33049538 CTTGGAGAGGGGGTTGTGGCAGG + Intronic
1080538542 11:33244529-33244551 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1080784103 11:35459336-35459358 CTGTCAAATGGGAATGTGTCAGG - Intronic
1080982966 11:37430504-37430526 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1081014564 11:37859680-37859702 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1081114666 11:39185101-39185123 CTCTGAAAGGGGGATGAAACAGG + Intergenic
1081771633 11:45653817-45653839 CTGTGAAAGAAGCATGTGCCTGG - Intronic
1082082953 11:48026305-48026327 CTGGGAAAGGGGCAGTTGGCTGG + Intronic
1082148966 11:48708009-48708031 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1082166244 11:48954887-48954909 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1082244921 11:49911136-49911158 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1082621753 11:55431743-55431765 CTCAGAGAGGGGGATGTGTCAGG - Intergenic
1082673004 11:56058401-56058423 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1082870872 11:57943233-57943255 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1082969598 11:59005503-59005525 CTCAGCAAGGGGAATGTGGCAGG - Intronic
1083120972 11:60511122-60511144 CTGGCAGAGGGGGATTTGGCAGG - Intergenic
1083203174 11:61132200-61132222 CTGGGAAAGGGGCCGGTGGCAGG + Exonic
1083285354 11:61655203-61655225 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1083372842 11:62195412-62195434 CTCTGAGAGGGGGATGTGTCAGG - Intergenic
1083388089 11:62327344-62327366 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1083392998 11:62368687-62368709 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1083543071 11:63528165-63528187 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1083680386 11:64349001-64349023 CAGTGAAAGGTGGATGCGCCCGG - Intronic
1083722427 11:64609958-64609980 ATGTGAAGGTGGAATGTGGCTGG - Intronic
1083767288 11:64847680-64847702 CTGTAAAAGGGGGTTGGGTCCGG + Intergenic
1084206457 11:67597520-67597542 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084608128 11:70184322-70184344 CTGTGAAAAGAGGAAGGGGCTGG + Intronic
1084645696 11:70456331-70456353 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1084989717 11:72910777-72910799 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1085159762 11:74329083-74329105 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1085161648 11:74353377-74353399 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1085397472 11:76213897-76213919 GTGTGAAGGGGGGATGTGGTGGG + Intergenic
1085596321 11:77813955-77813977 CTTTGAGAGGTGGAGGTGGCTGG + Intronic
1085609579 11:77934344-77934366 CTCAGAGAGGGGGATTTGGCAGG - Intronic
1085716899 11:78880407-78880429 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1085791506 11:79500769-79500791 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086491447 11:87360886-87360908 CTGGGAAATGGGTATGCGGCAGG + Intergenic
1087191118 11:95255693-95255715 CTGTGGAATGGAGAGGTGGCTGG - Intergenic
1087486950 11:98769632-98769654 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1088032264 11:105265597-105265619 CTCAGAGAGGGGAATGTGGCAGG - Intergenic
1088188194 11:107197155-107197177 CTGACAAAGGGGGTTGTGGAGGG - Intergenic
1088376384 11:109146009-109146031 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1089300762 11:117497423-117497445 CTGAGAATGGGGGCTGCGGCGGG + Intronic
1089471168 11:118721209-118721231 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1089472063 11:118729401-118729423 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1089510003 11:118991034-118991056 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1089517013 11:119039463-119039485 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1089520286 11:119058659-119058681 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1090520855 11:127477464-127477486 TTGTGGAATGGGGATGTGGGTGG - Intergenic
1090828941 11:130407573-130407595 CCGTGAGTGGGGGAAGTGGCTGG + Intronic
1091172571 11:133531640-133531662 CTGAGAAGGAGGGATGGGGCAGG + Intronic
1091263133 11:134249699-134249721 CTGTAAAAGGGGGATGGGGTGGG + Intronic
1091586307 12:1818942-1818964 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1091622240 12:2097881-2097903 CTGGGAGTGGGGGATGAGGCCGG + Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091963824 12:4721426-4721448 CTCGGAGAGGGGGATGTGTCAGG + Intronic
1092051334 12:5472761-5472783 CTGTGGCAGAGGGACGTGGCAGG + Intronic
1092059611 12:5537768-5537790 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1092142211 12:6191516-6191538 CTCGGAGAGGGGGATGTGTCAGG + Intergenic
1092437575 12:8462683-8462705 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1092455141 12:8636410-8636432 CTCGGAGAGGGGAATGTGGCAGG - Intergenic
1092570035 12:9711203-9711225 GTGTGAGATGGGGGTGTGGCTGG - Intergenic
1092645873 12:10571467-10571489 CTCGGAGAGAGGGATGTGGCAGG + Intergenic
1092722857 12:11458956-11458978 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1092849908 12:12617710-12617732 CTCAGAGAGGGGGATTTGGCAGG + Intronic
1093383149 12:18519952-18519974 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1093431748 12:19092696-19092718 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1093453669 12:19342927-19342949 CTGGGAGGGGGAGATGTGGCAGG - Intronic
1093650996 12:21645712-21645734 CTCGGAGAGGGGGATGTGGCTGG - Intronic
1095452652 12:42349448-42349470 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1095475496 12:42583295-42583317 CTGGGTAAGGTGGATGTGTCTGG + Intronic
1095774999 12:46001068-46001090 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1096044715 12:48552437-48552459 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1096706992 12:53428594-53428616 CTGTTAAATGGGGGTGTGACAGG + Intronic
1096786334 12:54019089-54019111 CTGCGAAAGGGGAATTTAGCGGG - Intronic
1096968552 12:55647795-55647817 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1097089271 12:56493236-56493258 CTCGGAGAAGGGGATGTGGCAGG + Intergenic
1097138648 12:56880170-56880192 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1097228452 12:57494548-57494570 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1097254992 12:57666280-57666302 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1097350485 12:58543361-58543383 CTCGGAGAAGGGGATGTGGCAGG + Intergenic
1097399200 12:59108974-59108996 CTCGGAGAGTGGGATGTGGCAGG - Intergenic
1097626993 12:62011701-62011723 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1097913975 12:65000632-65000654 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1098023219 12:66175668-66175690 CTCATAGAGGGGGATGTGGCAGG - Intergenic
1098130024 12:67340751-67340773 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1098332967 12:69374450-69374472 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1098411727 12:70192579-70192601 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1098654321 12:73008923-73008945 CTTGGAGAGGCGGATGTGGCAGG + Intergenic
1098680516 12:73348132-73348154 CTCGGTGAGGGGGATGTGGCAGG + Intergenic
1098773767 12:74587572-74587594 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1100048371 12:90411881-90411903 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1100276347 12:93075153-93075175 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1101170565 12:102088752-102088774 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1101183733 12:102250677-102250699 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1101520601 12:105478753-105478775 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1101780006 12:107826653-107826675 CTCAGAAACGGGGATGTGGCAGG + Intergenic
1101853243 12:108421205-108421227 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102323532 12:111958227-111958249 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1102420204 12:112797396-112797418 CAGAGAAAGGTGGATGTTGCTGG + Intronic
1102480698 12:113221403-113221425 CTGTGAAGGGGAAATGGGGCGGG + Intronic
1102656162 12:114484301-114484323 CTCCGAGAGGGGGATTTGGCAGG + Intergenic
1103045555 12:117731988-117732010 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1103092416 12:118106727-118106749 CTCCGAGAGGGGGATGTGTCAGG - Intronic
1103448216 12:121008792-121008814 TTTTGAAAGGGAGATGAGGCAGG - Intronic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1103776926 12:123372791-123372813 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1103794367 12:123493357-123493379 CTCCGAGAGGGGGATGTGTCAGG - Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104750607 12:131235895-131235917 CCGTGAGAGGGGGTTGTGTCTGG - Intergenic
1105209915 13:18251699-18251721 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1105253298 13:18720707-18720729 CTCAGAGAGGGGGTTGTGGCAGG - Intergenic
1105267489 13:18835826-18835848 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1105349177 13:19600969-19600991 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1105688677 13:22813848-22813870 CTCGGAAAGGGGAATGTGGCAGG + Intergenic
1105879568 13:24592313-24592335 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1105920269 13:24956745-24956767 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1106747491 13:32720684-32720706 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1106799600 13:33242703-33242725 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1107042931 13:35967780-35967802 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107562832 13:41572747-41572769 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1107700315 13:43040738-43040760 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1107737462 13:43415288-43415310 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1107906153 13:45062952-45062974 CTATTGAAAGGGGATGTGGCTGG - Intergenic
1108035239 13:46284468-46284490 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1108685981 13:52818787-52818809 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1108813853 13:54266992-54267014 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1110226976 13:73129873-73129895 CTGTTAAAGAAGAATGTGGCTGG + Intergenic
1110269769 13:73576160-73576182 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1110506764 13:76295765-76295787 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1111230487 13:85340165-85340187 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1111388710 13:87562377-87562399 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1112007768 13:95268774-95268796 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1112077110 13:95927706-95927728 CTCGGAGAGGGGGATTTGGCGGG + Intronic
1112250601 13:97775449-97775471 CTCGGACAGGGGGATGTGGCAGG - Intergenic
1112609932 13:100946164-100946186 CTGAGCAAGGTGGATGTGGTAGG - Intergenic
1113329270 13:109312336-109312358 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1113735713 13:112677955-112677977 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1114137404 14:19867225-19867247 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1114154499 14:20085339-20085361 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1114191666 14:20443753-20443775 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1114336783 14:21698529-21698551 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1114491885 14:23107735-23107757 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1114578835 14:23737499-23737521 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1114802483 14:25792965-25792987 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1114996863 14:28365105-28365127 CTGTGATAGGGGAGTGGGGCAGG + Intergenic
1115324758 14:32127215-32127237 CTGGGAGAGGGGGATTTGGCAGG + Intronic
1115898577 14:38118851-38118873 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1116464363 14:45214455-45214477 CTCAGAGAGGGGGATATGGCAGG - Intronic
1116502430 14:45636392-45636414 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1116729102 14:48599159-48599181 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1117000611 14:51367155-51367177 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1117026837 14:51629173-51629195 GTGAAAAAGGGAGATGTGGCTGG - Intronic
1117278102 14:54209705-54209727 CTGTGAAAGGGAGATATGCAAGG + Intergenic
1118314854 14:64719791-64719813 CCCTGAAATGGGGATGAGGCCGG + Intronic
1118640297 14:67785907-67785929 CTGGGAGAGGGTGGTGTGGCTGG + Exonic
1118935537 14:70284618-70284640 CTTGGAAATGGGAATGTGGCAGG - Intergenic
1119051693 14:71376606-71376628 CTCCGAGAGGGGGATTTGGCAGG + Intronic
1119721879 14:76897484-76897506 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1119823092 14:77635476-77635498 CTCGGAGAGGGAGATGTGGCAGG + Intergenic
1119835897 14:77748363-77748385 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1119841270 14:77794868-77794890 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1120170442 14:81243932-81243954 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1120193675 14:81461932-81461954 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1120240890 14:81948520-81948542 TTGTGAAAGACTGATGTGGCAGG - Intergenic
1120641669 14:87020876-87020898 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1120733163 14:88025085-88025107 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1120750764 14:88195845-88195867 AAGTGGCAGGGGGATGTGGCAGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121208189 14:92187088-92187110 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1121568026 14:94925316-94925338 CTAAGAAATGGGGATGGGGCAGG + Intergenic
1122232190 14:100311984-100312006 CTCGGAGAGGGGGATGTGTCAGG + Intergenic
1122293950 14:100694475-100694497 CTCTGAAGGAGGGATGGGGCGGG + Intergenic
1122987000 14:105217109-105217131 CTGAGGAAGGAGGATGTGGGTGG - Intronic
1202919304 14_KI270723v1_random:16200-16222 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1202925327 14_KI270724v1_random:18794-18816 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1123723689 15:23081915-23081937 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1124504858 15:30263937-30263959 CAGTGGAAAGGGGATGTTGCAGG - Intergenic
1124608010 15:31185362-31185384 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1124738694 15:32274698-32274720 CAGTGGAAAGGGGATGTTGCAGG + Intergenic
1125032361 15:35085496-35085518 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1125043519 15:35220583-35220605 CTGTGAAAGGGCAAAGAGGCAGG + Intronic
1125531588 15:40416901-40416923 ATGGGAAAGGGAGATGTGGCTGG + Intronic
1125817704 15:42600908-42600930 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1125861793 15:43006041-43006063 CTCCGAGAGGGGGATTTGGCAGG - Intronic
1125863057 15:43015596-43015618 CTCCGAGAGGGGGATTTGGCAGG - Intronic
1126573369 15:50173654-50173676 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1126685682 15:51246878-51246900 GTGTGAAAGAGGGATGGGCCAGG - Intronic
1126816373 15:52459203-52459225 CTCAGAGAGGGGGATTTGGCAGG + Intronic
1127023752 15:54780855-54780877 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1127088294 15:55445082-55445104 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1127192124 15:56541377-56541399 CTTAGAGTGGGGGATGTGGCAGG - Intergenic
1128130961 15:65226736-65226758 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1128194005 15:65734405-65734427 CTCCGAGAGGGGGATGTGTCAGG - Intronic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1128500376 15:68223079-68223101 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1128843584 15:70870994-70871016 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1129467305 15:75731332-75731354 CTGGGAGAGAGGGATGGGGCAGG - Intergenic
1129473433 15:75767469-75767491 CTTTGAAAGGCTGATGTGGGTGG + Intergenic
1129485816 15:75871048-75871070 CTCCGAGAGGGGGATGTGTCAGG + Intronic
1129589249 15:76900292-76900314 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1130942828 15:88524902-88524924 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1131774957 15:95784921-95784943 CTCGGAGAGGGGGACGTGGCAGG + Intergenic
1133312099 16:4855131-4855153 TAGTGAAATGGGGATGAGGCTGG + Intronic
1133437768 16:5794629-5794651 CTGTGGATGGGGGATGCAGCTGG + Intergenic
1133811882 16:9167029-9167051 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1133833764 16:9349620-9349642 CTCAGAGAGGGTGATGTGGCAGG + Intergenic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134133590 16:11665991-11666013 CTGAGAAATGGAGATGAGGCCGG - Intergenic
1134398851 16:13890148-13890170 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1134483250 16:14636335-14636357 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1134995466 16:18735204-18735226 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1135289357 16:21221986-21222008 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1136682121 16:31973927-31973949 CTGTGAAAGGCAGATTCGGCCGG + Intergenic
1137290734 16:47050336-47050358 CTTTGGAAGTGGGATGTGGGTGG + Intergenic
1137387994 16:48058578-48058600 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1137438912 16:48482478-48482500 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1138491754 16:57381174-57381196 CTGTAAAATGGGGATGAGCCTGG + Intronic
1138642017 16:58395370-58395392 CTCGCAAAGGGGGATTTGGCAGG + Intronic
1138919217 16:61506289-61506311 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1139378393 16:66515119-66515141 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1139420474 16:66846522-66846544 CTGTGAAATGGGGATCTTGCTGG + Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140511969 16:75515428-75515450 CTTTGAAAGGCCGAGGTGGCTGG + Intergenic
1140602858 16:76499600-76499622 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1141335137 16:83147512-83147534 TCGTGAAAGGAGGAAGTGGCAGG - Intronic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141799645 16:86298156-86298178 CAGTGAAAGAGGGGTGTGGGTGG - Intergenic
1142011907 16:87719620-87719642 CTCGGAGAGGGGGATTTGGCTGG - Intronic
1142111241 16:88332826-88332848 CTGTGAAACGGTGAGGAGGCTGG - Intergenic
1203141419 16_KI270728v1_random:1769698-1769720 CCCAGAGAGGGGGATGTGGCAGG - Intergenic
1142629588 17:1216128-1216150 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1143459095 17:7089089-7089111 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1143742988 17:8967259-8967281 CTGTGAAAGGGTGACGTGTGGGG - Intergenic
1144541474 17:16146249-16146271 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1144623978 17:16835088-16835110 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1144745453 17:17611122-17611144 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1144882447 17:18437628-18437650 CTCCCAGAGGGGGATGTGGCAGG - Intergenic
1145030993 17:19505152-19505174 CTTCGAGAGGGGGATGTGTCAGG + Intronic
1145053959 17:19685754-19685776 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1145087244 17:19951847-19951869 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1145149787 17:20506758-20506780 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1145896315 17:28459718-28459740 CTCGCAAAGGGGGATTTGGCAGG - Intronic
1145927358 17:28658298-28658320 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1146161726 17:30563391-30563413 CTCGGAGAGGGAGATGTGGCAGG + Exonic
1146166619 17:30594642-30594664 CTCGGCGAGGGGGATGTGGCAGG + Intergenic
1146361612 17:32180587-32180609 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1146783863 17:35701508-35701530 CTGTGAAGGAGGCATGGGGCTGG - Intronic
1147273810 17:39297978-39298000 CTTTGAAAGGCTGATGTGGGTGG - Intronic
1147546490 17:41406105-41406127 CTGTAGACGGGGGTTGTGGCTGG - Intergenic
1147729176 17:42586914-42586936 CTGTGAAAGGAGGGTGTTGAGGG + Intronic
1147838812 17:43355697-43355719 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1148085816 17:44993300-44993322 CTGTGAGATGGGGATGGGGCGGG - Intergenic
1148273666 17:46283808-46283830 CTCGGAGAGGGGGATGTGTCAGG + Intronic
1148397237 17:47318885-47318907 GTGTGAAAGGGAGATGTGTTTGG + Intronic
1148618470 17:49016911-49016933 CTGAGAAAGGGGGCGGGGGCGGG - Intronic
1148672077 17:49418857-49418879 CTCGGAGAGGGGGATGTGGTGGG + Intronic
1148848837 17:50544475-50544497 CTGAGAATGTGGGGTGTGGCGGG - Intronic
1149593153 17:57846868-57846890 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1149641972 17:58208706-58208728 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1149950079 17:60976480-60976502 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1150061651 17:62073571-62073593 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1150409393 17:64930773-64930795 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1150518365 17:65838041-65838063 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1150686739 17:67327041-67327063 CTCCGAGAGGGGGATGTGGCAGG + Intergenic
1150894485 17:69195601-69195623 CTCAGAGAGGGGGATTTGGCAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151843862 17:76637222-76637244 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1152480855 17:80551402-80551424 CTCCGAGAGGGGGATGTGTCAGG + Intronic
1152824094 17:82453241-82453263 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1152869533 17:82744724-82744746 CTCCGAGAGGGGGATGTGTCAGG + Intronic
1152873790 17:82774092-82774114 CTCAGAGAGGGGGATTTGGCAGG + Intronic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1152962898 18:90412-90434 CTCGGCAAGGGGGATGTGGCAGG + Intergenic
1153243315 18:3050368-3050390 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1153309524 18:3664484-3664506 AACTGAAAGGGTGATGTGGCTGG - Intronic
1153646794 18:7203236-7203258 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154003308 18:10505475-10505497 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1154089727 18:11345392-11345414 CTCTGAGAGGGGGATTTGGCAGG - Intergenic
1154115377 18:11609371-11609393 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1154192768 18:12244113-12244135 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1154420920 18:14225589-14225611 CTCGGAGAGGGGTATGTGGCAGG - Intergenic
1154482919 18:14854947-14854969 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1154943362 18:21137072-21137094 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1154977300 18:21471915-21471937 TTGTGAAAGTGGATTGTGGCTGG - Intronic
1155021178 18:21898256-21898278 CTTTGAAAGGAGGTGGTGGCAGG - Intergenic
1155472072 18:26202029-26202051 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
1155547131 18:26927462-26927484 CTCTGAGAGGGGGATGTGGCAGG + Intronic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155942262 18:31811247-31811269 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1156048735 18:32906777-32906799 GTGTGAAGGGAGGATGGGGCAGG - Intergenic
1156066303 18:33147410-33147432 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1156806151 18:41184614-41184636 CTCAGAGAGGCGGATGTGGCAGG - Intergenic
1157456050 18:47828885-47828907 CTCGGAGAGGGGGATGTGGCAGG - Exonic
1157777132 18:50404389-50404411 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1157778409 18:50416926-50416948 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1157857569 18:51116597-51116619 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1157885287 18:51360555-51360577 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1158568191 18:58573666-58573688 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1158647039 18:59256379-59256401 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1159324341 18:66894872-66894894 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1159336680 18:67076982-67077004 CTCTGAGAGGGGGATGTGGCAGG + Intergenic
1159412971 18:68105441-68105463 ATCAGAGAGGGGGATGTGGCAGG + Intergenic
1159477515 18:68942466-68942488 CTCAGAGAGGGGAATGTGGCAGG + Intronic
1159570201 18:70103710-70103732 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1160465346 18:79072192-79072214 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161162493 19:2768935-2768957 CGGGGAGAGGGGGAAGTGGCAGG + Intronic
1161343785 19:3757348-3757370 CTTTGAAAGGCTGATGTGGGAGG - Intronic
1161386888 19:3999399-3999421 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1161635613 19:5387030-5387052 CTGTAAAATGGGGATGTGTGTGG - Intergenic
1161818205 19:6513317-6513339 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1162096893 19:8315600-8315622 GTGTGAGAGGGGGATGTGGCAGG - Intronic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1162406556 19:10478194-10478216 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1162601960 19:11676304-11676326 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1162836192 19:13319834-13319856 CTGTAAAATGGGGATGACGCTGG - Intronic
1163633360 19:18427840-18427862 CTGTGGAAGGGGGTTGAGGGAGG + Intronic
1163674027 19:18646416-18646438 TTCTGAAAGGGGCATGAGGCCGG - Intronic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1163865640 19:19770770-19770792 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1163898863 19:20083082-20083104 CTCAGAGAGGGAGATGTGGCAGG - Intronic
1163906322 19:20152074-20152096 CTCGCAAAGGGGGATTTGGCAGG + Intergenic
1163919746 19:20277352-20277374 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1163957947 19:20661371-20661393 CGGTGAAAAGTGGCTGTGGCGGG - Intronic
1164016327 19:21258932-21258954 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1164122896 19:22284287-22284309 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1164126152 19:22321113-22321135 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1164153726 19:22575689-22575711 TTTGGAGAGGGGGATGTGGCAGG - Intergenic
1164154405 19:22581543-22581565 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1164217077 19:23160272-23160294 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1164231057 19:23289409-23289431 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1164239362 19:23369958-23369980 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1164273335 19:23693370-23693392 CTCTGAGAGGGGGATGTGTCAGG - Intergenic
1164387913 19:27793080-27793102 CTGTGAAAGGCGGACGCAGCAGG - Intergenic
1164390464 19:27815330-27815352 CTCAGAGAGGGGCATGTGGCAGG - Intergenic
1164424765 19:28131382-28131404 CTCGGAGAGGGGGATGTGTCAGG - Intergenic
1164488973 19:28689506-28689528 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
1165295168 19:34920924-34920946 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1165328841 19:35130127-35130149 CTCAGCGAGGGGGATGTGGCAGG - Intronic
1165506403 19:36233564-36233586 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1165523483 19:36332368-36332390 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1165595144 19:37006910-37006932 CTCTGAGAGGGGGATGTGTCAGG - Intergenic
1165606202 19:37106820-37106842 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1165607140 19:37115397-37115419 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1165621576 19:37252594-37252616 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1165633512 19:37321460-37321482 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1165652293 19:37501938-37501960 CTCGGAGAGGGGCATGTGGCAGG + Intergenic
1165655657 19:37529997-37530019 CTCGGTGAGGGGGATGTGGCAGG + Intronic
1165814192 19:38631328-38631350 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1165831620 19:38733465-38733487 ACATGAAAGGGGGATGTGCCTGG - Intronic
1165844241 19:38808072-38808094 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1165945028 19:39436727-39436749 CCGGGAAAGGGGGATTTGCCGGG - Intronic
1165945035 19:39436745-39436767 CTGGGAAAGGGGGATTTGCCGGG - Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166565966 19:43765680-43765702 ATGTGAAACGGGTATGTGGGTGG + Intergenic
1166611843 19:44204768-44204790 CTCCGAGAGGGGGATTTGGCAGG - Intergenic
1166619242 19:44280797-44280819 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1166659874 19:44639821-44639843 CTCGGTGAGGGGGATGTGGCAGG - Intergenic
1167336629 19:48890387-48890409 CTCCGAGAGGGGGATGTGTCAGG - Intronic
1167370455 19:49078005-49078027 CTTTAAAAGAGGGACGTGGCTGG + Intergenic
1167588681 19:50390617-50390639 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1167624955 19:50581881-50581903 CTCGGAGAGAGGGATGTGGCAGG + Intergenic
1167814678 19:51869474-51869496 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167818648 19:51906442-51906464 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167818912 19:51908385-51908407 CTCCGAGAGGGGGATGTGGCAGG + Intronic
1167820755 19:51925664-51925686 CTCGGTGAGGGGGATGTGGCAGG - Intronic
1167824343 19:51958556-51958578 CTCGGTGAGGGGGATGTGGCAGG - Intergenic
1167831538 19:52026954-52026976 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167833175 19:52043884-52043906 CTCCGAGAGGGGGATGTGGCAGG - Intronic
1167834102 19:52052467-52052489 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167867347 19:52338978-52339000 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1167876869 19:52421151-52421173 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1167883783 19:52484048-52484070 CTCAGAGAGGGGAATGTGGCAGG + Intronic
1167893239 19:52559438-52559460 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1167910469 19:52697934-52697956 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1167913039 19:52719809-52719831 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1167913708 19:52723757-52723779 CTCAGAGAGGGGGATGTGGAAGG + Intronic
1167917055 19:52749693-52749715 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1167939704 19:52936827-52936849 CTTGGAGAGGGGAATGTGGCAGG - Intronic
1167940865 19:52944781-52944803 CTCGGAGAGGGGGATGTGGAAGG + Intronic
1167951065 19:53028088-53028110 CTCAGCAAGGGGGATGTGGCAGG + Intergenic
1167997882 19:53421267-53421289 CTCCGAGAGGGGGATGTGGCGGG - Intronic
1168052412 19:53839377-53839399 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1168213386 19:54908029-54908051 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1168218602 19:54944466-54944488 CTCGGAGACGGGGATGTGGCAGG - Intronic
1168219527 19:54950476-54950498 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1168326186 19:55539619-55539641 CTGAGAAAGGGGGACGGAGCTGG + Intergenic
1168461130 19:56559531-56559553 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
1168614155 19:57824373-57824395 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1168638393 19:58013744-58013766 CTTGGCAAGGGGGATGTGGCAGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925336811 2:3104679-3104701 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
927210531 2:20636358-20636380 CTGTGAAAGGGGGATAATCCTGG + Intronic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927737072 2:25534041-25534063 CTCAGAGAGGGGGATGTGGCAGG + Intronic
927877038 2:26664911-26664933 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
928032404 2:27792728-27792750 CAGAGAAAGGGGGACTTGGCAGG - Intronic
928109609 2:28495959-28495981 CTTTGAAAGGGGGTAGTGGCGGG - Intronic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928539971 2:32275776-32275798 CTCAGAGACGGGGATGTGGCAGG + Intergenic
929064877 2:37963358-37963380 CTCGGAGAGGGGGATTTGGCAGG + Intronic
929065968 2:37976888-37976910 CTCGGAGAGGGGGATTTGGCAGG + Intronic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
929568089 2:43002265-43002287 GTGAGCAAGGGGGATATGGCAGG + Intergenic
929785078 2:44983789-44983811 CTTTGGAAGGGTGATGTGGGAGG + Intergenic
930363719 2:50412265-50412287 CTCGGAGAGGGGGATTTGGCAGG - Intronic
930786885 2:55280024-55280046 CTCGGAGAGGGGGATGTGTCAGG - Intergenic
931237489 2:60423778-60423800 CTGTAAAAAAGGGATGTGGTAGG + Intergenic
931604718 2:64041391-64041413 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
932719162 2:74124878-74124900 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
933241709 2:79929069-79929091 CTTTGACAGGGAGATGTGACAGG + Intronic
933572526 2:84030102-84030124 CTAAGAAAGAGGGATGAGGCAGG + Intergenic
933680423 2:85095040-85095062 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
933838103 2:86262051-86262073 CTCCGAGAGGGGGATGTGTCAGG - Intronic
933868207 2:86544385-86544407 CTCAAAGAGGGGGATGTGGCAGG + Intronic
933868811 2:86548229-86548251 CTCAAAGAGGGGGATGTGGCAGG + Intronic
934128868 2:88926803-88926825 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
934488971 2:94744862-94744884 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934894453 2:98101914-98101936 CTCAGAGAGGGGGATGTGGCAGG + Intronic
935180497 2:100685616-100685638 CTTGGAAAGGGGGATGTGGCAGG - Intergenic
936157315 2:110056816-110056838 CTTGGAGAGGGGGATGCGGCAGG - Intergenic
936158139 2:110063440-110063462 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
936186552 2:110308002-110308024 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
936187379 2:110314628-110314650 CTTGGAGAGGGGGATGCGGCAGG + Intergenic
936264545 2:110992686-110992708 CTTTGAAAGGGGGTTGTACCTGG + Intronic
936345731 2:111673427-111673449 CTCCGAGAGGGGGATTTGGCAGG - Intergenic
936378468 2:111963037-111963059 CTCGGAGAGGGGGATGTGGCAGG + Intronic
936487053 2:112935005-112935027 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
937011837 2:118569874-118569896 GGGTGAAAGTGGAATGTGGCTGG - Intergenic
937444614 2:121947126-121947148 GTTAGAAAGGGGGATGGGGCAGG + Intergenic
937734797 2:125276617-125276639 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
937826544 2:126373314-126373336 CTGGGAGATGGGTATGTGGCAGG - Intergenic
937905723 2:127051906-127051928 CTGTAAAAGGAGGAAGTGTCTGG + Intronic
937970127 2:127542777-127542799 CTCAGAGAAGGGGATGTGGCAGG + Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938250026 2:129807591-129807613 CTCGGAGAGGGGGATTTGGCGGG + Intergenic
938253530 2:129834265-129834287 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
938836378 2:135106706-135106728 CTCGGAGAGGGGGATTTGGCAGG - Intronic
940071611 2:149694644-149694666 CTGTGAAAGTGAAATGAGGCTGG + Intergenic
941025269 2:160449779-160449801 CTCAGAGAGGGGGATTTGGCAGG - Intronic
941822217 2:169855391-169855413 CTCGGAGAGGGGGATTTGGCAGG + Intronic
941859427 2:170263481-170263503 CTCGGAGAGGGGGATGTGGCAGG + Intronic
942362020 2:175182055-175182077 CTGTGAAATAGGACTGTGGCTGG + Exonic
943005943 2:182387371-182387393 CTGGCAGAGGGGGATTTGGCAGG - Intronic
943327767 2:186522241-186522263 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
943418282 2:187636328-187636350 CTCAGAGATGGGGATGTGGCAGG + Intergenic
943578243 2:189654435-189654457 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
943587627 2:189759799-189759821 CTCGGAGAGGGGGATTTGGCAGG + Intronic
943863335 2:192894893-192894915 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
943880972 2:193143166-193143188 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
944498190 2:200329696-200329718 GTGGGGAAGGGGGATGTGGGTGG - Intronic
944582033 2:201139753-201139775 CTCGGAGAGGGGGGTGTGGCAGG - Intronic
944722608 2:202439790-202439812 CTCGGAGAGGGGGATTTGGCAGG + Intronic
945832442 2:214803636-214803658 CTCCGAGAGGGGGATGTGTCAGG - Intronic
945864679 2:215162776-215162798 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
946077965 2:217091534-217091556 CTGTCACAGGGGAACGTGGCAGG - Intergenic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946447217 2:219750573-219750595 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
946780726 2:223191229-223191251 CTCGGAGAGGGGGATGTGGCAGG - Intronic
946880047 2:224168305-224168327 GTGTGAAAGGCAGACGTGGCTGG - Intergenic
947212686 2:227722410-227722432 CTCGGCGAGGGGGATGTGGCAGG + Intergenic
947273361 2:228363836-228363858 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
947613413 2:231538242-231538264 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
947730146 2:232423755-232423777 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
947953507 2:234168259-234168281 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
948589064 2:239037951-239037973 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
948872838 2:240812247-240812269 CTGTGGAAGGGGGCTGGGGGTGG + Intronic
949076405 2:242061498-242061520 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1168833581 20:861258-861280 CTGTGAAATGGGGATGCTGATGG - Intergenic
1169115654 20:3063789-3063811 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1169125909 20:3126461-3126483 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1169138170 20:3210092-3210114 GTGTGAAATGGGGATGATGCAGG + Intronic
1169420394 20:5454111-5454133 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1169486493 20:6038568-6038590 CAGAGAAGGGGGCATGTGGCTGG + Exonic
1169658907 20:7956951-7956973 CTTGGACAGGGGGATGTGGCAGG - Intergenic
1169781391 20:9314287-9314309 CAGTGACAAGTGGATGTGGCTGG + Intronic
1169788343 20:9384849-9384871 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171264128 20:23756479-23756501 CTCAGAGAGGGGGTTGTGGCAGG + Intergenic
1171276532 20:23860792-23860814 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1171291067 20:23983389-23983411 CTCAGAGAAGGGGATGTGGCAGG - Intergenic
1171450707 20:25234032-25234054 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1171451938 20:25241999-25242021 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1171495284 20:25550541-25550563 CTCGGTGAGGGGGATGTGGCAGG + Intronic
1171783266 20:29440490-29440512 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1171824684 20:29884213-29884235 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1171900295 20:30850110-30850132 CTCTGAGAGGGGGATGTGGTAGG + Intergenic
1172185790 20:33030256-33030278 CTGTGAGATGGGGCTGGGGCTGG + Intergenic
1172324946 20:34027113-34027135 CATTGAACGGGGGATGTGGAGGG - Intronic
1172337354 20:34128311-34128333 CTCAGCAAGGGGAATGTGGCGGG - Intergenic
1172341570 20:34162084-34162106 CTTTGGGAGGGGGATGTGGGCGG - Intergenic
1172716546 20:36968587-36968609 CTCGGCGAGGGGGATGTGGCAGG - Intergenic
1172797342 20:37550180-37550202 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1172910934 20:38408287-38408309 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1172923729 20:38511373-38511395 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1172937188 20:38628828-38628850 CTGTGAAAAGGGGTTGTGGGTGG + Intronic
1173472973 20:43337903-43337925 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1173852984 20:46230481-46230503 CTGTGAAATGGGGATGGTGCAGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174622894 20:51890147-51890169 CTGTGAAATGGGGAAGAAGCGGG + Intergenic
1175289137 20:57862078-57862100 CTGTGTTATGGGGCTGTGGCTGG + Intergenic
1175573434 20:60041377-60041399 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1176797683 21:13381630-13381652 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1176852538 21:13934291-13934313 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1177005928 21:15672235-15672257 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1177055318 21:16294350-16294372 CTGTGAAAGGGAGATTGGCCAGG - Intergenic
1177175105 21:17694410-17694432 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1177180431 21:17739086-17739108 CTAGGAAAGGGGGAGGTGGCAGG - Intergenic
1177199027 21:17932914-17932936 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1178113329 21:29392232-29392254 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1178343279 21:31804137-31804159 CCCTGAAAGGAGGAAGTGGCTGG + Intergenic
1178873026 21:36391966-36391988 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1179024237 21:37667104-37667126 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1179161259 21:38901193-38901215 CTGGGAAAGGGGGTTCAGGCAGG - Intergenic
1179444406 21:41421063-41421085 CTCCGAGAGGGGGATGTGTCAGG + Intronic
1179814537 21:43896998-43897020 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1179878417 21:44283048-44283070 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1179991569 21:44950844-44950866 CTGCGAAAGGGGGGTGTCGGGGG + Intronic
1180181481 21:46120434-46120456 ATGTGAGAGGCGGGTGTGGCCGG - Intronic
1180333072 22:11550410-11550432 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1180333660 22:11556101-11556123 CTTGGAGAGGGGTATGTGGCAGG + Intergenic
1180624631 22:17186036-17186058 CTGGGAAAGAAAGATGTGGCTGG + Intronic
1180766346 22:18347704-18347726 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1180779969 22:18514674-18514696 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1180812683 22:18771995-18772017 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1181198841 22:21206243-21206265 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1181297124 22:21848388-21848410 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1181400894 22:22649546-22649568 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1181534930 22:23536810-23536832 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1181594886 22:23907833-23907855 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1181702873 22:24630644-24630666 CTCAGAGAGGGGGATGTAGCAGG + Intergenic
1182029665 22:27147932-27147954 CTGTGAAATGGGGATGATGAGGG + Intergenic
1182082547 22:27539474-27539496 TTGGGAGAGCGGGATGTGGCTGG - Intergenic
1182563840 22:31183426-31183448 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1183087049 22:35492769-35492791 GAGTGAAAGGGCGATGTGGGTGG + Intergenic
1183165376 22:36143625-36143647 CAGTCAAAGGGGGCAGTGGCTGG - Intronic
1183627207 22:39011715-39011737 CTCAGCGAGGGGGATGTGGCAGG + Intergenic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184201518 22:42972459-42972481 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1184440654 22:44511365-44511387 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1184458793 22:44625739-44625761 CTGTAAAATGGGGATGAGGCTGG + Intergenic
1184894108 22:47397160-47397182 CTTTGAGATGGGGATGGGGCTGG - Intergenic
1185392530 22:50570356-50570378 CTGGGATTGGGGGATCTGGCTGG + Exonic
1203227964 22_KI270731v1_random:88594-88616 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
949217131 3:1583526-1583548 CTGGGAAAGGGGCCTGTGGCTGG - Intergenic
949330377 3:2916243-2916265 CTCCGAGAGGGGGATTTGGCAGG + Intronic
949342148 3:3041716-3041738 CTTTGGGAGGGGGATGTGGGAGG + Intronic
949565609 3:5242414-5242436 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
949580836 3:5386036-5386058 CTCTGAAATGGGGGTGTGGAGGG + Intergenic
949648663 3:6129161-6129183 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
949703342 3:6785004-6785026 TTATGAAAGGGGGATGTGGTCGG - Intronic
949875309 3:8622865-8622887 CTTTGAAGGAGGGAAGTGGCTGG + Intronic
950030333 3:9847856-9847878 CTCGGAGAGGGGGATGTGGCAGG + Intronic
950031049 3:9853830-9853852 CTCGGAGAGGGGGATGTGGCAGG + Intronic
950110352 3:10414713-10414735 TTGGGACAGGGCGATGTGGCTGG + Intronic
950387965 3:12674862-12674884 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
950447481 3:13046670-13046692 CTGTGGAGGGTGGATGTGGCCGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951161956 3:19434379-19434401 CTGTGTAAGGGAGATGAGGGTGG - Intronic
951264066 3:20547329-20547351 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
951290280 3:20866198-20866220 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
951514602 3:23544857-23544879 CTCCGAGAGGGGGATGTGTCAGG + Intronic
951651999 3:24960964-24960986 CTGTGAGAGGGGCCTGTGACAGG + Intergenic
952892752 3:38054147-38054169 CTCGGAGAGGGGGATTTGGCAGG - Intronic
952893894 3:38064053-38064075 CTCGGAGAGGGGGATTTGGCAGG + Intronic
953059891 3:39418493-39418515 CTCAGAGAGGGGGAGGTGGCAGG + Intergenic
953085001 3:39656590-39656612 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
953307293 3:41842091-41842113 CTCAGAGAGGGGGATGTGGCAGG - Intronic
953440041 3:42909106-42909128 CTCAGAGAGGGGGATTTGGCAGG + Intronic
953481830 3:43258498-43258520 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953796540 3:45990300-45990322 CTGTGAAAAGGGGCAGTGGGTGG + Intronic
954566819 3:51607148-51607170 CTCGGAGAGGGGGATTTGGCAGG + Intronic
955256742 3:57339330-57339352 CTCGGAGAGGGGGATGTGGCAGG - Intronic
955408933 3:58643432-58643454 CTGAGATAGGAGCATGTGGCAGG + Intronic
955669952 3:61392986-61393008 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
956803943 3:72789031-72789053 CTCGGAGAGGGGGATTTGGCAGG - Intronic
956806485 3:72818804-72818826 CTGTGAGAAGGCTATGTGGCAGG + Intronic
957082212 3:75646072-75646094 CTTTGAGAGGGGGATGTGGCAGG - Intergenic
957428489 3:80070971-80070993 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
957789408 3:84919471-84919493 CTCTCAGAGGGGGATTTGGCAGG - Intergenic
958047636 3:88304272-88304294 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
958111478 3:89152388-89152410 ATGTGAAAGGAGGTTGTGGGTGG - Intronic
958405900 3:93759694-93759716 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
958691894 3:97480272-97480294 CTCGGAGAGGGGGATTTGGCAGG + Intronic
958858777 3:99420058-99420080 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
958937499 3:100272688-100272710 CTCAGAGAGGGGGATGTGGCAGG + Intronic
958943204 3:100336517-100336539 CTCGGAGAGGGGGATGTGGCAGG + Intronic
959054287 3:101552433-101552455 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
959071250 3:101704027-101704049 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
959948528 3:112152208-112152230 CTCGGAGAGGGGGATGTGGCAGG + Intronic
959985231 3:112564273-112564295 CTCGGAGAGTGGGATGTGGCAGG + Intronic
960073697 3:113459370-113459392 CTCGGAGAGGGGGATTTGGCAGG - Intronic
960344989 3:116519911-116519933 CTCGGAGAGGGGGATTTGGCAGG - Intronic
960577693 3:119243482-119243504 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
960641319 3:119826432-119826454 TTGTGGAAGGGGCATGAGGCAGG + Intronic
960918732 3:122724691-122724713 CTTGGAGAGGGGGATGTGGCAGG + Intronic
961496148 3:127293284-127293306 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
961512543 3:127411847-127411869 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
962301153 3:134244246-134244268 CTGTGAAGGTGGCATATGGCTGG - Intronic
962334624 3:134516127-134516149 CTCGGAGAGGGGGATGTGGCAGG + Intronic
962404014 3:135084938-135084960 CTGTGAAATGGGGATAAGGAGGG - Intronic
962584399 3:136827015-136827037 CTCGGAGAGGGGGATTTGGCAGG + Intronic
962761942 3:138522235-138522257 CTCGGAGAGGGGGATTTGGCAGG - Intronic
962922198 3:139960327-139960349 CTCTGAAAGGGAAATGTGGGGGG - Intronic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963247221 3:143074329-143074351 CTCTCAGAGGGGGATTTGGCAGG - Intergenic
963468151 3:145709449-145709471 CTCTGAGAGGGGGATGTGGCAGG + Intergenic
963535495 3:146523011-146523033 CCCGGAGAGGGGGATGTGGCAGG - Intronic
964432403 3:156621145-156621167 CTGGGAGATGGGTATGTGGCAGG + Intergenic
964484976 3:157177979-157178001 CTCAGAGAGGGGGTTGTGGCAGG + Intergenic
964763900 3:160159936-160159958 GTGTGCTATGGGGATGTGGCGGG - Intergenic
964894438 3:161578538-161578560 CGGAGAAAAGGGGATGTGGGAGG - Intergenic
965302520 3:167019628-167019650 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
966073305 3:175905744-175905766 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
966351141 3:179033446-179033468 CTCGGAGAGGGGGATTTGGCAGG - Intronic
966378004 3:179316771-179316793 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
966617102 3:181925349-181925371 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
966772991 3:183520551-183520573 CTCGGTGAGGGGGATGTGGCAGG + Intronic
967127142 3:186434899-186434921 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
967179050 3:186887068-186887090 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
967179783 3:186893970-186893992 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
967418856 3:189251565-189251587 CTTAGAGAGGGGGATGTGGCAGG + Intronic
968156675 3:196386330-196386352 CTCGGAGAGGGGGATGTGGCAGG - Intronic
968221721 3:196944819-196944841 CTCGGAGAGGGGGATGTGTCAGG - Intergenic
968224180 3:196962830-196962852 CTCAGTGAGGGGGATGTGGCAGG - Intronic
968375844 4:40739-40761 CTCGGAGAGGAGGATGTGGCCGG + Intergenic
968396324 4:241975-241997 CTCAGCAAGGGGAATGTGGCAGG - Intergenic
968852606 4:3093958-3093980 CTTGGAGAGGGGGATTTGGCAGG + Intronic
969158043 4:5230484-5230506 TTGTAAAAGTGGAATGTGGCCGG - Intronic
969174110 4:5385928-5385950 CTGTGAGTGGGGGCTGTGGGTGG - Intronic
969174117 4:5385953-5385975 CTGTGAGTGGGGGCTGTGGGTGG - Intronic
969331895 4:6478627-6478649 CTGGCAAAGGGGGAGGTAGCAGG - Intronic
969384636 4:6836589-6836611 CTCGGAGAGGGGGATTTGGCAGG + Intronic
969410995 4:7028082-7028104 CTGTGATAGGTGTATGTGGGGGG - Intronic
969413278 4:7043231-7043253 CTGGGAAAGGCGGCGGTGGCCGG + Intronic
969508201 4:7601711-7601733 CTCGGAGAGGGGGATTTGGCAGG + Intronic
970440490 4:16077415-16077437 CTCAGAGAGGGGGATGTGGCAGG - Intronic
971026905 4:22597990-22598012 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
971281923 4:25248854-25248876 CTCGGAGAGGGGGATTTGGCAGG + Intronic
972624888 4:40787275-40787297 CTCGGAGAGGGGGATGTGGCAGG - Intronic
972700482 4:41490320-41490342 CTCAGAGAGGGGGATGTGGCAGG + Intronic
972938557 4:44168551-44168573 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
973263549 4:48187384-48187406 CTCAGAGAGGGGGATTTGGCAGG - Intronic
973273539 4:48285558-48285580 CCCGGAGAGGGGGATGTGGCAGG + Intergenic
973650550 4:52993347-52993369 CTCCGAGAGGGGGATTTGGCAGG - Intronic
973664230 4:53140159-53140181 CTCGGAGAGGGGGATTTGGCAGG - Intronic
974346110 4:60683455-60683477 CTGGGATAGGGGGATGGAGCAGG - Intergenic
974598011 4:64038070-64038092 CTCAGACAGGGGGATTTGGCAGG - Intergenic
974766886 4:66358951-66358973 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
974848943 4:67382319-67382341 CTTGGAGAGGGGGTTGTGGCAGG - Intergenic
974916349 4:68182834-68182856 GTCTGACAGAGGGATGTGGCCGG - Intergenic
974924598 4:68281659-68281681 TTCGGAGAGGGGGATGTGGCAGG + Intergenic
975063959 4:70038393-70038415 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
975522814 4:75318410-75318432 CTTAGAGAGGGGGATTTGGCAGG - Intergenic
975795829 4:78006607-78006629 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
976149571 4:82078534-82078556 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
976976335 4:91169151-91169173 CTCGGAGAGGGGGATGTGGCAGG - Intronic
977400406 4:96524305-96524327 CTCGGAGAGGAGGATGTGGCAGG + Intergenic
977542044 4:98329968-98329990 CTCGGAGAGGGGGATTTGGCAGG + Intronic
978014385 4:103723985-103724007 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
978156783 4:105498863-105498885 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
978527029 4:109677858-109677880 CTCGGAGAGGGGGATGTGGCAGG + Intronic
978888819 4:113797186-113797208 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
979235901 4:118399879-118399901 CTCTGAGAGGGGGATTTGGCAGG + Intergenic
979273838 4:118792844-118792866 CTCGGAGAGGGGGATTTGGCAGG - Intronic
979327523 4:119397116-119397138 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
979482979 4:121239295-121239317 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
979702643 4:123685710-123685732 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
979941950 4:126772112-126772134 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
980517305 4:133879361-133879383 CAGTGAAAGGGGGATAAGGCTGG - Intergenic
980645910 4:135642346-135642368 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
981995033 4:150964776-150964798 CTCAGAGAGGGGGATTTGGCAGG - Intronic
982205075 4:152991586-152991608 CAGGGAAAGAGGGATGTGGGGGG + Intergenic
982301971 4:153888745-153888767 CTGTAAAAGAGGGATTTGACAGG + Intergenic
982440036 4:155424431-155424453 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
982711214 4:158760265-158760287 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
982823738 4:159976687-159976709 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
983205407 4:164905708-164905730 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
983215227 4:164996437-164996459 CTCGGAGAGGGTGATGTGGCAGG - Intergenic
983215946 4:165002698-165002720 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
983613615 4:169678459-169678481 CTCGGAGAGGGGGATTTGGCAGG + Intronic
983664318 4:170165688-170165710 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
983811047 4:172062807-172062829 CTCTGATAGGGGGACTTGGCAGG - Intronic
984011803 4:174380772-174380794 CTCGGACAGGCGGATGTGGCAGG - Intergenic
984012167 4:174383781-174383803 CCCAGAGAGGGGGATGTGGCAGG - Intergenic
984013658 4:174401511-174401533 CCCGGAGAGGGGGATGTGGCAGG - Intergenic
984060488 4:174983915-174983937 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
984292595 4:177814107-177814129 CTCTGAAAGGGGAATCTGGCAGG - Intronic
984908016 4:184648464-184648486 CTGAGAATGGGGGAAGAGGCAGG + Exonic
985057849 4:186050786-186050808 CTCGGAGAGGAGGATGTGGCAGG - Intergenic
985245385 4:187975259-187975281 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
985372567 4:189301838-189301860 CTGGGAAAAGGGGGTGTGGTGGG - Intergenic
985576540 5:675856-675878 GTGTGAGAGGAGGCTGTGGCTGG - Intronic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
986130537 5:4925680-4925702 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
987490905 5:18579206-18579228 CTCTGAGAGGGGGATGTGTCAGG - Intergenic
988082092 5:26427543-26427565 ATGTTAAATGGGGATGTGGTGGG + Intergenic
988518791 5:31927899-31927921 CTGTGAAATGGGGGTATAGCTGG - Intronic
988533028 5:32041795-32041817 CTCGGAGAGGGGGATGTGGCAGG - Intronic
989071704 5:37518728-37518750 CTCGGAGAGGGGGATGTGGCAGG + Intronic
989085558 5:37672668-37672690 CTTGGCAAGGGGAATGTGGCAGG - Intronic
989575302 5:42982260-42982282 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
989583854 5:43058891-43058913 CTTGGTGAGGGGGATGTGGCAGG - Intergenic
989586406 5:43077218-43077240 CTTGGCGAGGGGGATGTGGCAGG + Intronic
989640804 5:43581172-43581194 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
989648662 5:43665275-43665297 CTCGGAGAGGGGGATTTGGCAGG + Intronic
989655652 5:43745214-43745236 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
989663333 5:43823926-43823948 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
989837362 5:46009147-46009169 CTCAGAGAGGGGGAGGTGGCAGG + Intergenic
989978131 5:50609075-50609097 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
989991592 5:50773879-50773901 CTTGGAGAGGGGGATGTGGCAGG + Intronic
990475428 5:56157745-56157767 CTCAGAGAGGGGGATGTGGCAGG - Intronic
990485691 5:56257727-56257749 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
990500961 5:56397250-56397272 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
990616887 5:57517943-57517965 CTCGGACAGGGGGATGTGGCAGG + Intergenic
990708979 5:58562535-58562557 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
990789797 5:59464538-59464560 CTCTGAGAGGGGGATGTGTCAGG - Intronic
991221858 5:64226615-64226637 CTCAGAGAGGGGGATGTGGCAGG - Intronic
991690567 5:69221138-69221160 CTCGGAGAGGGGGATGTGGCAGG - Intronic
991935086 5:71793352-71793374 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
992320662 5:75610877-75610899 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
992540797 5:77761589-77761611 CTCGGAGAGGGGGATGTGGCAGG - Intronic
993084499 5:83347685-83347707 ATGTGAGAAGGGGATGTGGGAGG - Intronic
993092074 5:83438419-83438441 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
993934879 5:93986968-93986990 CTCGGAGAGGGGGATTTGGCAGG - Intronic
994357865 5:98814661-98814683 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
994936471 5:106259368-106259390 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
995236071 5:109832215-109832237 CTCGGAGAGGGGGATTTGGCAGG + Intronic
995456911 5:112361472-112361494 CTCGGAGAGGGGGATTTGGCAGG - Intronic
996057773 5:118999649-118999671 CTGGGAGAGGGGGATTTGGCAGG - Intergenic
996071602 5:119137463-119137485 ATGTGAAAAGGGGATTTGGGAGG + Intronic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
997321476 5:132982433-132982455 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
997433405 5:133857215-133857237 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
997510471 5:134450388-134450410 GTGTGTAAGGGGGATGTAGTGGG + Intergenic
997535331 5:134616039-134616061 CTGAGACAGGAGAATGTGGCAGG + Intronic
997857726 5:137388381-137388403 CAGGGTAAGGGGTATGTGGCGGG + Intronic
997884725 5:137619980-137620002 CTGTGTGATGGGGATGAGGCTGG - Exonic
999216875 5:149942676-149942698 CTAGGTGAGGGGGATGTGGCAGG + Intronic
999295035 5:150453954-150453976 CTTGGAGAGAGGGATGTGGCAGG + Intergenic
999979163 5:156941268-156941290 CTCGGAGAGGGGGATTTGGCAGG - Intronic
999989237 5:157034200-157034222 CTCAGTGAGGGGGATGTGGCAGG + Intronic
1000103225 5:158036408-158036430 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1000411389 5:160937560-160937582 CTGGGAGATGGGTATGTGGCAGG - Intergenic
1000630089 5:163583099-163583121 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1000632374 5:163605458-163605480 GTTTAAAAGGGGGATGTGGTGGG - Intergenic
1000815799 5:165919958-165919980 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1002003767 5:176215306-176215328 CTCGGAGAGGCGGATGTGGCAGG - Intergenic
1002118767 5:176985045-176985067 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1002222604 5:177695300-177695322 CTCGGAGAGGCGGATGTGGCAGG + Intergenic
1002377508 5:178798820-178798842 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1002501413 5:179649863-179649885 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1002626046 5:180530608-180530630 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1002666291 5:180828016-180828038 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1002721983 5:181267060-181267082 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1002978214 6:2107702-2107724 CTGTGAATAGGTGATGTGGATGG - Intronic
1003066640 6:2909414-2909436 CTGAGAGAGGAGGATGTGTCAGG - Intergenic
1003333730 6:5151419-5151441 CAGTGAAAGGGAGATGGGCCAGG - Intronic
1003683209 6:8276135-8276157 CTGTGACATGGGTATATGGCGGG + Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004005741 6:11635968-11635990 CTGGGAGAGGGGGATTTGGCAGG - Intergenic
1004152633 6:13134745-13134767 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1004376385 6:15094185-15094207 CTGAGAAATGGGGATGGGGGAGG + Intergenic
1004717005 6:18227486-18227508 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1005177207 6:23060286-23060308 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1005293357 6:24400246-24400268 CCTGGAGAGGGGGATGTGGCAGG + Intergenic
1005294725 6:24414191-24414213 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1005453839 6:25999981-26000003 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1005525358 6:26642258-26642280 CTTGGTGAGGGGGATGTGGCAGG - Intronic
1005534898 6:26745420-26745442 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1005611421 6:27529412-27529434 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1005625039 6:27654341-27654363 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1005638700 6:27774654-27774676 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1005711048 6:28503069-28503091 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1005730050 6:28688131-28688153 CTCGGAGAAGGGGATGTGGCGGG - Intergenic
1005773476 6:29101863-29101885 GTGGGAATGGGGGATGTGACAGG + Exonic
1005901611 6:30221528-30221550 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1006014032 6:31066646-31066668 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1006225480 6:32532938-32532960 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1006238519 6:32657325-32657347 CTCGGAGAGGGAGATGTGGCAGG + Intergenic
1006250363 6:32778262-32778284 CTCAGAGAGGGGGATGTGTCAGG + Intergenic
1006289284 6:33122136-33122158 CTCAGTGAGGGGGATGTGGCAGG + Intergenic
1006305984 6:33219055-33219077 CTGTCAGAAGGGGAAGTGGCAGG - Intergenic
1006321609 6:33322696-33322718 CTGGGGGAGGGGGATTTGGCGGG - Intronic
1006326447 6:33357440-33357462 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1006538410 6:34719654-34719676 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1007295295 6:40816514-40816536 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
1007792287 6:44317392-44317414 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1007793480 6:44328242-44328264 CTCCGAGAGGGGGATGTGTCAGG + Intronic
1008106197 6:47443399-47443421 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1008565343 6:52762577-52762599 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1008572170 6:52826306-52826328 CTCGGAGAGGGGGATGTGACAGG - Intergenic
1008936806 6:57000524-57000546 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1008965311 6:57308978-57309000 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1009042148 6:58191386-58191408 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1009217984 6:60945618-60945640 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1009393019 6:63165159-63165181 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1009807102 6:68614087-68614109 CTGAGATAAGGGGAAGTGGCTGG - Intergenic
1009844653 6:69121047-69121069 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1009868818 6:69431830-69431852 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1009913809 6:69966722-69966744 CTCAGAGAGGGGGATTTGGCGGG - Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010271939 6:73925340-73925362 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1010300508 6:74254556-74254578 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011907718 6:92392684-92392706 ATGTGCAAGAGGGGTGTGGCTGG - Intergenic
1012458190 6:99430122-99430144 CTCCGAGAGGGGGATGTGTCAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013077312 6:106782780-106782802 CAGTGAGAGGGGGAAGTTGCTGG - Intergenic
1013087997 6:106873004-106873026 CTGTGAAAAGGGGAAGAAGCAGG + Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013555740 6:111255292-111255314 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1013921848 6:115415260-115415282 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1013955678 6:115837102-115837124 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1014396686 6:120932203-120932225 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1014463538 6:121729117-121729139 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1014518948 6:122414858-122414880 CTTTGAAAGGCCGATGTGGGCGG - Intronic
1014800786 6:125776041-125776063 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1016123505 6:140373263-140373285 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1016479766 6:144469743-144469765 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1016814474 6:148290824-148290846 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1017063571 6:150508166-150508188 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1017094965 6:150796736-150796758 CTATGAAATGGGGAAGGGGCAGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017785355 6:157752413-157752435 CTCAGACAGGGGGATGTGGCAGG + Intronic
1017855543 6:158348217-158348239 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1018024632 6:159794925-159794947 CTCTGAGAGGGGGATGTGTCAGG + Intronic
1018597715 6:165501025-165501047 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1019042311 6:169117461-169117483 AGCTGAAAGGGGGATGGGGCAGG - Intergenic
1019128231 6:169855972-169855994 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019651705 7:2162541-2162563 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1019687489 7:2389600-2389622 TTCTCAGAGGGGGATGTGGCAGG + Intergenic
1020174693 7:5872828-5872850 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1020219463 7:6223786-6223808 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020329333 7:7001969-7001991 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1021217915 7:17940233-17940255 CTGTGAAATGGGGAAGGGGCCGG - Intronic
1021747511 7:23757411-23757433 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1021995519 7:26175901-26175923 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1022102831 7:27179328-27179350 CTGCGATAGGGGGTTGTGGGAGG - Intronic
1022542842 7:31154185-31154207 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1022757235 7:33305087-33305109 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1023953870 7:44870369-44870391 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1023971162 7:44992097-44992119 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1023998745 7:45177663-45177685 ATGTGCCAGGGGGATGTGGGTGG - Intronic
1024115944 7:46193182-46193204 CTGCTAAAGGAGGATGTAGCAGG - Intergenic
1024551280 7:50564442-50564464 TTGTGAAATGGGGATGTGACTGG + Intronic
1024910865 7:54445074-54445096 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1024932177 7:54675404-54675426 CTCGGAGAGGCGGATGTGGCAGG + Intergenic
1025255142 7:57379577-57379599 CTGTGCAAAGGGCCTGTGGCAGG + Intergenic
1025745079 7:64235543-64235565 CTTTGAAAGGCCGATGTGGGTGG + Intronic
1025775289 7:64554941-64554963 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1025850923 7:65243228-65243250 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1026008613 7:66619155-66619177 CTCGCAGAGGGGGATGTGGCAGG + Intergenic
1026186297 7:68084197-68084219 ATCGGAGAGGGGGATGTGGCAGG - Intergenic
1027826861 7:83125838-83125860 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1028536108 7:91889651-91889673 CTCGGAGAGGGGTATGTGGCAGG - Intergenic
1028548385 7:92028245-92028267 CTCAGAGAGGGGGATGTGGCAGG - Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029280503 7:99432508-99432530 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1029534715 7:101150047-101150069 CTCCGAGAGGGGGATGTGGCAGG + Intergenic
1029564317 7:101325514-101325536 CAGTGAAACAGGGATATGGCTGG + Intergenic
1029963074 7:104709273-104709295 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1030329526 7:108256577-108256599 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1031779149 7:125940471-125940493 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1032129606 7:129217215-129217237 CTCGGAGCGGGGGATGTGGCAGG - Intergenic
1032179420 7:129662797-129662819 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1033090141 7:138378355-138378377 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1033185971 7:139226916-139226938 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1033212172 7:139468157-139468179 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1033349836 7:140553178-140553200 CTCCGAGAGGGGGATGTGTCAGG + Intronic
1033482004 7:141751881-141751903 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1033565755 7:142576084-142576106 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1034207738 7:149332603-149332625 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1034915020 7:155031144-155031166 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1034922594 7:155096330-155096352 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1035618542 8:1020891-1020913 GTATGAATGGGGGATGAGGCAGG - Intergenic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG + Intergenic
1037134464 8:15445358-15445380 CTCAGAGAGGGGGATTTGGCAGG + Intronic
1037791262 8:21944649-21944671 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1038340744 8:26683175-26683197 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
1038660130 8:29490049-29490071 CTGGGATTTGGGGATGTGGCAGG + Intergenic
1038957541 8:32483711-32483733 CTGAGAAGAGGGGATGTGGGTGG + Intronic
1039650724 8:39338476-39338498 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1039674827 8:39650994-39651016 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1039753054 8:40495866-40495888 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1039807536 8:41013968-41013990 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1039880974 8:41625459-41625481 CTGTGGCAGGAAGATGTGGCAGG + Intergenic
1040041179 8:42918468-42918490 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1040409363 8:47138627-47138649 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1041066404 8:54086379-54086401 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1041513014 8:58671935-58671957 CCCGGAGAGGGGGATGTGGCAGG + Intergenic
1041523210 8:58777054-58777076 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1041967608 8:63698209-63698231 CTGTAAAATGGAGATGAGGCTGG + Intergenic
1042021258 8:64372763-64372785 ATGTGAAAGGGGGGAGGGGCAGG + Intergenic
1042159600 8:65879092-65879114 CTGTTATAGGTGGATGTGGCTGG + Intergenic
1042424335 8:68629454-68629476 CTGGAAAAGGGAGATGTGGCAGG - Intronic
1042535751 8:69856494-69856516 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1042823287 8:72955244-72955266 CTTTGGAAGGCGGATGTGGGCGG - Intergenic
1042912997 8:73845660-73845682 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1043279039 8:78439511-78439533 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1043958373 8:86389198-86389220 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1044363034 8:91310437-91310459 CTGTAGAAGGGTGATTTGGCAGG + Intronic
1044581783 8:93832740-93832762 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1044637545 8:94341572-94341594 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1046334926 8:112772926-112772948 CCAGGAGAGGGGGATGTGGCAGG - Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046599360 8:116298333-116298355 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1046703812 8:117428014-117428036 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1046736151 8:117778347-117778369 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1046939593 8:119918045-119918067 CTCGGAGAGGGGGATGTGGCAGG - Intronic
1048354588 8:133642794-133642816 CTGTGGAAGGCGGAAGGGGCTGG + Intergenic
1048728823 8:137414545-137414567 CCCAGAGAGGGGGATGTGGCAGG + Intergenic
1049481494 8:142826416-142826438 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1049481979 8:142829586-142829608 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1049556967 8:143287478-143287500 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1049667065 8:143849897-143849919 CTCTGAGAGGGGGATGTGTCAGG + Intergenic
1049845072 8:144796645-144796667 CTCTGAGAGGGGGATGTGTCAGG - Intergenic
1049975860 9:861101-861123 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1050366430 9:4877801-4877823 CTCTGAAAAGGGGAGGTAGCGGG - Intronic
1050418092 9:5435271-5435293 CTTAGAGAGGGGGATGTGGCAGG - Intronic
1050535032 9:6623569-6623591 CTCTCAGAGGGGGATTTGGCAGG - Intronic
1050972466 9:11894720-11894742 CTCAGAGAGGGGGCTGTGGCAGG + Intergenic
1052236007 9:26214234-26214256 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1052259369 9:26493925-26493947 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1052279322 9:26715345-26715367 CTCAGAGAGGGAGATGTGGCAGG + Intergenic
1052338642 9:27343428-27343450 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1052771489 9:32694765-32694787 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1052871849 9:33515067-33515089 CTCGGAGAGGTGGATGTGGCAGG + Intergenic
1053081556 9:35182513-35182535 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1053360489 9:37483112-37483134 CTGTGTAACTGGGATGGGGCAGG - Intergenic
1053668818 9:40339487-40339509 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1053918617 9:42965760-42965782 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1054379954 9:64479523-64479545 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1054515793 9:66036807-66036829 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1054846132 9:69800336-69800358 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1055157902 9:73087401-73087423 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1055298106 9:74853811-74853833 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1055580342 9:77702147-77702169 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1056166996 9:83949045-83949067 CTTGGAGAGGGGGATTTGGCAGG - Intronic
1056228938 9:84525802-84525824 CTCAGAGGGGGGGATGTGGCAGG + Intergenic
1056567262 9:87785141-87785163 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1057204430 9:93162882-93162904 CTGTGAGATGGGGTTGTGACTGG + Intergenic
1057292435 9:93815255-93815277 CAGTGGAAAGGGGAAGTGGCAGG - Intergenic
1057674686 9:97129779-97129801 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1057685752 9:97232886-97232908 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1058049800 9:100393819-100393841 CTCGGCGAGGGGGATGTGGCAGG - Intergenic
1058368085 9:104234274-104234296 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1058375586 9:104317370-104317392 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1058390320 9:104489259-104489281 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1059042194 9:110826995-110827017 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1059118002 9:111616889-111616911 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1059143467 9:111876047-111876069 CTTGGAGAGAGGGATGTGGCAGG - Intergenic
1059188640 9:112302013-112302035 CTGTAACAGCGGGCTGTGGCAGG - Intronic
1059433523 9:114263645-114263667 CTGTGCAGGGGGGATGGGGGTGG + Intronic
1061182969 9:129035964-129035986 CTATGAAATAGGGATGAGGCCGG - Intergenic
1061324477 9:129855072-129855094 CAGTGAAAGGGGGATGTTGCTGG + Intronic
1061829771 9:133284171-133284193 CTCGGACAGGGTGATGTGGCAGG - Intergenic
1061831789 9:133300783-133300805 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1061955327 9:133958524-133958546 CTCCGAGAGGGGGATGTGTCAGG - Intronic
1061979460 9:134092630-134092652 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1062021768 9:134322940-134322962 CTGAGAAAGGGGGTTCGGGCTGG + Intronic
1062098478 9:134715131-134715153 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1062182377 9:135197468-135197490 CTGTGAAATGGGGATATCCCAGG + Intergenic
1062286304 9:135774013-135774035 GTGTGCAAGGGGGGTGTGTCCGG + Intronic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1062735245 9:138133716-138133738 CTCGGCAAGGGGGATGTGGCAGG - Intergenic
1203443297 Un_GL000219v1:31364-31386 CTTGGAGAGGGGGATATGGCAGG + Intergenic
1203377752 Un_KI270442v1:390566-390588 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1203514105 Un_KI270741v1:150273-150295 CTTGGAGAGGGGGATATGGCAGG + Intergenic
1203562808 Un_KI270744v1:72347-72369 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1203573384 Un_KI270744v1:153411-153433 CTCGGAGAGGAGGATGTGGCCGG - Intergenic
1185444699 X:251362-251384 CGGGGAGAGGGGGATGTGGCAGG + Intergenic
1185551776 X:987701-987723 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1185582024 X:1217111-1217133 CTGGGAAAAGGGGAAGTGGCCGG + Intergenic
1185593280 X:1292480-1292502 CTTGGCAAGGGGAATGTGGCAGG + Intronic
1186328219 X:8502847-8502869 CTCGGAGAGGGTGATGTGGCAGG - Intergenic
1186854390 X:13612088-13612110 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1187198818 X:17115205-17115227 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1187215740 X:17274947-17274969 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1187385732 X:18846689-18846711 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1188214501 X:27459493-27459515 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1188980405 X:36721923-36721945 ATGTGGAAGGGAGATCTGGCAGG - Intergenic
1189083308 X:37996251-37996273 GTGTGGAAGGGGGATCTGGCAGG - Intronic
1189220730 X:39369442-39369464 CTGTGCAAGAGGGAGGTGCCAGG - Intergenic
1189341856 X:40210566-40210588 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1189421907 X:40863607-40863629 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1189723578 X:43945962-43945984 CTTTTTAAGGGGGATCTGGCTGG + Intergenic
1189881954 X:45503299-45503321 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1190159203 X:48017792-48017814 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1190174916 X:48140020-48140042 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1190793733 X:53722425-53722447 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1190848565 X:54216239-54216261 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1190906996 X:54737340-54737362 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1190973036 X:55371242-55371264 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1191018443 X:55835411-55835433 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
1191033279 X:55997964-55997986 CTCCGAGAGGGGGATGTGTCAGG + Intergenic
1191161577 X:57335349-57335371 CCCGGAGAGGGGGATGTGGCAGG + Intronic
1191227963 X:58065522-58065544 CTCGGAGAGGGGGATGTGACAGG + Intergenic
1191679204 X:63824836-63824858 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1191828841 X:65393200-65393222 CTCAGAGAGGGGGATTTGGCAGG - Intronic
1191894076 X:65974746-65974768 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192123593 X:68479457-68479479 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1192229262 X:69253899-69253921 ATGTCAAAGGGGGAAGGGGCAGG - Intergenic
1192252338 X:69422934-69422956 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1192324954 X:70123837-70123859 CTTGGAGAGGGGGATTTGGCAGG - Intergenic
1192349840 X:70348394-70348416 CTCAGAGAGGGGGATGTGGCAGG + Intronic
1192478805 X:71467133-71467155 CTCGGAGAGGGGGATGTGGCAGG + Intronic
1192505302 X:71677490-71677512 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1192610402 X:72560515-72560537 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1192658731 X:73020903-73020925 CTCGGAGAGGGGGATGTGGCAGG + Intergenic
1192664255 X:73070491-73070513 CTCAGAGAGGGGGATATGGCAGG - Intergenic
1192794017 X:74412005-74412027 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1192885528 X:75333969-75333991 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1192892840 X:75408163-75408185 CTCGGAGAGGGGGATTTGGCAGG - Intronic
1193047285 X:77066621-77066643 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1193889898 X:87032693-87032715 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1193964850 X:87972822-87972844 CTCTGCGAGGGGGAAGTGGCAGG - Intergenic
1194141349 X:90214060-90214082 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1195763755 X:108274792-108274814 CTGTGAGAGGGCCATGTGGCTGG - Intronic
1195889099 X:109672029-109672051 CTCAGAGAGGGGGATTTGGCAGG - Intronic
1197186049 X:123588411-123588433 CTCGGAGAGGGGGATTTGGCAGG - Intergenic
1197194065 X:123680414-123680436 CTCGGAGAGGGGGATGTGGCGGG - Intronic
1197455900 X:126674878-126674900 CTGGCAGAGGGGGATTTGGCAGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1198108512 X:133483249-133483271 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1198189007 X:134285383-134285405 CTCGGAGAGGGGGATTTGGCAGG + Intergenic
1198308621 X:135406850-135406872 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1198388347 X:136148372-136148394 CTGTCCAAGGGGGATGGCGCGGG + Intronic
1198600657 X:138282096-138282118 CTTGGAGAGGGGGATTTGGCAGG + Intergenic
1198605676 X:138334239-138334261 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1198696277 X:139342114-139342136 CCCGGAGAGGGGGATGTGGCAGG + Intergenic
1199285527 X:146050282-146050304 CTCGGAAAGGGGGATTTGGCAGG - Intergenic
1199836633 X:151598863-151598885 CTTGGAGAGGGGGATTTGGCAGG + Intronic
1199896235 X:152130367-152130389 CTCAGAGAGGAGGATGTGGCAGG - Intergenic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic
1200324449 X:155223239-155223261 CTCGGAGAGGGGGATTTGGCAGG + Intronic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic
1200487104 Y:3783164-3783186 CTCGGAGAGGGGGATGTGGCAGG - Intergenic
1200777254 Y:7180607-7180629 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1200833669 Y:7712083-7712105 CTCGGAAAGGGGGATCTGGCAGG - Intergenic
1201068688 Y:10124595-10124617 CTCAGAGAGGGTGATGTGGCAGG + Intergenic
1201295916 Y:12463070-12463092 CTCAGAGAGGGGGATGTGGCAGG + Intergenic
1201335924 Y:12879505-12879527 CTCGCAAAGGGGGATTTGGCAGG - Intergenic
1201440185 Y:14000433-14000455 CTCAGAGAGGGGGATTTGGCAGG + Intergenic
1201444386 Y:14042275-14042297 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1201948403 Y:19536373-19536395 CTCAGAGAGGGGGATTTGGCAGG - Intergenic
1201962696 Y:19699673-19699695 CTCAGAGAGGAGGATGTGGCAGG + Intergenic
1202029105 Y:20553208-20553230 CTCAGAGAGGGGGATGTGGCAGG - Intergenic
1202069527 Y:20976281-20976303 CTTTGAGAGGGGGATGTGGCAGG + Intergenic