ID: 901247181

View in Genome Browser
Species Human (GRCh38)
Location 1:7741265-7741287
Sequence TGCTAGTTAGAAATGTTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901247177_901247181 20 Left 901247177 1:7741222-7741244 CCACTCGTGATATAGATAGATGT 0: 1
1: 0
2: 0
3: 0
4: 51
Right 901247181 1:7741265-7741287 TGCTAGTTAGAAATGTTGGCCGG 0: 1
1: 0
2: 2
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901247181 Original CRISPR TGCTAGTTAGAAATGTTGGC CGG Intronic
901247181 1:7741265-7741287 TGCTAGTTAGAAATGTTGGCCGG + Intronic
902569405 1:17337440-17337462 AGCTTTTAAGAAATGTTGGCTGG - Intronic
902848752 1:19135431-19135453 TCCTAGTCATAAATTTTGGCTGG - Intronic
903248130 1:22031940-22031962 ACATTGTTAGAAATGTTGGCCGG + Intergenic
903736281 1:25531677-25531699 TGCTGGTTAGAAGGGTTGGCCGG + Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
906163282 1:43667141-43667163 TTCTGGTTAGATACGTTGGCTGG + Intronic
907060699 1:51420961-51420983 TGCTAGTAAGAACTCTTGGATGG - Intronic
907374218 1:54022306-54022328 GGTTAGTTAGAACTGATGGCAGG + Intergenic
907789592 1:57648872-57648894 TGCTAATTAAAAGTGTTGGAAGG + Intronic
909809299 1:79911481-79911503 GGCTAGTTAGATATGTAGGTTGG - Intergenic
911858160 1:102908876-102908898 GTCTAGTTAGAAATACTGGCAGG + Intronic
913109375 1:115643271-115643293 TGCTAATTAGCATTGTTGACTGG - Intronic
914423724 1:147554814-147554836 AGCTAGTTGGAAGTGATGGCTGG + Intronic
915192735 1:154165490-154165512 TGCAAGTTTAACATGTTGGCTGG + Intronic
916027356 1:160845088-160845110 TGCTAGTTGGCAATTTGGGCTGG - Intronic
921011524 1:211146488-211146510 TGGTAGTCAGAAATGCTGTCAGG - Intergenic
921709830 1:218362877-218362899 TGCGGGTTAGAAATGATGACAGG + Intronic
921730637 1:218574164-218574186 TGTTAGTGAAAACTGTTGGCAGG + Intergenic
1070019175 10:72566859-72566881 TGTTTATTAGAAATGTTGGTAGG - Intronic
1070351584 10:75597735-75597757 TGATAGTTGGAATTTTTGGCAGG + Intronic
1070968596 10:80545029-80545051 TGCTAGGAAGAAAAGTAGGCAGG - Intronic
1071747304 10:88436575-88436597 TACTAGTGAGAAATGTTGCCAGG + Intronic
1073059910 10:100727426-100727448 TGCTTTATAGAATTGTTGGCCGG - Intergenic
1073438818 10:103539798-103539820 TGCAAATTAGAATTGTTGGGTGG + Intronic
1073664798 10:105519065-105519087 TGCAAATCAGAAATGTTGGGGGG - Intergenic
1079597205 11:22264615-22264637 TTCTAGTTAGAAATATCAGCTGG - Intronic
1079608596 11:22401978-22402000 TTCTATTTAGAAATGCAGGCCGG + Intergenic
1081456073 11:43224124-43224146 TGTTGGTTAGAAATGTGAGCTGG - Intergenic
1081857593 11:46313388-46313410 AGCTTGTTAGAAATGCAGGCTGG + Intronic
1084308480 11:68301922-68301944 TGCTATTAAGAATTGTGGGCTGG - Intergenic
1089501716 11:118935827-118935849 TGCTGGCCAGAGATGTTGGCAGG - Intronic
1092087861 12:5779030-5779052 TAATAATCAGAAATGTTGGCTGG - Intronic
1092616782 12:10222867-10222889 TGCTAGTTAGAAAGGTTTGGAGG + Exonic
1094142501 12:27195518-27195540 GGCATGTTAGAATTGTTGGCAGG + Intergenic
1097629477 12:62042592-62042614 TTCTAGGTAGATATGTAGGCTGG - Intronic
1098003068 12:65966006-65966028 TGCAAGTTAGGTATGTTTGCAGG + Exonic
1098137165 12:67414888-67414910 TGCTGGTTAGAAATGCTAGGTGG + Intergenic
1102215150 12:111155948-111155970 TGCTTGTTATTATTGTTGGCTGG - Intronic
1107364708 13:39657635-39657657 TGTTATTTTGAAATATTGGCTGG - Intronic
1107762607 13:43696605-43696627 TGCTAGTTAGCAATGATACCTGG + Intronic
1110912319 13:80980422-80980444 CATTAGTTAGAAATATTGGCTGG + Intergenic
1112759512 13:102678047-102678069 TGATAGTAAGAAAAGTTGGTTGG + Intronic
1121596653 14:95168526-95168548 TGCTAGTTTGGGATGTTAGCAGG - Intergenic
1121741443 14:96255050-96255072 TGTTACTTAGTAATGTAGGCGGG - Intronic
1122914011 14:104848165-104848187 TGATATTTAGTAATATTGGCCGG - Intergenic
1202836178 14_GL000009v2_random:78926-78948 TGCTGATTAGAAATGTGGTCGGG - Intergenic
1128572285 15:68742693-68742715 TCCTATTAAGAAATGCTGGCCGG + Intergenic
1128845364 15:70890020-70890042 GGATTGTTATAAATGTTGGCTGG + Intronic
1129064734 15:72892174-72892196 TCCTAGTTAAAAATGTAGGTGGG - Intergenic
1130768202 15:86894866-86894888 TTCAAGATAGAAAGGTTGGCAGG + Intronic
1131194885 15:90347798-90347820 TGCTAGTTAGAAAGGTTTGCAGG - Intergenic
1133069949 16:3239267-3239289 TGCTTTCTAGAAATGTTGGCCGG + Intergenic
1141527696 16:84622694-84622716 AGCTAGTCAGGAATGGTGGCAGG + Intergenic
1142734325 17:1885734-1885756 TGCTATTAAGAACAGTTGGCTGG - Intronic
1144262159 17:13532330-13532352 TTCTAGTTAGCAATGGTGCCAGG + Intronic
1149517648 17:57292555-57292577 TGCTTGTTAGAAATGGAGGTTGG + Intronic
1151872668 17:76847084-76847106 TTTTAGTTAAAAATTTTGGCTGG - Intergenic
1153611208 18:6887085-6887107 TGCTAGCAAGAAATGCTGTCAGG + Intronic
1156358456 18:36362512-36362534 GGCTAGTGAGAAATGTTGGCTGG + Intronic
1157022388 18:43801298-43801320 TACAAATAAGAAATGTTGGCTGG + Intergenic
1158317103 18:56223331-56223353 TACTTGTTGGAAATGTTTGCCGG + Intergenic
1158381414 18:56933958-56933980 TGCTTGTCAGAGATGTTGCCTGG + Intronic
1158750544 18:60254209-60254231 TGTTAGTTAGAAGTCTTGGTTGG - Intergenic
1162688354 19:12407166-12407188 TACAAGTTAGAAATTTGGGCTGG + Intronic
1202636459 1_KI270706v1_random:48436-48458 TGCTGATTAGAAATGTGGTCGGG + Intergenic
929123189 2:38500189-38500211 TGCTAGTTGGAATGTTTGGCTGG - Intergenic
931220974 2:60287451-60287473 TGAGAGTTAGAAATGTGGCCAGG - Intergenic
935247540 2:101232243-101232265 TTCCAATTATAAATGTTGGCGGG + Intronic
935460709 2:103330059-103330081 TGCTTTTGAGAAATATTGGCTGG + Intergenic
936817710 2:116479266-116479288 TACTAGCTTGAAATTTTGGCTGG - Intergenic
939316719 2:140560106-140560128 TTCTGGTTATAAATGTTGGGAGG - Intronic
940220182 2:151343464-151343486 TGAAAGTCAGAAATGTTAGCAGG - Intergenic
941380100 2:164782066-164782088 TGAGAATTAGAAGTGTTGGCTGG - Intronic
942001510 2:171652735-171652757 TGGTATGTAGAAATGTTGTCTGG + Intergenic
942710317 2:178827680-178827702 TGCTGGTTTGAAAGGCTGGCTGG + Intronic
942797586 2:179839946-179839968 GGCTAATGAGAAATGTTGGCGGG - Intronic
944120919 2:196239897-196239919 TGTTAGGTAGTAATGTTGGTAGG + Intronic
945916984 2:215714564-215714586 TGCCAGTCAGAAATGGTGGTGGG - Intergenic
945959471 2:216117154-216117176 TGCTCGTTAGAAATGTTTGGAGG + Intronic
1170495544 20:16920541-16920563 GGCTAGATAGATATGTTGTCTGG - Intergenic
1176863208 21:14025813-14025835 AGCTGGTTAGAAATTTAGGCTGG - Intergenic
1178222999 21:30682365-30682387 TGCTAGACAGAAATGTTGGAGGG + Intergenic
1180061876 21:45389688-45389710 TTCTAGTTAGAAAATGTGGCCGG - Intergenic
1180364411 22:11925878-11925900 TGCTGATTAGAAATGTGGTCAGG - Intergenic
1182880774 22:33731302-33731324 TTCTACTTAGAAATGCAGGCCGG - Intronic
949403621 3:3691787-3691809 TGCTATTTTTAAATGTTGGTTGG + Intergenic
950218819 3:11178906-11178928 TACTTTTTAGAGATGTTGGCAGG + Intronic
951150543 3:19284825-19284847 TGCTGATCAGAAATCTTGGCTGG + Intronic
951201297 3:19877435-19877457 TGCAATTTAGAAATTTTGGACGG - Intergenic
951207829 3:19943012-19943034 TGGTAGTGAATAATGTTGGCAGG - Intronic
952781174 3:37101059-37101081 TTCTATTAAGAAATGTTGGCTGG + Intronic
956305709 3:67822325-67822347 TGCTACTTATAAATGTTGATTGG + Intergenic
957326145 3:78697476-78697498 TGGTAGTTATAAAAATTGGCTGG - Intronic
959496165 3:107054678-107054700 CTCTAGTTAGAAAACTTGGCTGG - Intergenic
962651139 3:137493081-137493103 TGCTATATAGAAATGTTGATGGG - Intergenic
963478632 3:145839474-145839496 TCCTAGTTAGGGATGGTGGCTGG + Intergenic
964586122 3:158304216-158304238 TGCTTGCCAGAAATGTAGGCAGG + Intronic
966099089 3:176243911-176243933 TGCTAGCTAGGATTGTGGGCAGG + Intergenic
968393306 4:211073-211095 AGCTGGTTAGAAATTTAGGCTGG - Intergenic
968402273 4:308019-308041 AGCTGGTTAGAAATTTAGGCTGG + Intergenic
968410118 4:383279-383301 AGCTGGTTAGAAATTTAGGCTGG - Intronic
968421318 4:487487-487509 AGCTGGTTAGAAATTTAGGCTGG - Intronic
969051892 4:4379046-4379068 TGCTGGGAAGATATGTTGGCAGG - Intronic
969434603 4:7181071-7181093 AGCTAGCTAGAAATCATGGCTGG + Intergenic
970019641 4:11553417-11553439 TGCCCGTAAGGAATGTTGGCAGG + Intergenic
971751523 4:30655821-30655843 AGCCAGTTAGATATGTGGGCAGG + Intergenic
972979274 4:44676760-44676782 TGCTACTTTCACATGTTGGCTGG - Intronic
973089673 4:46119368-46119390 TGGTAGTTAAAAATGCAGGCAGG + Intronic
973394340 4:49580630-49580652 TGCTGATTAGAAATGTGGTCGGG - Intergenic
975425945 4:74227639-74227661 TACTAGTAAGAAATGTTGTTGGG + Intronic
977600714 4:98931251-98931273 TGCTGGTTAGAAGTGGTGTCAGG + Intergenic
984601755 4:181735999-181736021 TTCTAATAAGAAATTTTGGCCGG + Intergenic
1202763774 4_GL000008v2_random:134306-134328 TGCTGATTAGAAATGTGGTCGGG + Intergenic
990275985 5:54197449-54197471 TGCTTGTAAGAAATGTAGGCAGG - Intronic
993224457 5:85149423-85149445 TGCTAGTTGGAAATTTTGGTTGG + Intergenic
994040923 5:95259203-95259225 AGCCATTCAGAAATGTTGGCAGG - Intronic
999297883 5:150471895-150471917 AATTCGTTAGAAATGTTGGCTGG - Intergenic
999790239 5:154932859-154932881 CTCTAGTTAGAAGAGTTGGCCGG - Intronic
1003072299 6:2954674-2954696 TGCTTGGTAGAATTTTTGGCAGG + Exonic
1010402242 6:75459330-75459352 TACTAGTATGAATTGTTGGCAGG + Intronic
1012448599 6:99331535-99331557 TGGTAGTTGGAAATGTTGCTGGG + Intronic
1012794836 6:103746296-103746318 TGTTAGTTAGAAATGATGCACGG + Intergenic
1012966200 6:105676172-105676194 TTTTAGTTACAAGTGTTGGCAGG + Intergenic
1013680325 6:112518259-112518281 TGCTTGTTAAAAATTTTGTCTGG - Intergenic
1014970453 6:127808399-127808421 TTCTAAATAGAAATGTTGTCAGG - Intronic
1016406108 6:143732786-143732808 AGGTAGTAATAAATGTTGGCTGG - Intronic
1022883671 7:34619534-34619556 TGCTACATAGAAATTTTGGGAGG - Intergenic
1028151129 7:87373587-87373609 ATTTAGTTGGAAATGTTGGCAGG + Intronic
1028354034 7:89884968-89884990 TGCTACTTAGATATTATGGCAGG + Intergenic
1031097164 7:117434153-117434175 TGTAAATGAGAAATGTTGGCTGG - Intergenic
1031177798 7:118374761-118374783 CATTAGTTAGAAATATTGGCCGG + Intergenic
1032296609 7:130644763-130644785 TGCTATTAAGAAATGCTGGCCGG + Intronic
1032634718 7:133693967-133693989 AGATTGTTAGAAATGCTGGCTGG + Intronic
1033621329 7:143064399-143064421 TGGTGGTTAGAGATGTGGGCCGG - Intergenic
1034159312 7:148981070-148981092 TGTTATTTAGAAGTGTTGGCGGG - Intergenic
1037396288 8:18447325-18447347 GGATAATGAGAAATGTTGGCAGG + Intergenic
1038941234 8:32308133-32308155 TCCTAGTTAGAAATGTCCACTGG - Intronic
1041326043 8:56665649-56665671 TGCAAATTAGAAATTATGGCAGG - Intergenic
1044398513 8:91742642-91742664 TGCTGGTAAGAGAAGTTGGCTGG - Intergenic
1044720293 8:95139205-95139227 TGCATATTACAAATGTTGGCCGG + Intronic
1047388392 8:124430562-124430584 TTCTGGTTAGAAATCTGGGCAGG + Intergenic
1052020602 9:23521398-23521420 TGCTTGTTAGCAATGTTGGGGGG + Intergenic
1054782225 9:69175697-69175719 TGCCATTTAGAAATGTGGACAGG + Intronic
1058225136 9:102350932-102350954 TGTCAGTTAGAAATGAAGGCAGG - Intergenic
1058850208 9:109004489-109004511 TGTTAGTAAGAAGAGTTGGCTGG + Intronic
1203544528 Un_KI270743v1:119179-119201 TGCTGATTAGAAATGTGGTCGGG + Intergenic
1186918846 X:14254432-14254454 TTATATTTACAAATGTTGGCAGG + Intergenic
1187175684 X:16894378-16894400 TTCTAGAAAGAAATGTTGGCTGG - Intergenic
1188837079 X:34971060-34971082 TGAAAGTAGGAAATGTTGGCTGG - Intergenic
1189887779 X:45566367-45566389 TTCAAGTTAGAATTTTTGGCAGG - Intergenic
1195779768 X:108449195-108449217 TGCTACCTAGAAAAGTTGGAGGG + Intronic
1195965347 X:110425203-110425225 TAGTAGGTAGAAATGTTGCCAGG + Intronic
1198024112 X:132688043-132688065 GGATTGTCAGAAATGTTGGCTGG - Intronic
1198314643 X:135453231-135453253 TGCCAGTTTCAAATGTTGACAGG - Intergenic
1201324844 Y:12745041-12745063 TGTTAGTTTAAAATGTAGGCAGG + Intronic