ID: 901248435

View in Genome Browser
Species Human (GRCh38)
Location 1:7752705-7752727
Sequence CATGGTTACCAGCACTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901248435_901248438 2 Left 901248435 1:7752705-7752727 CCCTTGGAGTGCTGGTAACCATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 901248438 1:7752730-7752752 AGACGATGCTGTTTGAACAATGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901248435 Original CRISPR CATGGTTACCAGCACTCCAA GGG (reversed) Intronic