ID: 901248435

View in Genome Browser
Species Human (GRCh38)
Location 1:7752705-7752727
Sequence CATGGTTACCAGCACTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901248435_901248438 2 Left 901248435 1:7752705-7752727 CCCTTGGAGTGCTGGTAACCATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 901248438 1:7752730-7752752 AGACGATGCTGTTTGAACAATGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901248435 Original CRISPR CATGGTTACCAGCACTCCAA GGG (reversed) Intronic
900420199 1:2552976-2552998 CCTGGGTTCCAGCCCTCCAAGGG - Intergenic
900424232 1:2568682-2568704 CCTGGGTTCCAGCCCTCCAAGGG + Intergenic
900862429 1:5243108-5243130 CCTGGTCACCAGCCCTCGAAAGG + Intergenic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902561893 1:17282832-17282854 CATGTTCACCTGCAGTCCAAAGG - Exonic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
907848681 1:58233449-58233471 CATTGTAGACAGCACTCCAAAGG - Intronic
908987736 1:70045243-70045265 GAAAGTTACCAGCACTCCACTGG - Intronic
914792588 1:150891555-150891577 CATGTTTACAAGCTTTCCAATGG + Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915725686 1:158015414-158015436 CTTGGTTCCCAACTCTCCAATGG - Intronic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
1063126329 10:3139579-3139601 CATGGCTTCCAGCACAGCAAGGG + Intronic
1064993043 10:21273305-21273327 CTTGGAGACCAGCTCTCCAAGGG - Intergenic
1065341911 10:24715560-24715582 CTTGGTTACCAGCTTCCCAAAGG + Intronic
1071320706 10:84454166-84454188 AATGGTTACCAGCAATCCTTGGG + Intronic
1072726050 10:97814913-97814935 GATGGTTTCCATCACTCCAGAGG + Intergenic
1076037779 10:127215208-127215230 CATGGATCCCAGGACTCCTAGGG - Intronic
1076324097 10:129607708-129607730 CATGGTGAGCAGCTGTCCAAGGG - Intronic
1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG + Intronic
1077699966 11:4432143-4432165 CATGTTTCCCAGCACTGCCAGGG + Intergenic
1081776886 11:45681750-45681772 CATGGATCCCAGCACCCCCATGG - Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1088297937 11:108321381-108321403 AATGCTTTCCAGCTCTCCAATGG - Exonic
1089164366 11:116463450-116463472 CATGGTTATAAGCACTCAGAGGG + Intergenic
1092832100 12:12454286-12454308 CATGCTTACCAGCAATGCACAGG + Intronic
1094664193 12:32502102-32502124 CATGGTAACCAGCCCTCCTAAGG - Intronic
1097495651 12:60328920-60328942 AATGGGTACCAGCAATTCAACGG + Intergenic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1100791300 12:98133119-98133141 CATGGTTTACAACAGTCCAAGGG - Intergenic
1103663255 12:122539261-122539283 CATGGTAACCAAGACCCCAAAGG - Intronic
1103922942 12:124408785-124408807 GAAGGTTACAAGCACTCCAAGGG + Intronic
1111924199 13:94445710-94445732 CATGGTTACCAGCACATGCAGGG + Exonic
1122119233 14:99542983-99543005 CCTGGATCCCAGCATTCCAAAGG + Intronic
1126311690 15:47324490-47324512 CATAATTAACAGCACTCCATAGG + Intronic
1126992691 15:54400604-54400626 CAAGGTTAACATCACTACAAGGG - Intronic
1127857458 15:62964236-62964258 CATGGACACTTGCACTCCAATGG - Intergenic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1134463854 16:14455552-14455574 CAAGGTTAACAGCACTACACAGG + Intronic
1137515960 16:49144468-49144490 CATGGTTACCATGGCTCCAGGGG - Intergenic
1138852912 16:60651618-60651640 CATGGTTCCCATCACTTCTAAGG + Intergenic
1139306782 16:65993317-65993339 CATGGTTACCAGGATTCTTAGGG + Intergenic
1140382608 16:74504083-74504105 CATGGTTACAAGGACTTCATAGG - Intronic
1144339942 17:14302597-14302619 CCTGGTTACCGGAACCCCAAGGG + Intronic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1144949757 17:18987662-18987684 CATGGTTTCCCCCACCCCAAAGG + Intronic
1146404858 17:32528280-32528302 CCTTGCTACCAGCTCTCCAAAGG - Intronic
1157612826 18:48969002-48969024 CATTGCTACCCTCACTCCAAGGG - Intergenic
1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG + Intergenic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
929252350 2:39772822-39772844 CATGGGTACTTGAACTCCAAGGG + Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG + Intergenic
933628967 2:84634955-84634977 CATTGTGACCAGATCTCCAAAGG - Intronic
935165716 2:100567085-100567107 TGGGGTTACCAGCACTCCAAGGG - Intronic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1172017542 20:31886902-31886924 CCTGGTTTTCAGTACTCCAAAGG - Intronic
1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG + Intronic
1173565580 20:44036035-44036057 CATGGTTACAAGCCCTTCCAAGG - Intronic
1174932904 20:54834881-54834903 CATGGTTTCCAACCATCCAATGG + Intergenic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1178321489 21:31609532-31609554 GATGGTCAGCAGCACTCCATAGG - Intergenic
1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG + Intronic
951924370 3:27891393-27891415 CATGTTTACCAGCTTTCCAGGGG - Intergenic
956086651 3:65618292-65618314 CATGTTTACAAGCATTGCAAAGG + Intronic
960537173 3:118827059-118827081 CATGGTGACCTGCACTCAGAAGG + Intergenic
960645267 3:119873485-119873507 CCTGTTTACCTGCCCTCCAAGGG + Intronic
962022966 3:131518985-131519007 CATGGTTACTAAAACTGCAAAGG - Intergenic
967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG + Intronic
969214035 4:5708787-5708809 CGAGGTTACCAGGACCCCAAGGG + Intronic
970437697 4:16051418-16051440 AATGTTTCCCAGCACTCAAAAGG - Intronic
971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG + Intronic
976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG + Intronic
986028551 5:3873614-3873636 AATGGTTGCCAGCAATTCAAGGG + Intergenic
991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG + Intergenic
993426978 5:87777457-87777479 CATGGTCACCAGCTATCAAATGG - Intergenic
994411995 5:99418286-99418308 CCTGGTTACCAGCATTGCAGTGG - Intergenic
995182444 5:109241428-109241450 CATCATTAGCAGCACTACAAGGG - Intergenic
997527849 5:134564841-134564863 CAGAGTTCTCAGCACTCCAATGG - Intronic
1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG + Intergenic
1014442700 6:121491751-121491773 CATGGATTCAAGCATTCCAAGGG + Intergenic
1029133339 7:98350326-98350348 CATGGTTACAAGATATCCAAAGG + Intronic
1035818122 8:2562321-2562343 CATGGTTTCCTGCACCGCAACGG - Intergenic
1036508276 8:9376455-9376477 CATTTTCTCCAGCACTCCAATGG - Intergenic
1037999704 8:23381043-23381065 CATGGTTACCCGCCCCCCAGTGG - Intronic
1039345896 8:36704878-36704900 CATGGCAACCAGCCCTGCAATGG + Intergenic
1042203524 8:66304930-66304952 CATGGTTACAAGGACTAGAATGG + Intergenic
1043263454 8:78231204-78231226 CACCTTTACCAGCACTTCAAGGG + Intergenic
1048722385 8:137340736-137340758 CTTCTTTACCAGCACTCAAAAGG + Intergenic
1050105877 9:2166248-2166270 CATGGCGCCCAGAACTCCAATGG + Intronic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1195178427 X:102333424-102333446 CATGGGTGCCAGCTCTCCACTGG + Intergenic
1195180437 X:102353659-102353681 CATGGGTGCCAGCTCTCCACTGG - Intergenic
1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG + Intergenic
1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG + Intergenic