ID: 901250116

View in Genome Browser
Species Human (GRCh38)
Location 1:7771510-7771532
Sequence CACCGCCCACCCCCAGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 1, 2: 5, 3: 78, 4: 686}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901250116_901250121 -8 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250121 1:7771525-7771547 GGGCGGTGGCCCTTGGGTCGCGG 0: 1
1: 0
2: 2
3: 11
4: 143
901250116_901250126 4 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250126 1:7771537-7771559 TTGGGTCGCGGGCTGCAGACGGG 0: 1
1: 0
2: 0
3: 6
4: 96
901250116_901250122 -7 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250122 1:7771526-7771548 GGCGGTGGCCCTTGGGTCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 103
901250116_901250129 12 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250129 1:7771545-7771567 CGGGCTGCAGACGGGCCGGGCGG 0: 1
1: 0
2: 2
3: 29
4: 246
901250116_901250133 28 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250133 1:7771561-7771583 CGGGCGGGTCCCGCGGCCATCGG 0: 1
1: 0
2: 1
3: 9
4: 79
901250116_901250125 3 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250125 1:7771536-7771558 CTTGGGTCGCGGGCTGCAGACGG 0: 1
1: 0
2: 0
3: 12
4: 112
901250116_901250127 8 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250127 1:7771541-7771563 GTCGCGGGCTGCAGACGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 135
901250116_901250131 21 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250131 1:7771554-7771576 GACGGGCCGGGCGGGTCCCGCGG 0: 1
1: 0
2: 2
3: 90
4: 502
901250116_901250128 9 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250128 1:7771542-7771564 TCGCGGGCTGCAGACGGGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 114
901250116_901250130 13 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250130 1:7771546-7771568 GGGCTGCAGACGGGCCGGGCGGG 0: 1
1: 0
2: 8
3: 47
4: 422
901250116_901250134 29 Left 901250116 1:7771510-7771532 CCGAGGCCTGGGGGTGGGCGGTG 0: 1
1: 1
2: 5
3: 78
4: 686
Right 901250134 1:7771562-7771584 GGGCGGGTCCCGCGGCCATCGGG 0: 1
1: 0
2: 0
3: 13
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901250116 Original CRISPR CACCGCCCACCCCCAGGCCT CGG (reversed) Intronic
900115438 1:1025976-1025998 CAAAGCCCCCCCCCAGGCCAAGG - Intronic
900189235 1:1346287-1346309 CATCCCCCAGTCCCAGGCCTGGG + Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900395888 1:2453093-2453115 CACCACCTCCACCCAGGCCTGGG + Intronic
900460586 1:2800654-2800676 CACCGCCGCCCCCCGAGCCTGGG + Intronic
900505187 1:3026787-3026809 CCCAGCCCATCCCCTGGCCTTGG - Intergenic
900507794 1:3038425-3038447 CACTGCCCAGCTCTAGGCCTCGG + Intergenic
900546964 1:3234651-3234673 CACCCTCCACCCACAGGCCAGGG + Intronic
900579156 1:3399936-3399958 CACAGCCAACCCGCAGACCTGGG - Intronic
900692317 1:3988050-3988072 CTCAGCCCATCCCCAAGCCTGGG - Intergenic
900801576 1:4740348-4740370 CATCCCCCTCCCCCAGGCCCTGG - Intronic
900982343 1:6053369-6053391 CCCCCCACACCCCCAGGCCATGG - Intronic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
901381611 1:8878400-8878422 CCCCGCTCACCCCGAGGCCCGGG - Intronic
901755837 1:11440964-11440986 CACCTCCCACCACCAGGCCAAGG - Intergenic
901794350 1:11671856-11671878 CCCCCCCCTCACCCAGGCCTTGG - Intronic
902402442 1:16165620-16165642 CCACGCCCATCACCAGGCCTGGG + Intergenic
902827876 1:18989532-18989554 CACCACACACCCACAGGCCGAGG + Intergenic
902870616 1:19311839-19311861 CACCGCCCAGCCCGAGCCCCAGG + Exonic
902984726 1:20148578-20148600 CCCAGCCCAGCCCCAGGCATGGG + Exonic
903371281 1:22837774-22837796 CCCAGCCCACCCCCATTCCTTGG + Intronic
903458219 1:23503626-23503648 CACCTCCCACCCGCCTGCCTTGG + Intergenic
903462816 1:23531068-23531090 CCCCGCGCTCCCCAAGGCCTCGG + Exonic
903799311 1:25954814-25954836 CACCGGCCATCTGCAGGCCTGGG + Intergenic
904253088 1:29238283-29238305 CACATCCCACCCTGAGGCCTGGG + Intronic
905889699 1:41511325-41511347 CCCCTCCCACTTCCAGGCCTCGG - Intronic
906511628 1:46413383-46413405 GACTCCCCACCCCCAGGCCCAGG - Intronic
906769457 1:48471550-48471572 CGACGCCCACCCCCAGACTTGGG + Intronic
906769537 1:48471921-48471943 CGCCTCCCACCCCCGGGCATTGG - Intronic
907547421 1:55274404-55274426 CACAGCCCACCCCCACCCCAAGG - Intergenic
909042459 1:70670472-70670494 ATCCGCCCTCCCCCAGGCCAAGG - Intergenic
910685549 1:89912401-89912423 CACCCCCCACCCCCACCCTTTGG + Intronic
911017071 1:93345445-93345467 CACCTCCCACCCCCAAGCCCAGG + Intergenic
911019937 1:93375847-93375869 CACCCCCCACCCCAAGTCCTGGG - Intergenic
911053238 1:93689743-93689765 CACCACCCACCCCCAACCCCAGG - Intronic
911296209 1:96118355-96118377 TACCTCCCTCACCCAGGCCTTGG - Intergenic
912787582 1:112619403-112619425 CACCGCCCCCCCCCCGGGGTTGG + Exonic
912802341 1:112728024-112728046 CACCCCCCTCCCTAAGGCCTTGG - Intergenic
912822999 1:112882443-112882465 CCCCTCCCACCCCTAAGCCTGGG - Intergenic
913549953 1:119907546-119907568 CACTGCCCACCCCCAGCAGTTGG - Intergenic
913592353 1:120341509-120341531 CTCCCCCCACCCCCAAGTCTGGG - Intergenic
913651006 1:120913636-120913658 CTCCCCCCACCCCCAAGTCTGGG + Intergenic
914170108 1:145215431-145215453 CTCCCCCCACCCCCAAGTCTGGG - Intergenic
914386673 1:147175941-147175963 CACCCCCCACCCCCAAGTCCTGG - Intronic
914525225 1:148459394-148459416 CTCCCCCCACCCCCAAGTCTGGG - Intergenic
914598451 1:149176436-149176458 CTCCCCCCACCCCCAAGTCTGGG + Intergenic
914900707 1:151709690-151709712 CTCCTCCCACCCCCAGGCCCAGG - Intronic
915447159 1:155980254-155980276 CACCCTCCTGCCCCAGGCCTGGG - Intronic
915524716 1:156468548-156468570 CACCTCCCACCCCCTACCCTGGG + Intronic
915595474 1:156894152-156894174 CACTGCCCCCTCCCAGGGCTGGG + Intronic
916442035 1:164836649-164836671 CATCCCCCACCCCCAAGCCTGGG + Intronic
916491866 1:165309209-165309231 CGCTCCCCACCCCCAGCCCTTGG + Intronic
916532069 1:165666232-165666254 CACTCCCCACCCCCAGCCCCTGG - Intronic
916879531 1:169006398-169006420 CATCCCCAACCCTCAGGCCTAGG + Intergenic
918276915 1:182961706-182961728 AACCCCCAACCCCCAGCCCTAGG - Intergenic
919414847 1:197295252-197295274 CACCACCCTCACTCAGGCCTTGG - Intronic
919747777 1:201019531-201019553 CACCTCCCTGGCCCAGGCCTGGG + Intronic
920196420 1:204230343-204230365 CACTGCCCACTCCCAGGGCATGG - Intronic
922178415 1:223215084-223215106 CATCCCCAACCCCCAGGCCCTGG + Intergenic
922466075 1:225846181-225846203 CACTGCCCACCCCCACACCTTGG + Exonic
922474807 1:225899442-225899464 CCCCACCCACCCACAGGCCTAGG + Intronic
922727066 1:227927539-227927561 CACCTCCAAGCCCCAGGGCTAGG + Intronic
922794804 1:228334749-228334771 CACCGCCCGCCTCCTGGCCCCGG - Intronic
924382588 1:243478088-243478110 CTTCTCCCGCCCCCAGGCCTCGG + Intronic
1062992968 10:1837066-1837088 CACCGCACAGCCCCAGCCCCTGG + Intergenic
1063505724 10:6597637-6597659 CCCCCCCCACCTCCAGTCCTTGG + Intergenic
1063796335 10:9517556-9517578 CATCCCCCACCCCCATGACTGGG + Intergenic
1064957982 10:20932406-20932428 CACCCCCCAGCCCCAGGCCCTGG - Intronic
1065136857 10:22679857-22679879 CAACCCCTACCCCCAGCCCTAGG - Intronic
1065876295 10:30000235-30000257 CACCTTCCACTCACAGGCCTGGG + Intergenic
1066952806 10:42137900-42137922 CACCTCCCAGCCCCCTGCCTTGG + Intergenic
1067047778 10:42995074-42995096 CATCCCCCACCCCTAGCCCTTGG - Intergenic
1067092625 10:43276645-43276667 CCCCACCCACCCCCAGACCCTGG + Intergenic
1067728659 10:48792861-48792883 CACCCACCATCCCCAGGACTAGG - Intronic
1069349574 10:67509345-67509367 CTCCACCCACCGACAGGCCTCGG + Intronic
1069547528 10:69339288-69339310 GGCAGCCCAGCCCCAGGCCTAGG + Intronic
1069831466 10:71284715-71284737 CCTCGCGCACCCGCAGGCCTGGG - Exonic
1069910187 10:71754197-71754219 CCCCACCCACCCCCAGCCATGGG + Intronic
1070312550 10:75284211-75284233 GACCGCCCAACCCCAGCCCTAGG + Intergenic
1070772854 10:79092400-79092422 CACCTCCCTCTTCCAGGCCTTGG + Intronic
1071805180 10:89111722-89111744 CACCCCCCACCCCCAGCCTTTGG + Intergenic
1072259067 10:93650043-93650065 CACTGTCCACTCCCAGCCCTAGG + Intronic
1073208564 10:101781221-101781243 CTCCACCCTCCCCCAGGCCCAGG + Intergenic
1073359276 10:102884407-102884429 CACCCCCTACCCCCAGCCCCTGG + Intronic
1073491182 10:103854712-103854734 CTGCCCCCAGCCCCAGGCCTAGG + Intronic
1073800720 10:107038666-107038688 CACTGCCCACCCCCAACCCTGGG + Intronic
1074516424 10:114174348-114174370 CACCTCCCACCTCCCGGCCCAGG + Intergenic
1074771526 10:116737958-116737980 CTGCGGGCACCCCCAGGCCTGGG - Intronic
1075046632 10:119151409-119151431 CCACCCCCACCCCCAGCCCTAGG - Intronic
1075810756 10:125222937-125222959 TTCAGCCCACCCCCAGGCCCAGG - Intergenic
1076255471 10:129021091-129021113 CACCGCCCCCACCCAAGCCTGGG - Intergenic
1076599953 10:131650948-131650970 CACTGCACACCCCCTGACCTGGG + Intergenic
1076761947 10:132610349-132610371 CACCCCCCACCCCCATCACTGGG - Intronic
1077044444 11:538176-538198 CCCCTTGCACCCCCAGGCCTTGG + Intronic
1077124530 11:926368-926390 CACCCCGCACCCCCAGACCCAGG - Intronic
1077145049 11:1040933-1040955 CGCTGCCCCTCCCCAGGCCTTGG - Intergenic
1077187270 11:1240919-1240941 CACCGCCCAGAGCCCGGCCTGGG + Exonic
1077338240 11:2014842-2014864 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1077344390 11:2039619-2039641 CCCTTCCCAGCCCCAGGCCTGGG + Intergenic
1077360105 11:2137096-2137118 CACGGCCCACGCCTGGGCCTCGG - Intronic
1077431021 11:2516026-2516048 ATCCGCCCACGCCCAGGCCAGGG + Intronic
1077600240 11:3569605-3569627 CACAGCACAGCCCCAGACCTTGG + Intergenic
1077615338 11:3670001-3670023 CACCCTCCACTCCCAGGGCTGGG + Intronic
1077675353 11:4189890-4189912 CACCTTCCACAACCAGGCCTAGG + Intergenic
1078076372 11:8165515-8165537 CCCAGCCCACCTCCAGCCCTAGG - Intronic
1078170167 11:8923846-8923868 CACCCCCCACCCCCACCCCCCGG + Intronic
1078613253 11:12840577-12840599 CACAGCCGAACCCCAGACCTAGG - Intronic
1078662418 11:13298074-13298096 CATCTCCCACCCCAAGGCCATGG + Intronic
1079160337 11:17986547-17986569 AACCTCCCACCCCAAGGGCTGGG + Intronic
1079444716 11:20548103-20548125 CACCTCCCACCCGCCTGCCTTGG + Intergenic
1079711281 11:23685393-23685415 CACCTCCCACCCCCAGTCCCAGG - Intergenic
1081677709 11:44980644-44980666 CCCATCTCACCCCCAGGCCTGGG - Intergenic
1081712487 11:45226407-45226429 CACCGCCTACCACCTGGCCTTGG + Intronic
1081797430 11:45830760-45830782 CACCTCACACCCCCAGCTCTAGG - Intergenic
1081809716 11:45908005-45908027 CACCGTCCCCTCGCAGGCCTGGG + Intergenic
1081870501 11:46380855-46380877 CAAGCCCCTCCCCCAGGCCTCGG + Exonic
1082719199 11:56652773-56652795 AAGCGCCCGCCACCAGGCCTGGG - Intergenic
1083596292 11:63919533-63919555 AATCGTCCTCCCCCAGGCCTGGG + Intergenic
1083625903 11:64071839-64071861 CACGGCCCACAGCCTGGCCTGGG - Intronic
1083628504 11:64084198-64084220 CTCAGCCCCCTCCCAGGCCTGGG + Intronic
1083640722 11:64143989-64144011 CACCTCCCACCCCAAGCTCTGGG + Intronic
1083860601 11:65418141-65418163 CAGGGCCAAGCCCCAGGCCTCGG - Intergenic
1084256152 11:67944219-67944241 CACAGCACAGCCCCAGACCTTGG + Intergenic
1084331226 11:68431858-68431880 CATCCACCACCCCCTGGCCTGGG + Intronic
1084333579 11:68444569-68444591 CACCCCCCACCCCCCACCCTGGG + Intronic
1084412243 11:69011736-69011758 CACCCACCACCCCTAGGTCTGGG + Intronic
1084559321 11:69893854-69893876 CTCCGGCCCCACCCAGGCCTGGG - Intergenic
1084692405 11:70734850-70734872 CACCACCCTCCCCCAGGCTTGGG + Intronic
1084816606 11:71651080-71651102 CACAGCACAGCCCCAGACCTTGG - Intergenic
1085296583 11:75434928-75434950 CACCGCCAACCCCCTGCCCCAGG - Exonic
1085527515 11:77172894-77172916 CACCCGCCAACCCCAGGCCAGGG - Intronic
1086158250 11:83692469-83692491 CACCCCCTACCTCCAGCCCTAGG - Intronic
1087709322 11:101530932-101530954 TATCCCCCACCCCCAGGCCCTGG - Intronic
1088599106 11:111460033-111460055 CACCACCCACCCCCACGCCAGGG + Intergenic
1089384560 11:118059313-118059335 CTGCCCCCACCCCCATGCCTGGG - Intergenic
1090333546 11:125948421-125948443 CATCGGGCACCCCGAGGCCTTGG + Intergenic
1090446188 11:126766716-126766738 CACCCGCCTCCCCCAGGCCAAGG - Intronic
1202812345 11_KI270721v1_random:32354-32376 AACTGCCAATCCCCAGGCCTGGG - Intergenic
1202821224 11_KI270721v1_random:70024-70046 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1202827376 11_KI270721v1_random:94808-94830 CCCTTCCCAGCCCCAGGCCTGGG + Intergenic
1091383627 12:78246-78268 CACCGCCCGCCGCCAGCCCGGGG + Intronic
1091462059 12:651086-651108 CAATGCCCACCCCCATGACTGGG - Intronic
1091571606 12:1691379-1691401 CACGGCCGACCCTCAGGCCAAGG - Intronic
1091831293 12:3552794-3552816 CTCAGACTACCCCCAGGCCTCGG - Intronic
1092426386 12:8378965-8378987 CACAGCACAGCCCCAGACCTTGG + Intergenic
1093661915 12:21767315-21767337 CCCCCCCCACCTCCAGGCCAGGG + Intronic
1095639445 12:44470273-44470295 CAACCCCCACCCACAGGCCCTGG - Intergenic
1095705676 12:45234717-45234739 AACCCCCCACCCCCACCCCTGGG + Intronic
1095960068 12:47828873-47828895 CACCCCCCGGCCCCAGGCCCTGG - Intronic
1096080033 12:48827064-48827086 CACCACCCAGCCCCTGGCCCCGG + Exonic
1096384715 12:51187569-51187591 CACCCTGCACCCCCATGCCTGGG + Exonic
1096499498 12:52056278-52056300 CACCTCTGAACCCCAGGCCTTGG + Intronic
1096569697 12:52515019-52515041 CAAAGCCCACCCCCAGCCCTCGG + Exonic
1096919431 12:55068241-55068263 CACCTCTCACACCCAGGGCTAGG + Intergenic
1097084293 12:56455705-56455727 CACCACACAACCCCACGCCTAGG - Intronic
1097107500 12:56634351-56634373 CACCGACCAACCCTAGGCCCAGG + Intronic
1097168996 12:57102110-57102132 CAGAGCCAACCCCCAGGCCTGGG + Intronic
1097178956 12:57160015-57160037 CTCCTCCCACCCCAAGGCCTGGG - Intronic
1097264751 12:57738524-57738546 CAGCGCCCCCACCCAGGCCGGGG - Intronic
1097768999 12:63558452-63558474 CACCCCCCACCAACAGGCCCTGG + Intergenic
1100048155 12:90410928-90410950 CACCTCCCAGCCGCATGCCTTGG + Intergenic
1100464059 12:94829626-94829648 CTTCTCCCACCCCCAGTCCTGGG - Intergenic
1100904255 12:99279467-99279489 CTCTTCCCACCCCCAGCCCTAGG + Intronic
1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG + Intronic
1103342962 12:120230825-120230847 CCCCACCCACCCCCAGCCCAGGG + Intronic
1103384674 12:120522802-120522824 CATTGCCCACCCCCAGGCTTGGG - Intronic
1103716588 12:122948865-122948887 CACCGCCACCCCCAAGGCCCGGG - Intronic
1103901057 12:124303806-124303828 CAGCGCCCTCCCACAGGCCCGGG - Intronic
1103910584 12:124349943-124349965 CACCTCCACCTCCCAGGCCTGGG + Intronic
1103922839 12:124408064-124408086 CACCGCGCCCCGCCACGCCTTGG - Intronic
1104004965 12:124885387-124885409 CCCCACCCACCCCCAGGCACAGG + Intergenic
1104226667 12:126841477-126841499 CTCCATCCACCCCCAGGCCCTGG - Intergenic
1104747978 12:131221824-131221846 CACCCACGTCCCCCAGGCCTCGG - Intergenic
1104822146 12:131683408-131683430 CACAGCCCATCCTCAGCCCTGGG - Intergenic
1104861529 12:131926703-131926725 CACCTCCCACCCGCCTGCCTTGG - Intergenic
1104873136 12:132014910-132014932 CACACCCCACCCCCCGTCCTGGG + Intronic
1104980314 12:132570565-132570587 CACCCCCCAACCCCTGCCCTGGG - Intronic
1105000709 12:132688026-132688048 CAGCGCCGACCCCCGGGTCTGGG - Intronic
1105070879 12:133233971-133233993 AGAGGCCCACCCCCAGGCCTTGG - Intronic
1106231408 13:27823929-27823951 CAGTGCCCACCCCCAAGCCCTGG + Intergenic
1107388856 13:39942525-39942547 AACTGCCCAACCCCAGGACTGGG - Intergenic
1107988872 13:45799613-45799635 TACCACCAACCCCCAGGCCTTGG - Intronic
1108462328 13:50678798-50678820 TCCCTCCCACCCCCGGGCCTGGG - Intronic
1108610411 13:52079657-52079679 CACCTCCCACCCGCCTGCCTTGG + Intronic
1109034397 13:57235892-57235914 CCCCACCCACCAACAGGCCTGGG - Intergenic
1109364669 13:61339441-61339463 CTCCACCCACCCCCAGCCGTGGG + Intergenic
1109657146 13:65407861-65407883 AACCCCCAACCCCCAGGCCAAGG - Intergenic
1110325812 13:74214246-74214268 CCCAGCCCACCCCTAGCCCTTGG + Intergenic
1110358367 13:74595508-74595530 AACCCCCCACCCCCAGTCCGTGG - Intergenic
1110732187 13:78891394-78891416 CCCCACCCACCCCCAGCCCTAGG - Intergenic
1112290807 13:98143065-98143087 CACCGCCCCTCCCCGGGTCTGGG - Intronic
1112443182 13:99439995-99440017 CACGCCCCTCCCCCAGGTCTTGG + Intergenic
1112508365 13:99988921-99988943 CCCACCCCACCCCCAGGCCCAGG - Intergenic
1112750115 13:102574432-102574454 CCACCCCCACCCCCAGGCCCTGG + Intergenic
1114270497 14:21097886-21097908 CACCCCCCAACCCCCGGCCCAGG - Intronic
1114566888 14:23639538-23639560 CTCACCCCACCCCCAGGCCCGGG + Intronic
1115690411 14:35838027-35838049 CTCCACCCTCCCACAGGCCTCGG + Intronic
1116192154 14:41675241-41675263 CACCTCCCACCCGCCTGCCTTGG - Intronic
1116945368 14:50830954-50830976 CTCCGTGCACCCCCAGGCCGTGG + Intronic
1117577138 14:57110775-57110797 CACCACCCACCAACAGGCCCTGG - Intergenic
1118813798 14:69294605-69294627 CCCTTCCCACCCCCAGCCCTAGG + Intronic
1119171639 14:72540324-72540346 GATCGCCCAGCCTCAGGCCTGGG + Intronic
1119338127 14:73851858-73851880 CCCAGCTCGCCCCCAGGCCTCGG - Exonic
1119743642 14:77029060-77029082 CCCACCCCACCCCCAAGCCTCGG + Intergenic
1120067164 14:80056230-80056252 CTACCTCCACCCCCAGGCCTGGG + Intergenic
1121423514 14:93832292-93832314 CAGAGCCCAACCCAAGGCCTAGG - Intergenic
1121531484 14:94657781-94657803 CACCTCCCACCCGCCTGCCTTGG + Intergenic
1121777009 14:96597926-96597948 CAGCTCCCAGCTCCAGGCCTGGG + Intergenic
1122156028 14:99750952-99750974 CGCCTTCCACCTCCAGGCCTCGG + Intronic
1122162997 14:99800231-99800253 CTTCGCACACCCCCAGTCCTGGG - Intronic
1122188381 14:100019825-100019847 CACCTCCCACCCCCATGACTGGG - Intronic
1122329229 14:100901778-100901800 CACCTCCCCCCACCAGCCCTGGG + Intergenic
1122356726 14:101127097-101127119 CACCCCCAGCCCTCAGGCCTGGG + Intergenic
1122358649 14:101142621-101142643 CCCCGCCCCCCAACAGGCCTTGG + Intergenic
1122370289 14:101225702-101225724 CATCCCCCACCCCCACTCCTTGG - Intergenic
1122636087 14:103130317-103130339 CACCTCCCAGGCCCAGGCCAAGG + Exonic
1122840884 14:104461995-104462017 CACCGCGCACGCCTAGGCCCCGG + Intergenic
1123052169 14:105549795-105549817 CCCCGCCGCCCCCCAGGCCTGGG + Intergenic
1124629032 15:31326806-31326828 CCCCGCCCACCCCCGGGGCCGGG + Intergenic
1124860773 15:33438315-33438337 CATCCTCCACCCCCAGGCCATGG + Intronic
1125510046 15:40288030-40288052 AACTGCCTGCCCCCAGGCCTAGG + Exonic
1125645265 15:41267166-41267188 CACCACCATCCCCCAGCCCTGGG - Intronic
1125678191 15:41513597-41513619 GACCGGCCACCCCCAAGCCTAGG + Intronic
1126666937 15:51083810-51083832 CTCCGCCCAGCCCCCTGCCTGGG - Intronic
1126695229 15:51320340-51320362 CACCTGCTACCCCCAGCCCTGGG + Intronic
1127234667 15:57036046-57036068 CACCCCCCACCCCCAGCTCCTGG + Intronic
1127384333 15:58454738-58454760 CAGCGCTCACCCCCAGGGCCTGG + Intronic
1127466819 15:59252292-59252314 CACCGCACCCCGCTAGGCCTTGG - Intronic
1128078176 15:64841406-64841428 CACCGCCCACTGCCCGGCGTCGG + Intergenic
1128112720 15:65086757-65086779 CACCTGCCCCCACCAGGCCTGGG + Intergenic
1128325767 15:66723054-66723076 TACTCCCCACCCCAAGGCCTGGG - Intronic
1128745545 15:70111704-70111726 CCCAGCCCACCCCCAGCCCCTGG - Intergenic
1128765381 15:70248113-70248135 CACTGCCCACCCCCAACACTGGG + Intergenic
1129181624 15:73881623-73881645 CACCTCCCACCCCCACCCCAGGG + Exonic
1129313670 15:74728629-74728651 CACCTCCCACCCGCCTGCCTTGG + Intergenic
1129372989 15:75109632-75109654 CACAGCCCACCCCCTTGGCTTGG + Intronic
1129424661 15:75454794-75454816 CCCCGCCCACCCCAAGGCGGCGG - Intronic
1129599784 15:76992019-76992041 CCCCACCCACACCCAGGCCCAGG - Intergenic
1129782835 15:78285429-78285451 GACCCCCCAACCCCATGCCTCGG + Intronic
1129792069 15:78348124-78348146 CACCCCCACCCCCCAGGCCTTGG + Exonic
1130018292 15:80203826-80203848 CAGCTCCCACCCCCATGCCAGGG - Intergenic
1130068207 15:80623745-80623767 CACCCCCCACCCCCAGCCCAAGG - Intergenic
1130305519 15:82710115-82710137 CACCCCCGACCACCTGGCCTCGG + Intergenic
1130885042 15:88085568-88085590 CCCAGCCAACCCACAGGCCTGGG + Intronic
1131409722 15:92197104-92197126 GTCCTCCCACCCCCAGGCCATGG - Intergenic
1131526746 15:93158773-93158795 CCCCGCCCTGCCCCAGCCCTGGG - Intergenic
1132373919 15:101316018-101316040 CACCACCCACCCAGGGGCCTGGG - Intronic
1132609002 16:805834-805856 CACCGCCCACCCCCAACCCCTGG + Exonic
1132733616 16:1375096-1375118 GACCGCCGAGCGCCAGGCCTCGG - Intronic
1132826765 16:1909147-1909169 TCCTTCCCACCCCCAGGCCTGGG + Intergenic
1132930074 16:2454555-2454577 CCCCGCCCTCCACCAGGCCCTGG + Intronic
1133026555 16:2991235-2991257 TCACGCCCACTCCCAGGCCTGGG - Intergenic
1133325105 16:4937315-4937337 CGCCGCCCACCCCCAGCCGGGGG + Intronic
1133371938 16:5251966-5251988 CACAGCACAGCCCCAGACCTTGG - Intergenic
1133919883 16:10142547-10142569 CACCGCACACCACCATGCCCGGG - Intronic
1134583983 16:15395651-15395673 CCCGGCCCACCCCCATGCATGGG - Intergenic
1136192310 16:28623707-28623729 CCCGGCCCACCCCCATGCATGGG + Intergenic
1136455599 16:30378228-30378250 CACCGCCCACTTCCCGGCCCGGG - Exonic
1136498837 16:30659697-30659719 CGCCGCCGCCCGCCAGGCCTTGG + Exonic
1136622258 16:31436974-31436996 CAGCACCCGGCCCCAGGCCTCGG + Exonic
1137251880 16:46747179-46747201 CACCCTCCACCCCCAGGCTCCGG + Intronic
1137538069 16:49342433-49342455 CAACTCCCACCCCCAGCCCCTGG - Intergenic
1137731499 16:50693676-50693698 CCCAGCCCACCCCCAGGCGCTGG - Intronic
1138458557 16:57134694-57134716 CACCACCCACTGCCAGGCCAAGG - Intronic
1138545314 16:57715730-57715752 CACTGCCCTCCCCCAGGGCCTGG + Intronic
1139589457 16:67925562-67925584 CTGCGCCCACCCACAGCCCTTGG + Intronic
1139909040 16:70385597-70385619 CTCCTCCCACCCCGAGCCCTAGG - Intronic
1139946785 16:70647309-70647331 CACCGGCCATACCCAGGACTGGG - Intronic
1140098638 16:71895788-71895810 CACGCCCCCCACCCAGGCCTGGG - Intronic
1140441495 16:74991430-74991452 GACCACCCTCCCCCAGGCCAAGG - Intronic
1140873189 16:79125658-79125680 CAACCCCAACCCCCAGGCCATGG + Intronic
1141055784 16:80812478-80812500 CACCCCCCACCCCCATCCCTAGG + Intergenic
1141125508 16:81398040-81398062 CACCCCCCAGCTCCAGGCCCTGG + Intergenic
1141412556 16:83845399-83845421 CACCCGCCACTCTCAGGCCTGGG + Intergenic
1141498618 16:84427778-84427800 CACTCCCCAACCCCAGGCCCTGG - Intronic
1141683397 16:85556750-85556772 CCCCCCCCCCCCCCAGTCCTGGG + Intergenic
1142133240 16:88440393-88440415 CACCGACCCAACCCAGGCCTGGG + Exonic
1142157266 16:88538255-88538277 CATCGCCGACTCCCAGACCTGGG + Intergenic
1142223848 16:88867911-88867933 CAGCTCCTACCCCCAGGCCGAGG + Intergenic
1142261533 16:89044779-89044801 CGCCGGCCACCCCCTGGCCCGGG + Intergenic
1142285322 16:89169310-89169332 GTCCCCCCACCCCCAGCCCTTGG - Intergenic
1203120209 16_KI270728v1_random:1529629-1529651 CCCCCCCCACCCCCGGCCCTGGG - Intergenic
1203141675 16_KI270728v1_random:1771326-1771348 CACAGCCTCCCCCCAGGGCTGGG - Intergenic
1203141692 16_KI270728v1_random:1771373-1771395 CACAGCCTCCCCCCAGGGCTGGG - Intergenic
1142492772 17:289450-289472 CACCGCCCACGCCCACACCAAGG + Intronic
1143004917 17:3824080-3824102 CCCCGCCCAGCCCCAGGTCTAGG - Intronic
1143452533 17:7044058-7044080 CTCCCCCCTCCCCCGGGCCTGGG - Intergenic
1143572506 17:7768697-7768719 CACCTACCACCCCCAGCCCCTGG + Intronic
1143642572 17:8207540-8207562 CCCCGTCCACCCCCAGGCTTGGG + Intronic
1143756799 17:9073242-9073264 CACCTTCCACCCCCAAGTCTCGG - Intronic
1144213056 17:13031456-13031478 CATCACTCACCCCCAAGCCTGGG - Intergenic
1144782537 17:17815238-17815260 CCCAGCCCAACCCCAGCCCTGGG - Exonic
1144825739 17:18104757-18104779 CAGAGCCCACCCCCAGCCCAGGG - Intronic
1144959021 17:19034455-19034477 CCCCGCACACCTCCATGCCTGGG + Intronic
1144976138 17:19140069-19140091 CCCCGCACACCTCCATGCCTGGG - Intronic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145711802 17:26984833-26984855 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145980691 17:29009652-29009674 CACACCCCACCCCCTGGCTTCGG - Intronic
1146263482 17:31436422-31436444 CACCCCCTCTCCCCAGGCCTCGG - Intronic
1146377635 17:32305269-32305291 CCCAACCCAGCCCCAGGCCTTGG - Intronic
1146613305 17:34328006-34328028 CACCACCCACCAACAGGCCCTGG - Intergenic
1146651711 17:34611208-34611230 CAACCCACACCCCCAGGTCTGGG - Intronic
1146930280 17:36771966-36771988 CACCACCCACTCCCCGCCCTGGG - Intergenic
1147130227 17:38403326-38403348 CACCTCTCACCCCTAGACCTAGG - Exonic
1147155124 17:38540813-38540835 CCCTCCCCACCCCCAGGTCTTGG + Intronic
1147160066 17:38564376-38564398 CACTGCCCATATCCAGGCCTGGG + Intronic
1147587552 17:41661037-41661059 CACCCCCCACCCCCACTCCAGGG + Intergenic
1147930694 17:43978790-43978812 CACCTCCCACTCCCACCCCTTGG + Intronic
1147936467 17:44014274-44014296 CATCGCCCACCAACAGCCCTGGG + Intronic
1147986261 17:44309144-44309166 CACCCCCCAGGCCCAGGCCCGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148547553 17:48529460-48529482 CTCTCCCCAACCCCAGGCCTGGG - Exonic
1148555500 17:48576674-48576696 CACTGCCCACCCCCACCCCGAGG + Exonic
1148736805 17:49869627-49869649 CGCCCCCCACCCCCGGGCCCAGG + Intergenic
1148970780 17:51479419-51479441 CACCCCCCACCCCCACCCCTTGG + Intergenic
1149657789 17:58319396-58319418 ATCCACCCAGCCCCAGGCCTGGG + Intronic
1150294101 17:63998691-63998713 CCGCGCACACCCCCAGCCCTGGG + Exonic
1151139278 17:71976127-71976149 CACCCCCAGCCCCCAGGGCTTGG - Intergenic
1151479588 17:74362211-74362233 CCTCCCCCAACCCCAGGCCTCGG + Intergenic
1151515123 17:74588876-74588898 CACCTCCCACCCCAAGGGCAGGG + Intronic
1151531032 17:74704843-74704865 CACCTCCCACCCCAAGGGCAGGG + Intronic
1151570051 17:74921545-74921567 CAAGGCCAACCCCCAGGGCTGGG + Intronic
1151665959 17:75545244-75545266 CCTCTGCCACCCCCAGGCCTGGG - Intronic
1151828775 17:76537895-76537917 GCCCGCCCACCCGCAGGCCACGG + Exonic
1151943414 17:77306495-77306517 CTCTGCCCACACACAGGCCTTGG - Intronic
1151946717 17:77323651-77323673 CACCGCCCTCCAGGAGGCCTCGG - Intronic
1152093595 17:78259755-78259777 AAGCGCCCACCACCATGCCTGGG - Intergenic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152370209 17:79883110-79883132 CCACCCCCACCCCCAGCCCTAGG + Intergenic
1152472123 17:80495483-80495505 ATTCGCCCTCCCCCAGGCCTGGG + Intergenic
1152473239 17:80501852-80501874 CGCTGCCCTCCCCCAGGCCCTGG + Intergenic
1152476547 17:80522126-80522148 CACCCACCGCCCCCAGGCCCTGG + Intergenic
1152598848 17:81251424-81251446 CAGCCCCCTCCCCCAGCCCTGGG - Intronic
1152612900 17:81324272-81324294 CACCTGCCAGCACCAGGCCTGGG - Intronic
1152626082 17:81388518-81388540 CACCTCCCAGACCCAGCCCTTGG - Intergenic
1152906449 17:82973100-82973122 CACCGCCCACTCACAAGCCCAGG + Intronic
1152926592 17:83090339-83090361 CACCCCCCACCCCCCGCCCCAGG + Intronic
1153051765 18:907506-907528 CTGCTCCCACCCCCAGTCCTGGG + Intronic
1153654133 18:7267103-7267125 CACTGCCTAGCCCCAGGCATCGG + Intergenic
1156258710 18:35424355-35424377 CACCCCCCACACCCAGTCTTGGG + Intergenic
1156337875 18:36186568-36186590 CACCCCCCAACCGCATGCCTGGG + Intergenic
1157100019 18:44720906-44720928 CACCCCCCACCCCAACCCCTTGG + Intronic
1157595751 18:48862687-48862709 CACCCCCCACCCTCATCCCTCGG - Intronic
1158568287 18:58574489-58574511 CAACCCCCAGCCCCAGGCCATGG + Intronic
1158584365 18:58718348-58718370 CATCCCCCACCCCCAGGCTGTGG + Intronic
1159945967 18:74445143-74445165 CAACCCCCACCCCCAGCTCTGGG - Intronic
1160426812 18:78783418-78783440 CACCGCCTCCTCCCAGGCATGGG - Intergenic
1160756274 19:758514-758536 CACCTCCCAGCCCCAGACATGGG - Exonic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1161007498 19:1943870-1943892 ACCCGCCCTCCGCCAGGCCTCGG - Intronic
1161119652 19:2518313-2518335 CACCGCCCTCCGCCCGGGCTGGG + Intronic
1161161057 19:2762126-2762148 CCCCACTCACCCCCAGGCCAGGG + Intronic
1161216192 19:3096014-3096036 CACCGCCCCGCCCCCGGCCCAGG - Intronic
1161219073 19:3109669-3109691 CACAGACCACCCCAAGGGCTGGG - Intronic
1161273927 19:3404910-3404932 CCTCGCCCTCCCCCAGGTCTCGG - Intronic
1161347241 19:3774474-3774496 CTTCGCCCATCCACAGGCCTGGG - Intergenic
1161354939 19:3813745-3813767 CGCTCCCCACACCCAGGCCTGGG - Intronic
1161561325 19:4974253-4974275 CACCGGCCACCACCATGCCCGGG - Intronic
1161960307 19:7519623-7519645 CACTGCCACCCCCCAGGTCTTGG + Exonic
1162382487 19:10339735-10339757 CCCCTTCCACCCACAGGCCTGGG - Exonic
1162399481 19:10436116-10436138 CACCTCCAACTCCCCGGCCTAGG - Intronic
1162483805 19:10946068-10946090 CACCCCCCCCCCCCACCCCTTGG - Intergenic
1162797140 19:13092751-13092773 CGCTTCCCACCCCCGGGCCTGGG + Intronic
1163099475 19:15085690-15085712 CACCTCCCGCCCCCAGCCCCTGG + Intergenic
1163425078 19:17236486-17236508 CACCCCCCACCCCCAGCTCCTGG + Intronic
1163466471 19:17470847-17470869 CCCCGCCCCCGCCCAGCCCTCGG - Intronic
1163484414 19:17577474-17577496 GCCCCCCCACCCCCAGGCCTCGG - Intronic
1163527729 19:17831394-17831416 CACCGCCCGCCCGCAGGGCATGG - Exonic
1163664743 19:18598077-18598099 CGCCCCCCAGCTCCAGGCCTCGG + Intronic
1163813971 19:19452576-19452598 CACTTCACCCCCCCAGGCCTGGG - Intronic
1163830423 19:19544858-19544880 CTCCGCCAACCCCCGTGCCTGGG + Exonic
1164846892 19:31439870-31439892 CACCCTCCACCCCCACGCCCTGG - Intergenic
1164872333 19:31656486-31656508 CACTTCCAACCCCCAGGCCTGGG - Intergenic
1165049458 19:33132337-33132359 CACCCTCGACCCCCTGGCCTTGG + Exonic
1165128918 19:33620465-33620487 CCCAGCGCAGCCCCAGGCCTGGG + Intergenic
1165309013 19:35019410-35019432 CACCACACACCCGCCGGCCTGGG - Exonic
1165454060 19:35900603-35900625 CAGGGCCCGCCCACAGGCCTGGG + Exonic
1165771646 19:38383946-38383968 CCCCGCACACCCCCCAGCCTAGG + Intergenic
1165779912 19:38426231-38426253 CCCCACCCACCCTCAGGCCAGGG + Exonic
1165802392 19:38561097-38561119 CCCTGCCCGCCCCCAGGCCATGG + Exonic
1165819808 19:38667282-38667304 CACCGCCAAGCCTCTGGCCTTGG + Intronic
1166106434 19:40600286-40600308 CAGCACCCACCCCCAGGACGAGG + Intronic
1166543990 19:43623289-43623311 CCCAGCCCAGGCCCAGGCCTAGG + Exonic
1166788857 19:45385728-45385750 AACCCCCCACCCCCACGCCTAGG - Exonic
1166844661 19:45719353-45719375 CACCTCCCTCCCCCAGCCCTAGG - Intronic
1166852195 19:45766320-45766342 CATCTCCCTCCCTCAGGCCTAGG - Intronic
1166871206 19:45872239-45872261 CACCGCTGACACCCAGGCCTGGG - Exonic
1167250397 19:48395974-48395996 CCCCTTCCTCCCCCAGGCCTTGG - Intronic
1167253024 19:48410977-48410999 CCCCGGCCATCCCCAGCCCTGGG + Intronic
1167275733 19:48538070-48538092 CACCCCCCACCGACAGGCCCCGG + Intergenic
1167509779 19:49889906-49889928 CACCGCCTACCCGCACGGCTGGG - Exonic
1167591541 19:50406931-50406953 CACCTCCCACCCCCAACCCCTGG + Intronic
1167622749 19:50568333-50568355 CCCCACCCCCCCCCAGGCCCCGG + Intergenic
1168076853 19:53985161-53985183 CACCGCCCAGCACAAGGCTTCGG - Exonic
1168089325 19:54071741-54071763 CACCCCCCAACCCCAGGCCCAGG - Intronic
925221406 2:2144274-2144296 CCCCAGCCACCCCCACGCCTGGG + Intronic
925291008 2:2748758-2748780 CACTGCCCAGCCCCAGGGCCAGG - Intergenic
925394460 2:3522811-3522833 CCCCTCCCACCCCCAGGCTGCGG + Intergenic
925398994 2:3558392-3558414 CACCGCCCCTCCCTAGGCCCCGG - Exonic
925405823 2:3605131-3605153 CACCGGGCTCCCCCAGGCTTGGG - Intronic
925858934 2:8156594-8156616 CCCTGCCCACACTCAGGCCTCGG - Intergenic
925869124 2:8253957-8253979 CACCCCCCACCCCCAGGCCTGGG + Intergenic
925891472 2:8438507-8438529 CACCCCCCACCCCCAGTCTATGG + Intergenic
926037217 2:9645320-9645342 CACCCACCACCCCCAGGGCTGGG - Intergenic
926369208 2:12163530-12163552 CGCGACCCACCCCCAGGCTTGGG + Intergenic
926490786 2:13523715-13523737 CACACCCCACACCCATGCCTAGG - Intergenic
926693591 2:15754598-15754620 CACCACCCACTCTCAGGCCATGG - Intergenic
927146915 2:20172338-20172360 CCCTGCCCACTCCCAGGTCTGGG + Intergenic
927859694 2:26552925-26552947 CACAGCCCACAGACAGGCCTAGG + Intronic
928845340 2:35665124-35665146 CTCCTCTCACCACCAGGCCTAGG + Intergenic
929531790 2:42757236-42757258 CACCTCATACCTCCAGGCCTGGG - Intergenic
929777298 2:44937332-44937354 CACCTCCCACTGCCAGGCCCAGG - Intergenic
931461529 2:62454272-62454294 CTCCTCCCACCCCCAGAGCTGGG - Intergenic
931695752 2:64869332-64869354 CACCGCCCACCTCCAGCCATTGG - Intergenic
931920088 2:67005761-67005783 CTCCTACCACCCTCAGGCCTTGG + Intergenic
932129821 2:69177810-69177832 CACCGGCCACCCCCACCACTCGG + Intronic
932418838 2:71589535-71589557 TCCCTGCCACCCCCAGGCCTGGG + Intronic
932738158 2:74270381-74270403 CCGCGCCCAGCCCCAGGCATTGG - Intronic
934562975 2:95322813-95322835 CACCACCCAACCCCAGCCCTTGG + Intronic
935112244 2:100104580-100104602 CACCGCCCACCCCCAGGTCGGGG + Intronic
935653032 2:105398702-105398724 CACCCCCAACCCCCAGGGTTCGG + Intronic
936047068 2:109196324-109196346 CACAGCCCAACGCCAGGCCTTGG - Intronic
936122738 2:109760579-109760601 CGCCGCCCGCCCCCAGGTCGGGG - Intergenic
936221955 2:110610894-110610916 CGCCGCCCGCCCCCAGGTCGGGG + Intergenic
937087490 2:119181121-119181143 CAACGCCCAGCCTGAGGCCTTGG + Intergenic
937249157 2:120512373-120512395 GACACCCCACCCCCAGGCCCTGG - Intergenic
937357261 2:121205845-121205867 CCCTGGCCACCCCCAGGCCCGGG + Intergenic
937930283 2:127199468-127199490 CCCCGCTCACCCTCCGGCCTCGG + Exonic
937954824 2:127416272-127416294 CACCCCCAACCCCCAGCACTGGG + Intergenic
938063511 2:128269323-128269345 CCCCAACCACCACCAGGCCTTGG - Intronic
938339134 2:130523801-130523823 CTCTGCCCTCTCCCAGGCCTGGG + Intronic
940036874 2:149320667-149320689 CACTGCCGTCCCCCAGGCCGCGG + Intergenic
940961889 2:159795656-159795678 CACCACCTTCCCCCAGTCCTTGG - Intronic
941903313 2:170697835-170697857 CTCCTCCTACCCCCAGCCCTTGG - Intergenic
942792096 2:179772384-179772406 CATACCCCACCCCCAGGCATTGG - Intronic
943361627 2:186925691-186925713 CACCCCCCACCCCCACACTTGGG - Intergenic
943907461 2:193517763-193517785 CACCTCCCACACACAAGCCTGGG + Intergenic
946160822 2:217834993-217835015 CACCCCCAACCCTCAGGCCTGGG + Intronic
946406084 2:219492790-219492812 CACGGACCACAGCCAGGCCTCGG + Exonic
947525762 2:230875819-230875841 CACCCCCCACCCCCAGGCCCTGG - Intronic
947552598 2:231057166-231057188 CAGGGCCCACCCCCGGGCCGGGG + Intronic
947722827 2:232379951-232379973 CTCTGCCCAGCCCCAGCCCTTGG - Intronic
947727172 2:232408032-232408054 CTCTGCCCAGCCCCAGCCCTTGG - Intronic
947736330 2:232457337-232457359 CTCTGCCCAGCCCCAGCCCTTGG - Intronic
947797134 2:232901693-232901715 CACAGGTCACCCCCAGTCCTGGG + Intronic
947840497 2:233204548-233204570 CCCCGCCCACCCCGACGCCGCGG + Exonic
948800332 2:240430534-240430556 CCCCCCCCACCCCCAGCCCATGG + Intergenic
948945602 2:241217630-241217652 CACCGTCCGCCCTCAGCCCTCGG - Intronic
948976482 2:241466636-241466658 CACCCCTCACCCCCAGGCAGCGG + Intronic
949070095 2:242019274-242019296 CCCCGCCCACCCCCCTCCCTTGG - Intergenic
1168961907 20:1875831-1875853 GTCCCCCCACCCCAAGGCCTGGG - Intergenic
1169076090 20:2760535-2760557 CGGCCCCCACCCCCAGGCCTAGG + Intergenic
1169483371 20:6005899-6005921 CCCCGCCCACCCCCGGGCCTTGG + Intergenic
1169915674 20:10680839-10680861 CCTCACCCACCCCCAGGCCCTGG + Intergenic
1170112659 20:12822434-12822456 CACCGCCCAGCAACAGGCCCTGG + Intergenic
1170269767 20:14512382-14512404 CATCTTCCACCCCCAAGCCTTGG - Intronic
1170562765 20:17570567-17570589 CGCCCCCCACTCCCCGGCCTCGG - Intronic
1172596568 20:36154624-36154646 CCCCGCCCCCGCCCCGGCCTCGG - Intronic
1172952463 20:38730789-38730811 CACCCCTCGGCCCCAGGCCTGGG - Intergenic
1172966026 20:38835900-38835922 CACCGCCCTCCCCAACGCCCTGG - Exonic
1173280659 20:41624194-41624216 CCACTCCCACCCCCAGGCCTGGG + Intergenic
1173548997 20:43919397-43919419 CACAAACCAGCCCCAGGCCTTGG - Intronic
1173975527 20:47183914-47183936 CACCCCCAACCCGGAGGCCTGGG + Intronic
1174151524 20:48489472-48489494 CACAGCCCAGGGCCAGGCCTTGG + Intergenic
1174290219 20:49503042-49503064 TACCTCCCACCCCCACCCCTGGG - Intergenic
1174448838 20:50607998-50608020 GACCGCTCAGCCCCAGGCCAAGG + Intronic
1174487555 20:50870885-50870907 CGCAGCCCACCCCCAGCCCAAGG - Intronic
1175429322 20:58891119-58891141 CGCCCCCCACCCCCCGGGCTCGG - Intronic
1175515114 20:59564462-59564484 CAGCGTCCGCCCCCAGGCCAAGG + Intergenic
1175597773 20:60249104-60249126 CACAGGCCATCCCCTGGCCTTGG + Intergenic
1175707500 20:61191339-61191361 CACAGCCCAGCCCAAGGCCAAGG - Intergenic
1175723883 20:61303761-61303783 CTGTGCCCACCCCCAGGCCCGGG + Intronic
1175819460 20:61900736-61900758 CAGCGCCCACCCCCAACCCCTGG - Intronic
1175877298 20:62236512-62236534 CACCCCCAACCCCAAGGCCAGGG + Intronic
1175939882 20:62532989-62533011 CAGCCCCCACCTTCAGGCCTGGG - Intergenic
1175957877 20:62620952-62620974 CACCGCCCACGTCCAGGCCTGGG + Intergenic
1175970590 20:62684845-62684867 CACCTCCCACCCCATGGCCGTGG + Intronic
1176191777 20:63814580-63814602 CTCCTCCCACCCCCAGGCAAGGG + Intronic
1176214485 20:63941729-63941751 CCCCGGCCATCCCCAGGCTTGGG - Intronic
1177886655 21:26755253-26755275 CACTGCCCCACCCCAGGCCAGGG - Intergenic
1178148707 21:29769425-29769447 CACCCCTCACCTCCAGTCCTTGG - Intronic
1178341636 21:31790370-31790392 CACTCCCCACCCCCAGTCCATGG - Intergenic
1178495329 21:33081277-33081299 CACCCCCCTCGACCAGGCCTAGG + Intergenic
1178707996 21:34890031-34890053 CTCCTCCCTCCCCCAGGGCTAGG + Intronic
1178721778 21:35016921-35016943 TGCCACCCACCCCTAGGCCTTGG - Intronic
1178761394 21:35405963-35405985 GAGCACCCACCCCCCGGCCTGGG + Intronic
1178895553 21:36554228-36554250 CACCGCCGAGCCCAGGGCCTGGG - Intronic
1178916726 21:36709112-36709134 CAGCGCCCAGCCCGATGCCTGGG - Intronic
1179792543 21:43763992-43764014 CACCCATCACCCCCAAGCCTAGG + Intergenic
1179802619 21:43818039-43818061 CACGGCCCCCACCCAGGCCCGGG - Intergenic
1179995012 21:44970144-44970166 CAACCCCCACCCCGAGGCCAGGG - Intronic
1180105619 21:45616451-45616473 CACCACCCTCCGCCTGGCCTGGG - Intergenic
1180109813 21:45642713-45642735 CAACGCCCCGCCCCAGGCCACGG + Intergenic
1181236508 22:21450572-21450594 ATCCGTCCACCCCCAGGCGTGGG + Exonic
1181592916 22:23895782-23895804 CACCCCCGAACCCCACGCCTTGG + Intronic
1181855338 22:25777498-25777520 CAGCGCCCCGCCCCAGGCCTAGG - Intronic
1182124058 22:27803896-27803918 CCCCGCCCGCCCCGGGGCCTAGG + Intergenic
1182472709 22:30558451-30558473 GCCCTCCCTCCCCCAGGCCTGGG + Intronic
1182509611 22:30809569-30809591 CACTCCCCAGTCCCAGGCCTTGG - Intronic
1182846098 22:33432178-33432200 CACCGCCCATGGCCAGCCCTTGG - Exonic
1183331846 22:37226426-37226448 AACCCCCCACCCCCGGGCCAGGG - Intronic
1183482233 22:38071534-38071556 CACCGCCCAACCACAGCCCAGGG - Intronic
1183486316 22:38089297-38089319 CAGCCCCCACCCCCAGTCCCAGG + Intronic
1183581223 22:38727753-38727775 CATCCCCCACCCCCAGGCCCTGG - Intronic
1184096450 22:42318831-42318853 CACTGGCCACCTCCATGCCTGGG + Intronic
1184224605 22:43122080-43122102 CGCCGCCCTCCCACAGGCCTAGG - Intronic
1184602504 22:45551969-45551991 ACCCGCCCACCCTCAGGCTTAGG - Intronic
1184712832 22:46263166-46263188 CGCCGCGCACCCCGAGGCCCGGG + Exonic
1184747586 22:46465197-46465219 CACCTGCCACCTCCAGGCCCGGG + Intronic
1184864842 22:47196332-47196354 ATCAGCCCAGCCCCAGGCCTTGG - Intergenic
1185139426 22:49092120-49092142 CACGCCCCATCCCCAGGTCTGGG - Intergenic
1185170163 22:49288760-49288782 CACCCCCAGCACCCAGGCCTTGG + Intergenic
1185285827 22:49999613-49999635 CCCCGCCCCCGGCCAGGCCTAGG - Intronic
1185285846 22:49999653-49999675 CCCCGCCCCCGGCCAGGCCTGGG - Intronic
1185285866 22:49999693-49999715 CCCCGCCCCCGGCCAGGCCTAGG - Intronic
1185409245 22:50673913-50673935 CCCCCCCCCGCCCCAGGCCTGGG - Intergenic
949919646 3:8990759-8990781 CACAGCCCGCCCCGGGGCCTGGG - Exonic
950098866 3:10345340-10345362 CTCCGCCCTCCCCCAGGCTTTGG + Intronic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
950469894 3:13177947-13177969 CCCCACCCAGCCCCAGGCCTAGG - Intergenic
950480721 3:13242136-13242158 CCCAGCCCCCCACCAGGCCTGGG - Intergenic
950616795 3:14166351-14166373 CGCCTCCCTCACCCAGGCCTGGG - Intronic
951550633 3:23872011-23872033 CACCTCCCACCCGCCTGCCTTGG - Intronic
952237815 3:31498456-31498478 CACCCCCCACCCCCACCCCTTGG - Intergenic
952253493 3:31676118-31676140 CACTGACCTCCCCCAGGACTTGG - Intronic
953605383 3:44410187-44410209 AACCTCCCACCCACAGGCCAAGG + Intergenic
953687415 3:45088861-45088883 CCCCCCTCACCCCCAGGCATGGG + Intronic
954293140 3:49660315-49660337 CCCTGCCCACCCATAGGCCTTGG - Intronic
954300693 3:49699380-49699402 CACCCCCCACCCCGGGGCCTGGG - Intronic
954425797 3:50442472-50442494 CACCACCCACCCCAAGGCCTGGG - Intronic
954663475 3:52238120-52238142 CACCCCCAGCCCCCAGCCCTAGG - Intronic
954748581 3:52800922-52800944 CACAGTCCAGCCCCAGCCCTGGG - Intronic
954878439 3:53818411-53818433 CACAGCCCACCCAGAGGCCCAGG + Intronic
954936588 3:54332741-54332763 CCCCACCCACACACAGGCCTTGG - Intronic
954945960 3:54424622-54424644 CAGAGCCCACCCCCAGGTCCTGG - Intronic
957071069 3:75568256-75568278 CACAGCACAGCCCCAGACCTTGG + Intergenic
958407281 3:93764909-93764931 CACCTCCCAGCCCCCTGCCTTGG - Intergenic
960281412 3:115784708-115784730 CACCGCCCACCTGCAGCCCGGGG + Intergenic
960965360 3:123100619-123100641 CCCCTTCCACCCCCAGGCCCAGG - Intronic
960991301 3:123313390-123313412 CACCGCCCACCCCAGAGGCTTGG + Intronic
960996760 3:123345282-123345304 CACCGGCCACCCCTGCGCCTCGG - Intronic
961236887 3:125375057-125375079 CCCCGCCCTCCCCCGGGCCCGGG + Intronic
961283047 3:125778468-125778490 CACAGCACAGCCCCAGACCTTGG - Intergenic
961380894 3:126496008-126496030 CCCCAGCCTCCCCCAGGCCTGGG + Intronic
961629274 3:128284438-128284460 CACCCCCAACCCCCAGCACTGGG - Intronic
961642174 3:128371609-128371631 CACTGTCCAGCCTCAGGCCTTGG - Intronic
963603044 3:147393505-147393527 CACAGCGCAGCCCCGGGCCTAGG - Intronic
964623755 3:158739578-158739600 CACCTCCCACCCCCAGTACGAGG - Intronic
965816122 3:172638532-172638554 CACCCCCCACCCCAAGAACTAGG - Intronic
967062641 3:185885791-185885813 CTCCTCCCACCCCCAGCCCCAGG + Intergenic
967320079 3:188186177-188186199 TAGCTCCAACCCCCAGGCCTTGG + Intronic
968443740 4:637636-637658 CACAGCCGGCCCCCAGGCCGCGG - Intronic
968524183 4:1047562-1047584 CACCACCCACCTCCAAACCTAGG + Intergenic
968618983 4:1595202-1595224 CCCCGCCCACCTCCAGGCTCTGG + Intergenic
968631079 4:1651854-1651876 CCCCGCGCAGCCCCAGTCCTAGG + Intronic
968919917 4:3517152-3517174 CACCACCCACCCCCAAACCCAGG - Intronic
968982040 4:3855557-3855579 CACCTTGCACCCCCAGGGCTGGG - Intergenic
968985773 4:3873612-3873634 CCCCGCCCTTCCCCAGCCCTGGG + Intergenic
969014667 4:4095954-4095976 CACAGCACAGCCCCAGACCTTGG + Intergenic
969264287 4:6054990-6055012 CAGCGAGCAACCCCAGGCCTCGG - Intronic
969448201 4:7257360-7257382 CCCCCACCACCCCCAGGCCTGGG - Intronic
969456937 4:7305693-7305715 CTCCGTCCACTCCCAGGTCTAGG + Intronic
969739273 4:9012487-9012509 CACAGCACAGCCCCAGACCTTGG - Intergenic
969798456 4:9544000-9544022 CACAGCACAGCCCCAGACCTTGG - Intergenic
972369800 4:38412328-38412350 CACTGACTATCCCCAGGCCTGGG - Intergenic
972375859 4:38469611-38469633 CCCAGCCCAGCCCCAGCCCTAGG + Intergenic
975984365 4:80189150-80189172 CTCTGCCCACCCCCAGACCTCGG + Intronic
976719880 4:88159065-88159087 CACCGCCCTCCCTCGGGGCTAGG + Intronic
977557275 4:98498647-98498669 CACACTCCACCCCCAGGCCCTGG - Intronic
978393538 4:108253031-108253053 CCCCCCCCGCCCCCAGGACTAGG - Intergenic
979242038 4:118455782-118455804 CTCCTACCACCCCCAGGCCTAGG + Intergenic
981305974 4:143247484-143247506 CACCCCCCACCCCCAGTCCCTGG + Intergenic
981802373 4:148673261-148673283 CCCCACCAACCCCCAGCCCTAGG - Intergenic
982714811 4:158795894-158795916 CATCCCCCACCCCCAGTCCATGG + Intronic
984658156 4:182342449-182342471 CCCCTCCCACCCCCAGCCCTAGG - Intronic
984813816 4:183819183-183819205 CACCTCCCAGCCCCCTGCCTTGG - Intergenic
985772437 5:1821231-1821253 CACCCCCCACCCTCAGGGCCAGG - Intergenic
986347156 5:6846143-6846165 CCCCGCCACCCCCGAGGCCTTGG + Intergenic
986602341 5:9485231-9485253 CTTCTCCCACCCCCAGGCCCTGG + Intronic
986860205 5:11918650-11918672 CACTGGCCGCGCCCAGGCCTTGG + Intergenic
987647674 5:20696428-20696450 CCCCGCCCACCCCCCGACCTGGG + Intergenic
990237629 5:53784568-53784590 CACCCCCCACCCCCACACCAAGG - Intergenic
990462124 5:56039234-56039256 CACCTCCCACCCGCCTGCCTTGG - Intergenic
991388302 5:66114572-66114594 CACCCCCACCCCCCAGGCCCTGG - Intergenic
992641478 5:78772050-78772072 CACCACCCAGCACCAGGCGTCGG + Intergenic
993640025 5:90391261-90391283 CAGCTACCACCCCTAGGCCTAGG - Intergenic
993938899 5:94035011-94035033 CATCCCCCACCCCCAGTCCATGG + Intronic
994098533 5:95869575-95869597 CATCCCCCAGCCCCAAGCCTGGG + Intergenic
996026735 5:118654753-118654775 CACCTCCCACCCCCAATCCCTGG + Intergenic
997296538 5:132772335-132772357 CCACCCCAACCCCCAGGCCTAGG + Intronic
997305112 5:132830772-132830794 CACTGTCCACCCTCAGACCTGGG - Exonic
998045811 5:138985786-138985808 CACCTCCCACCCCATGGCCATGG + Intronic
998130912 5:139650612-139650634 CGCCCCCCACCCCGCGGCCTGGG - Intronic
998138697 5:139688103-139688125 CCCCGCCCACCCGCAGCCCTGGG + Intergenic
998203970 5:140146137-140146159 GGCCCCCCACCCCTAGGCCTGGG - Intergenic
998366574 5:141636512-141636534 CACCCCCCAACCCCCGGCCGAGG + Intronic
999282106 5:150372705-150372727 ACCCACCCAGCCCCAGGCCTGGG + Intronic
999516173 5:152303900-152303922 CACCTCCCACCCCCATTCCCAGG + Intergenic
1001483677 5:172105163-172105185 CACCTCCCACCCCCACCCCCTGG + Intronic
1002095934 5:176831079-176831101 CACCCCCCACCTCCGTGCCTCGG + Intronic
1002193626 5:177491171-177491193 CACCGCCCACCCCCAGTGTGGGG - Intronic
1003402652 6:5803535-5803557 CACCGCCCCCCACCAAGCCCAGG - Intergenic
1003405642 6:5825006-5825028 CAGCCCCCACCACCATGCCTGGG + Intergenic
1003650727 6:7957848-7957870 CTCCGCCCTCCCCCAGCCCCTGG - Intronic
1004730101 6:18349428-18349450 CACCCCCCACCCCCAATCCCAGG - Intergenic
1005992903 6:30914399-30914421 TCCCGCCCATCCCAAGGCCTGGG - Exonic
1006638348 6:35475706-35475728 CACCCCCCACCCCCATGCCCAGG - Exonic
1007073069 6:39050195-39050217 CAGCGCCCCCAGCCAGGCCTTGG + Intronic
1007367777 6:41406909-41406931 CCTCGCCCGCCCCCAAGCCTAGG - Intergenic
1007371061 6:41427502-41427524 GGGCGCCTACCCCCAGGCCTAGG + Intergenic
1007392539 6:41558354-41558376 CACCCCCCTCTCCCAGCCCTTGG - Intronic
1007432813 6:41786454-41786476 CACCCCCCAGACCCAAGCCTCGG + Intronic
1007498162 6:42276132-42276154 CACACCCCACCCCCTGGCCTGGG + Intronic
1008598499 6:53065860-53065882 CCCCGCCGACCCCCAGCCCTAGG - Intronic
1009308937 6:62125536-62125558 CACCACCCATCCCCAGCCCCAGG + Intronic
1009642427 6:66355373-66355395 CACCCCCCAACAACAGGCCTTGG - Intergenic
1014146089 6:117999485-117999507 GACCCCCCACCCCCACCCCTGGG + Intronic
1015751904 6:136568937-136568959 AACCACCTACCCCCAGGCCAAGG + Intronic
1016490433 6:144594788-144594810 CACCGCACTGCCCCAGCCCTAGG + Intronic
1016589800 6:145731612-145731634 CCCCACCCACCAACAGGCCTTGG - Intronic
1017672556 6:156779732-156779754 CCCCCCCCTCCCCCAGGCCCGGG + Intronic
1018990038 6:168667590-168667612 CAGCTGCCACCCTCAGGCCTGGG + Exonic
1019036271 6:169062484-169062506 CAGCTCCCACCGCCAGCCCTTGG - Intergenic
1019217341 6:170452353-170452375 CACAGCCCACGCGCAGGCCCAGG - Intergenic
1019262820 7:91683-91705 CACGCCCCACCTCCAGCCCTGGG + Intergenic
1019371847 7:666200-666222 CACCTCACTCCCCAAGGCCTGGG + Intronic
1019735872 7:2649516-2649538 CACGGCCCCCACCCTGGCCTGGG + Intronic
1019920826 7:4162322-4162344 CACCACCCACCCCCAGACTTTGG - Intronic
1020044412 7:5030527-5030549 CCCCCCCCACCCCCAGTCCTAGG + Intronic
1020111584 7:5450950-5450972 CACCCCCCACCCTCCAGCCTGGG - Intronic
1020899828 7:13990599-13990621 CACCGCTCGCCCCCAACCCTGGG - Intronic
1022232239 7:28425425-28425447 CCCACCCCACCCCCAGTCCTAGG - Intronic
1023450923 7:40284130-40284152 CACCTCCAACCCCCAGCCCCTGG - Intronic
1023819633 7:43973350-43973372 CCCAGGCCACCCCCAGGCCCTGG + Intergenic
1023822178 7:43986426-43986448 CACCCCCTTCCCCCAGGCCTGGG - Intergenic
1023861709 7:44220796-44220818 CACAGCCCCCCCCCAGCCCCAGG + Intronic
1023970588 7:44987861-44987883 CCCCACCCACCCCCAGGCAGAGG + Intergenic
1024015189 7:45307289-45307311 CACCCCCCACCCCAAGTCCATGG - Intergenic
1024457978 7:49630612-49630634 CACTGCCCACCCCCGGGTCTTGG - Intergenic
1025078619 7:55964251-55964273 CACTGCCCCGCCCCAGGCCCTGG + Intronic
1025231232 7:57204471-57204493 CACAGCCCAGGGCCAGGCCTTGG - Intergenic
1025619962 7:63159711-63159733 CTCCACCCACCCCCAGCCCCTGG + Intergenic
1026225272 7:68434733-68434755 CACCCCCAACCCCCAGTCCGTGG - Intergenic
1027345792 7:77258159-77258181 CACCCCCCACCCCCACCTCTGGG - Intronic
1027546954 7:79539323-79539345 TTTCTCCCACCCCCAGGCCTGGG - Intergenic
1028477496 7:91266834-91266856 CTCAGCCCATGCCCAGGCCTCGG + Exonic
1028678155 7:93492232-93492254 CCCCTCCCACCAACAGGCCTTGG - Intronic
1029073344 7:97917583-97917605 CACAGCACAGCCCCAGACCTTGG + Intergenic
1029246511 7:99205949-99205971 CACCCCCCGTCCCCAGCCCTTGG + Intronic
1029441088 7:100586901-100586923 CCCCGCCCGCCCCCAGCCCGGGG - Intronic
1029550073 7:101232799-101232821 AACCCCCCACCCCCCGCCCTCGG - Intronic
1029612705 7:101635802-101635824 CCCCTCCCTCCCCCAGGGCTTGG - Intergenic
1029750444 7:102539840-102539862 CACCCCCTTCCCCCAGGCCTGGG - Intronic
1029768396 7:102638948-102638970 CACCCCCTTCCCCCAGGCCTGGG - Intronic
1032140041 7:129320559-129320581 CACCGCCCATCCCAAAGTCTTGG + Intronic
1032237707 7:130139762-130139784 CACAGCCCAGCTCCAGGACTTGG + Intergenic
1033317972 7:140314221-140314243 CACCTCCCTGCCCCAGCCCTTGG - Intronic
1034179381 7:149126077-149126099 CACTGCCAACCCCCAGGCCCAGG + Intronic
1034236108 7:149570947-149570969 CACAGCCCAGCCCAAGGCCGGGG + Intergenic
1034247362 7:149657143-149657165 TACTCCCCACCCCCAAGCCTAGG - Intergenic
1034253723 7:149713544-149713566 CACCGCCCACCCTCCGGCCCGGG - Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034278912 7:149838356-149838378 CACTGCCCAGCCCCAGGCGGCGG - Exonic
1034447608 7:151121570-151121592 CTCCGCCCACGCCCAGTCCCCGG + Intronic
1034545473 7:151786049-151786071 CAGCGCCCACCCCCAGCGCTGGG - Intronic
1034911657 7:155002968-155002990 CCCCGCCCACCCCCCGCCCCCGG + Exonic
1034943385 7:155246603-155246625 CATCGCCCACGCCGAGGCTTTGG + Intergenic
1035032256 7:155869259-155869281 CCACCCCCATCCCCAGGCCTGGG - Intergenic
1035032261 7:155869265-155869287 CACCACCCACCCCCATCCCCAGG - Intergenic
1035270366 7:157716114-157716136 CACCTCCCACCCCCAGCCTGTGG - Intronic
1035327092 7:158072262-158072284 CACTGCACACCATCAGGCCTCGG - Intronic
1035607426 8:939049-939071 CACCTCCCACTCCCAGGCAGGGG - Intergenic
1036244345 8:7103707-7103729 CACAGCACAGCCCCAGACCTTGG - Intergenic
1036256397 8:7210032-7210054 CACAGCACAGCCCCAGACCTTGG + Intergenic
1036308447 8:7668617-7668639 CACAGCACAGCCCCAGACCTTGG + Intergenic
1036361087 8:8077460-8077482 CACAGCACAGCCCCAGACCTTGG - Intergenic
1036646252 8:10612702-10612724 CACCGGCCTCCCCGAGGGCTCGG - Exonic
1036690092 8:10939808-10939830 CAGGGCCCAGCCCCTGGCCTTGG - Intronic
1036897487 8:12647702-12647724 CACAGCACAGCCCCAGACCTTGG + Intergenic
1037489049 8:19379177-19379199 CACCACCAACCCCCAGCCCCTGG + Intronic
1038630168 8:29234494-29234516 TTCCTCCCACCCCTAGGCCTGGG - Intronic
1039619351 8:38982304-38982326 CACCTCCCACCTCCAGCCCCTGG - Intronic
1041719292 8:60961706-60961728 CACCTCCCAGCCCCAGCCCCTGG - Intergenic
1042406228 8:68408397-68408419 CGCCACACACCCCCAGTCCTTGG + Intronic
1042637678 8:70895884-70895906 CACCGCCCGCCCCCAGTGGTTGG - Intergenic
1042827604 8:72994211-72994233 CATCCCCAACCCCCAGGCCGTGG - Intergenic
1042835413 8:73075266-73075288 CACCACCAAGCCCAAGGCCTGGG - Intronic
1043373107 8:79615357-79615379 CAGTGGCCACGCCCAGGCCTAGG - Intronic
1043441996 8:80284425-80284447 CCTCACCCACCCCCAGGCTTGGG - Intergenic
1044375715 8:91468119-91468141 CACCCCCTACCCACAGGCATTGG - Intergenic
1045571481 8:103372227-103372249 CACCGCCCTGGCCCAGGCCCAGG - Intronic
1046899189 8:119505562-119505584 CACCCCTCACCCTCAGGCCCTGG - Intergenic
1047246912 8:123154375-123154397 CTCCTCCCTCCCCCAGGCTTAGG + Intergenic
1049019984 8:139949727-139949749 CTTCCCCCACCCCCAGCCCTAGG - Intronic
1049354789 8:142182334-142182356 CCCCTGCCACCCCCAGGCCCAGG - Intergenic
1049654512 8:143791819-143791841 CAGACCCCACCCCCATGCCTCGG + Intronic
1049673667 8:143880394-143880416 CTCCTCCAGCCCCCAGGCCTGGG + Intergenic
1049697117 8:143989893-143989915 CACCGCCCGACCCCACCCCTCGG + Intronic
1049709824 8:144058453-144058475 CACTGCCCACTCCTGGGCCTGGG - Intronic
1052837919 9:33265198-33265220 CCCCGCCCACCCCCAGCCCCGGG + Intronic
1052928583 9:34038640-34038662 CACCTCCCACCCGCCTGCCTTGG + Intronic
1052974115 9:34399309-34399331 CACTGCCCAGCCCCAGGGGTGGG + Exonic
1053014722 9:34655286-34655308 CTCCCCCTGCCCCCAGGCCTGGG + Exonic
1053313854 9:37035891-37035913 CACCCCCCGCCCCCAGCCCGGGG - Intergenic
1055743915 9:79421934-79421956 CCCCACCCACCCACAGGCCCTGG + Intergenic
1055757319 9:79570979-79571001 CCCCGCCCACCCCGCGGCCCCGG + Intergenic
1055913393 9:81375837-81375859 CTCCTCACACCCCCAGGACTAGG - Intergenic
1056773748 9:89497538-89497560 CACCGCCCCCTCCCTGGCCCGGG + Intronic
1056972331 9:91216752-91216774 CACCCCCTCCTCCCAGGCCTGGG + Intronic
1057869686 9:98708606-98708628 CCGCGCCCAGCCCCAGGCCCCGG + Exonic
1057909250 9:99005197-99005219 CACCACACTCACCCAGGCCTTGG - Intronic
1057934024 9:99221810-99221832 CGCCGCCCACGCCCAGGTCTGGG + Exonic
1058721691 9:107770040-107770062 CACCGCCCACCCCCAAGATCAGG - Intergenic
1059651364 9:116319014-116319036 CGCCTCCCACCCCAAAGCCTTGG + Intronic
1059761039 9:117337831-117337853 GGCCTCCCACCCCCATGCCTTGG - Intronic
1060153237 9:121301886-121301908 AACCGCCCTCCCTCATGCCTGGG + Intronic
1060157827 9:121332293-121332315 TACTGCCCACCCCCTGCCCTGGG - Intronic
1060245914 9:121946203-121946225 CACATCTCACCCCCAGGCCCAGG - Intronic
1060334704 9:122711146-122711168 CACCTCCCACCCGCCTGCCTTGG + Intergenic
1060703367 9:125779076-125779098 CATCCCCCACCCCTAGCCCTTGG + Intronic
1060767794 9:126308006-126308028 CACCCGACAGCCCCAGGCCTTGG - Intergenic
1060793315 9:126499851-126499873 CTCCGCCCTCCCCCAGCCCGCGG + Intronic
1061225721 9:129279769-129279791 CACCACCCCCTCCCAGGCCATGG - Intergenic
1061264499 9:129497351-129497373 CCCCGCCCCCGCCCGGGCCTAGG - Intergenic
1061330657 9:129890310-129890332 CAGCGCCCACCCCCATGGCTCGG - Exonic
1061623885 9:131829090-131829112 AACTCCCCACCCCCAGGCGTAGG - Intergenic
1061627855 9:131852040-131852062 CACAGCCCGGCCCCAGGCCCAGG - Intergenic
1061804209 9:133129066-133129088 CACCGCCGAGCCCCAGGCATGGG - Intronic
1062027869 9:134348886-134348908 CACCCACGACCCCCAGACCTTGG + Intronic
1062209417 9:135355740-135355762 CAGCGCCCACCTCCTGGTCTTGG - Intergenic
1062282718 9:135759185-135759207 GACCTCCCAGCCTCAGGCCTGGG + Intronic
1062322507 9:135997305-135997327 CACCTCCCAGCCCGAGGCCCGGG + Intergenic
1062410117 9:136419341-136419363 CACCGCCCTCCCCCAGTGCTCGG + Intronic
1062463694 9:136672153-136672175 CGCCCCCGACCCCCAAGCCTGGG - Intronic
1062489747 9:136799416-136799438 CACCACCCAACCCGAGGGCTTGG + Intronic
1062547313 9:137069619-137069641 CACCTGCCACCCCCCGGCCCTGG + Intronic
1185621214 X:1452508-1452530 CACTCCCCACCCCCATGCCTAGG + Intronic
1185644854 X:1609380-1609402 CCCCGCCAAACCCCAGCCCTGGG + Intergenic
1185705435 X:2263023-2263045 CCCTCCCCACCCCCAGGCCCTGG - Intronic
1185890283 X:3816261-3816283 CACACACCACCCCCAGGACTGGG - Intergenic
1186402839 X:9275517-9275539 CACCTCCCACCACCAGGCACAGG + Intergenic
1186884100 X:13895422-13895444 CACCCCCCACCCCCAGCTTTTGG - Intronic
1187674950 X:21707099-21707121 CACCCCCCACCCCAAGCCCCTGG + Intronic
1189161198 X:38810797-38810819 CCCCACCAAGCCCCAGGCCTAGG - Intergenic
1189257856 X:39654285-39654307 CACCCCCATCCCCCAGCCCTGGG - Intergenic
1189991163 X:46596432-46596454 TACCCCCCACCCCCAGACCCAGG - Intronic
1190119783 X:47650490-47650512 CCCCACCGCCCCCCAGGCCTGGG + Exonic
1190789555 X:53686362-53686384 CTCTCCCCTCCCCCAGGCCTCGG - Intronic
1192123702 X:68480988-68481010 CATTGCCCACCACCAGCCCTGGG - Intergenic
1193098437 X:77579415-77579437 CACCCCCCACCCCCAGCTCCAGG + Intronic
1193362091 X:80590746-80590768 CACCTCCCACCCGCCTGCCTTGG + Intergenic
1194539937 X:95157289-95157311 CACCCGCCACCACCAGGCTTGGG + Intergenic
1195280801 X:103330765-103330787 CACTCCTCACCCTCAGGCCTGGG - Intronic
1195297638 X:103495502-103495524 CTGTGCCCACCCCCAGCCCTAGG + Intergenic
1196743790 X:119049769-119049791 CTCCCCCTACCCCCAGCCCTAGG - Intergenic
1197757083 X:130002915-130002937 CACTGCCCACCCCAAAGACTTGG - Intronic
1197800323 X:130340876-130340898 CACCCCCTACCCCCACCCCTTGG + Intronic
1198568045 X:137925368-137925390 CTCCACTCACCCCTAGGCCTTGG - Intergenic
1200019499 X:153189867-153189889 CTCACCCCACCCCCAGTCCTTGG + Intergenic
1200043203 X:153384739-153384761 CTCCTCCCAGCCCCAGCCCTTGG - Intergenic
1200123014 X:153800179-153800201 CTCTTCCCACCCCCAGGCCTTGG + Intergenic
1200182770 X:154160972-154160994 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200188424 X:154198086-154198108 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200194074 X:154235226-154235248 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200199829 X:154273030-154273052 CATCCCCCACCCCCAGCCCCTGG - Intronic
1200811522 Y:7490335-7490357 CATCCCCAACCCCCAGGCCATGG - Intergenic
1202330256 Y:23743525-23743547 AAGCGCCCACCACCACGCCTAGG - Intergenic
1202540514 Y:25926537-25926559 AAGCGCCCACCACCACGCCTAGG + Intergenic