ID: 901253163

View in Genome Browser
Species Human (GRCh38)
Location 1:7797162-7797184
Sequence TCGTGGATGTGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901253159_901253163 -9 Left 901253159 1:7797148-7797170 CCTGGAAAATGCATTCGTGGATG 0: 1
1: 0
2: 1
3: 21
4: 107
Right 901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG 0: 1
1: 0
2: 3
3: 30
4: 314
901253157_901253163 8 Left 901253157 1:7797131-7797153 CCTTTGGACTGGATGAGCCTGGA 0: 1
1: 0
2: 1
3: 20
4: 164
Right 901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG 0: 1
1: 0
2: 3
3: 30
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901253163 Original CRISPR TCGTGGATGTGGAGGGAAGC TGG Intronic
900089129 1:911723-911745 TCGTGCAGAGGGAGGGAAGCAGG + Intergenic
900432033 1:2607008-2607030 TCTTGGAGGTGGTGGGAGGCTGG - Exonic
900647565 1:3715847-3715869 TCGGGGTAGGGGAGGGAAGCAGG - Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
904676352 1:32201334-32201356 GGGTGGAAGTGGAGGGATGCCGG + Intronic
904879466 1:33684455-33684477 TCGTGGAGGGGGAAGGAAGAAGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906679991 1:47719988-47720010 TTGTGCATGTGGTGGGGAGCAGG + Intergenic
907273758 1:53305734-53305756 GGGTGGAGGTGCAGGGAAGCTGG - Intronic
912466291 1:109877230-109877252 TGGTGGAGCTGGAAGGAAGCTGG - Intergenic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
912945312 1:114079609-114079631 ACCTGGATGTGCAGGGCAGCGGG + Intergenic
913152514 1:116058949-116058971 TTGGGGACTTGGAGGGAAGCGGG + Intronic
913486563 1:119337092-119337114 GCTTGGGTGGGGAGGGAAGCTGG - Intergenic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
917443155 1:175084364-175084386 TGGGGGATGTGGAGGGGGGCAGG + Intronic
918076700 1:181176110-181176132 GCGGGAATGTGGAGGGAAGATGG + Intergenic
919017576 1:192059832-192059854 TCCTGGAAGTGGAAAGAAGCTGG - Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920528229 1:206684509-206684531 TCGTGGGGGTGGGGGGGAGCTGG - Intergenic
920820836 1:209379197-209379219 TTGGGGATGTGGAGGGGAGGAGG + Intergenic
922726206 1:227924129-227924151 TCGTGGGTGTGAAGGCAAGTGGG - Exonic
924801583 1:247332200-247332222 TCGCGGCTGGGGATGGAAGCTGG + Intergenic
1062768202 10:81042-81064 TCCTGGAGGAGGAGGGAGGCTGG - Intergenic
1063429590 10:5977331-5977353 ACGTGGAGCTGGAGGGAACCGGG - Intronic
1063859908 10:10295787-10295809 TCGGGGTGGTGGAGGGGAGCGGG - Intergenic
1063991271 10:11566449-11566471 TCGTGAATGTGGATTGAAGGAGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067056606 10:43056275-43056297 TTGCGGATGTGAAGGGAAGCTGG - Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1068936226 10:62638084-62638106 TGGGGGAAGTGAAGGGAAGCGGG + Intronic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1071122563 10:82296449-82296471 TGGTGGTGGTGGAGGAAAGCAGG + Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072899278 10:99393193-99393215 TGGAGGAAGGGGAGGGAAGCTGG - Exonic
1073585332 10:104704525-104704547 TCCTGGGTGAGGAGGGAAACTGG + Intronic
1074015171 10:109527270-109527292 TGGTGGATGGGGAGGGAAAGAGG - Intergenic
1077932203 11:6745227-6745249 TCCTTGAGGTGGAGGGAAGATGG - Intergenic
1078451323 11:11443032-11443054 TCGTGGGTGTGGATAGAAGTGGG - Intronic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1080324112 11:31050226-31050248 TCAGGGAAGTGGAGGAAAGCGGG - Intronic
1080678457 11:34450018-34450040 TTTGGGATGTGGGGGGAAGCTGG + Intronic
1082820901 11:57543964-57543986 TGGTGGACGCTGAGGGAAGCAGG - Intronic
1083792805 11:64996832-64996854 TCGGGGATGAGAAGGGGAGCTGG - Intronic
1084889597 11:72230185-72230207 GCGTGGATGTGGAGGGTGGGCGG + Exonic
1085390160 11:76178172-76178194 TCTGGGATGTTGAGAGAAGCAGG - Intergenic
1085739937 11:79069954-79069976 TTGTGGATGTGGAGGAGCGCGGG - Exonic
1088842067 11:113635578-113635600 TCATGGATGGGGCAGGAAGCTGG - Intergenic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1090946188 11:131431545-131431567 TCTTCCTTGTGGAGGGAAGCAGG - Intronic
1091474621 12:760032-760054 TCTTGGAGGAGGAGGAAAGCAGG + Intronic
1092424882 12:8366948-8366970 TGGTGGTGGTGGTGGGAAGCTGG - Intergenic
1093189103 12:16054821-16054843 TGGTGGAGGTGGAGGGTAGGAGG + Intergenic
1095115261 12:38344782-38344804 TCAGGGAAGTGGGGGGAAGCTGG - Intergenic
1095892752 12:47249993-47250015 TCAGGGAAGTGGAGGAAAGCTGG - Intergenic
1096095489 12:48932772-48932794 AGGTGGAAGTGGGGGGAAGCAGG + Intronic
1096099613 12:48961832-48961854 TAGTGTATGTGGAAGGAAGAGGG - Intergenic
1096275516 12:50204198-50204220 TCTTGGTTGTTGAGGGAAGAAGG - Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1101413217 12:104486255-104486277 CCATGGATGTGAAGTGAAGCAGG - Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102566794 12:113802360-113802382 TGGGGGAGGTGGAGGGAAGGAGG + Intergenic
1102962140 12:117099623-117099645 TGCTGGATCTGGAAGGAAGCAGG + Intergenic
1103013736 12:117477915-117477937 TCTTAGATGTGGAAGGAGGCTGG + Intronic
1103131840 12:118475735-118475757 TAGGGGAAGTAGAGGGAAGCTGG + Intergenic
1103193498 12:119022434-119022456 TTGTGGATGTGAAGGAAGGCTGG - Intronic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104797254 12:131528347-131528369 TGGTTGATGAGGAGTGAAGCAGG - Intergenic
1105280964 13:18962390-18962412 TTCTTGATGTGGAGGGAAGGAGG - Intergenic
1105314179 13:19242416-19242438 GCCTGGAAGTGGAGGAAAGCTGG - Intergenic
1106506651 13:30376342-30376364 ACAAGGATGTGGAGGGAAGGGGG + Intergenic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1113638168 13:111936617-111936639 TCAGGGAAGTGGAGGAAAGCTGG + Intergenic
1114658464 14:24330112-24330134 GGGTGGATGTGGGGGGCAGCAGG - Intronic
1117112746 14:52475543-52475565 TCAGGGAAGTGGAGGAAAGCCGG - Intronic
1117212863 14:53519475-53519497 TGGTGGAAGGGGAGGGAAGCTGG + Intergenic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119729671 14:76943049-76943071 TTGGGGATGGGGTGGGAAGCAGG - Intergenic
1119995866 14:79253071-79253093 ACCTGGATGTTGAGGGAAGGAGG + Intronic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1127989025 15:64097234-64097256 TGGTGGATGGGGAGGGTTGCAGG + Intronic
1128496290 15:68200428-68200450 TGGTGGAGGTGGAAGGCAGCCGG + Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1131050790 15:89346605-89346627 TCGGGGAGGGGCAGGGAAGCAGG - Intergenic
1132457103 16:30018-30040 TCCTGGAGGAGGAGGGATGCTGG - Intergenic
1133225741 16:4339607-4339629 TCGTGGATGTGCCAGGAACCCGG + Intronic
1133739451 16:8640522-8640544 TGATGGATGAGGAGGGAAGGAGG + Intronic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG + Intergenic
1135510689 16:23080589-23080611 TGGAGGATGTGGAGGGGAACAGG - Intronic
1139488136 16:67270957-67270979 CCGTGGATGGGGAGGCAGGCAGG - Exonic
1141480511 16:84303331-84303353 TCCTGCATGTGGAAGGAAGGGGG + Intronic
1141747379 16:85934757-85934779 TCCTGGATGAGGATGCAAGCTGG - Intergenic
1141840173 16:86568766-86568788 GCGTGGATCTGTAGGGCAGCTGG - Exonic
1143720766 17:8807497-8807519 TGGAGGATGTGGAAGGAAGGGGG + Intronic
1144036029 17:11366801-11366823 TGGTGTATGTGGAGGGTTGCAGG + Intronic
1146223012 17:31042338-31042360 TCCTGCATGTGGAGGAAAGCTGG + Intergenic
1146255854 17:31391391-31391413 TCGGGGACGCGGAGGGAAACTGG + Intergenic
1146341991 17:32027679-32027701 TCCTGCATGTGGAGGAAAGCTGG - Intronic
1146350819 17:32091916-32091938 TCCTGCATGTGGAGGAAAGCTGG + Intergenic
1146818815 17:35968039-35968061 TCCTGTATGTGGAGGAAAGCCGG + Intergenic
1148173339 17:45542903-45542925 TCCTGCATGTGGAGGAAAGCTGG + Intergenic
1148275929 17:46302548-46302570 TCCTGCATGTGGAGGAAAGCTGG - Intronic
1148298043 17:46520122-46520144 TCCTGCATGTGGAGGAAAGCTGG - Intronic
1148362583 17:47024590-47024612 TCCTGCATGTGGAGGAAAGCTGG - Intronic
1150404546 17:64889820-64889842 TCCTGCATGTGGAGGAAAGCTGG + Intronic
1151153022 17:72104380-72104402 TCGGGGTTGTGATGGGAAGCAGG - Intergenic
1151476853 17:74349042-74349064 TTGTGGAAGTGGAGGAAAGGAGG + Intronic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152675941 17:81641285-81641307 TTGGGGAGGTGAAGGGAAGCTGG + Intronic
1152703068 17:81829048-81829070 TGGTGGATGTGGAGGGACCCAGG + Intronic
1152961091 18:80539-80561 TCCTGGAGGAGGAGGGAGGCTGG - Intergenic
1153644713 18:7184962-7184984 TCGTGAATGTGGAGGGCAGCAGG - Intergenic
1155359096 18:24982351-24982373 TCGTGGAAGTGGTGGCAAGTGGG + Intergenic
1156203196 18:34857218-34857240 TCGTGGGTGTGGTGAGAAGATGG - Intronic
1156460519 18:37319076-37319098 TCATGGATGGGCAGGAAAGCTGG - Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157560865 18:48645146-48645168 TCGGAGAGGTGGAGGGAAGAAGG + Intronic
1157703318 18:49779348-49779370 TCAGGGAAGTGGTGGGAAGCCGG + Intergenic
1158245782 18:55430695-55430717 TTGTGGATGTTGAGGGAGACAGG + Intronic
1158900643 18:61958620-61958642 TCGAGGCTGCGGAGGGAAGCAGG + Intergenic
1160267615 18:77353823-77353845 TTGGGGAAGTGGAGGAAAGCCGG + Intergenic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1162246660 19:9407024-9407046 TGGTTGATGTGGAAGGAGGCGGG + Intergenic
1162761516 19:12891408-12891430 TCGGGAGTGTGGAGGGAAGGAGG + Intronic
1165327774 19:35124352-35124374 TCGTGGTTATGGAGGGACTCAGG - Intergenic
1165719663 19:38070079-38070101 CCGTGGATGAGCAGGGAAGCTGG - Intronic
1166200022 19:41231335-41231357 TTGTGGATGTGGGTGGAAGGAGG - Intronic
1166704824 19:44902977-44902999 GCATGGATATGGTGGGAAGCTGG + Intronic
1167505132 19:49867275-49867297 TAGTGGATGTGGGAGGAGGCGGG - Intronic
1167622074 19:50566219-50566241 TCCTGGACCAGGAGGGAAGCCGG + Intronic
1167696332 19:51017467-51017489 GCGTGAAAGTGGAAGGAAGCTGG + Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168717741 19:58539067-58539089 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717750 19:58539106-58539128 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717756 19:58539145-58539167 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717765 19:58539184-58539206 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717773 19:58539223-58539245 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717782 19:58539262-58539284 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717790 19:58539301-58539323 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717798 19:58539340-58539362 TCATGTCTGAGGAGGGAAGCAGG - Intergenic
1168717818 19:58539454-58539476 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717827 19:58539493-58539515 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717836 19:58539532-58539554 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717845 19:58539571-58539593 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717851 19:58539610-58539632 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717860 19:58539649-58539671 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717878 19:58539724-58539746 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717887 19:58539763-58539785 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717942 19:58539995-58540017 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717951 19:58540034-58540056 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717960 19:58540073-58540095 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717979 19:58540151-58540173 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717990 19:58540190-58540212 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717996 19:58540229-58540251 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718005 19:58540268-58540290 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718014 19:58540307-58540329 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718025 19:58540344-58540366 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718036 19:58540383-58540405 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718057 19:58540459-58540481 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718077 19:58540537-58540559 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718099 19:58540615-58540637 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718108 19:58540654-58540676 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718118 19:58540693-58540715 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718142 19:58540807-58540829 TCCTGCCTGAGGAGGGAAGCAGG - Intergenic
1168718151 19:58540846-58540868 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718160 19:58540885-58540907 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718169 19:58540924-58540946 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718178 19:58540963-58540985 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718187 19:58541002-58541024 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718198 19:58541041-58541063 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718217 19:58541119-58541141 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718228 19:58541158-58541180 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718239 19:58541197-58541219 TCCTGTATGAGGAGGGAAGCAGG - Intergenic
1168718248 19:58541236-58541258 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718257 19:58541275-58541297 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718268 19:58541312-58541334 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718279 19:58541351-58541373 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718300 19:58541427-58541449 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718311 19:58541466-58541488 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718318 19:58541505-58541527 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718327 19:58541544-58541566 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718336 19:58541583-58541605 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718343 19:58541622-58541644 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718352 19:58541661-58541683 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718361 19:58541700-58541722 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718379 19:58541775-58541797 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718388 19:58541814-58541836 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718435 19:58542006-58542028 TCCTGCCTGAGGAGGGAAGCAGG - Intergenic
1168718444 19:58542045-58542067 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718453 19:58542084-58542106 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718462 19:58542123-58542145 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718471 19:58542162-58542184 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718480 19:58542201-58542223 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718512 19:58542319-58542341 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718521 19:58542358-58542380 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718530 19:58542397-58542419 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718577 19:58542589-58542611 TCCTGCCTGAGGAGGGAAGCAGG - Intergenic
1168718585 19:58542628-58542650 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718594 19:58542667-58542689 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718603 19:58542706-58542728 TCCTGTCTGAGGAGGGAAGCAGG - Intergenic
925192756 2:1898799-1898821 TCGGGCAGGTGGAGGGAAGAAGG + Intronic
925907094 2:8546053-8546075 GCGTTGATGTGGAGGGAAGGGGG + Intergenic
929224645 2:39500533-39500555 GCTTTGAGGTGGAGGGAAGCAGG - Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
932750979 2:74371536-74371558 CCTTGGATGGGGAAGGAAGCGGG + Exonic
934752471 2:96802323-96802345 TCTTGGCCGTGGAGGGCAGCAGG - Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
937157150 2:119729225-119729247 TCTTAGATGGGGAAGGAAGCAGG - Intergenic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
941071140 2:160955922-160955944 TCTTGGATGAGGAAGGAAACTGG - Intergenic
942455412 2:176135169-176135191 AAGTGGATGTGGACTGAAGCAGG - Intergenic
945287797 2:208099598-208099620 TGGGGGATGAGGAGGGAAGTGGG - Intergenic
945739273 2:213641206-213641228 TCAGGGAAGTGGAGGAAAGCTGG + Intronic
945807623 2:214509534-214509556 TCGTAGATTTGGATGGAAGTGGG + Intronic
946862458 2:224013470-224013492 ACGAGGAAGAGGAGGGAAGCAGG + Intronic
947819057 2:233058355-233058377 TCCTGAATGTGGAGGGCAGAAGG + Intergenic
948510897 2:238464547-238464569 TCCTGGGTGTGGCGGGGAGCGGG - Intergenic
948713958 2:239847007-239847029 TCAGGGAAGTGGGGGGAAGCCGG - Intergenic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
948823816 2:240564679-240564701 TCCTGGCTGTGGAGGGCACCTGG + Intronic
1168947219 20:1771224-1771246 TGTTGGAAGTGGACGGAAGCTGG + Intergenic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169396050 20:5230491-5230513 TCATGAATGGGGAAGGAAGCTGG + Intergenic
1172034252 20:32000460-32000482 TAATGGATGTGGAGGGCAGGTGG - Exonic
1174741067 20:53014807-53014829 TCAGGGAGGTGGAGGGGAGCAGG - Intronic
1174883674 20:54308005-54308027 TTGAGGATGTGGTGGGAAACTGG + Intergenic
1175442658 20:59002297-59002319 TTGTGCATGGGAAGGGAAGCAGG - Intronic
1179594024 21:42430356-42430378 TCTAGGATTTGGAGGGAATCAGG + Intronic
1180096295 21:45556788-45556810 TCTTGGATGGGGAGAGAGGCGGG + Intergenic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1182113548 22:27741930-27741952 TTTTGGATGTGGTGGGATGCCGG - Intergenic
1182601039 22:31463960-31463982 TCGTGGATCTGGAAGGACGTGGG + Exonic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
950128172 3:10523729-10523751 TCCTGGATGTGGCTGGTAGCAGG + Intronic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
950786864 3:15444256-15444278 TGGTGGAGGTGGCTGGAAGCAGG + Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
953118636 3:40017184-40017206 TCCTGGATGTGCAAGGAAGTGGG - Intronic
960786027 3:121373515-121373537 GGGTGGATGTGGAGGGATGTTGG - Intronic
961416927 3:126765957-126765979 GCGTGGTTTTGGATGGAAGCAGG + Intronic
961498652 3:127314984-127315006 TGGTGGAAGAGGAGGGGAGCTGG + Intergenic
961554591 3:127689355-127689377 ACCTGGAAGTGGAGGGAAGCTGG + Exonic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
967110903 3:186293035-186293057 TTATGCATGTGTAGGGAAGCAGG - Intronic
967209057 3:187150509-187150531 TCTGGGAAGTGGAGGAAAGCTGG - Intronic
967235187 3:187377238-187377260 TCGTGGCTGTGGTGGTATGCAGG - Intergenic
968477923 4:821062-821084 TCCTACATGGGGAGGGAAGCAGG - Intronic
969191655 4:5526195-5526217 TCCTGTATGTAGAGGGAAGAAGG - Exonic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
973179605 4:47251759-47251781 TCGGGGAAGTGGGGGAAAGCTGG + Intronic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978391172 4:108226855-108226877 TCATGGATGTGGAGGGCTGACGG + Intergenic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979963610 4:127050880-127050902 TTGTGCAAGTGCAGGGAAGCAGG - Intergenic
980281208 4:130722651-130722673 TAGTGCAGGTGGAGGGAAGAGGG - Intergenic
980309660 4:131109657-131109679 TAGTGGCTGTGGAGGGTAGGGGG + Intergenic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981912528 4:149998201-149998223 GCATGGAAGTAGAGGGAAGCAGG - Intergenic
982680170 4:158419158-158419180 TCAGGGAAGTGGAGGAAAGCCGG + Intronic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
989163001 5:38409646-38409668 TAGTGGATGTGATGGGAAGAAGG + Intronic
991386932 5:66101075-66101097 TCAGGGAAGTGGAGGAAAGCTGG - Intergenic
993557580 5:89360307-89360329 TCTTGGATTTGGAAGGAAGTAGG + Intergenic
993656941 5:90589414-90589436 ACATGCATGTGGAGGGAAACTGG + Intronic
993775314 5:91987236-91987258 AGGAGGATGTGGAGGGAACCTGG + Intergenic
994222202 5:97208781-97208803 TCAGGGAAGTGGAGGAAAGCTGG + Intergenic
994666815 5:102715117-102715139 TTGTGGATGTGGAGAGATTCAGG - Intergenic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999492506 5:152064922-152064944 TCGTGCATGTTGGGGGAAGATGG + Intergenic
1000334051 5:160228892-160228914 ACTTGGATGTGTAGAGAAGCAGG - Intronic
1002064755 5:176646515-176646537 AAGTGGAGGTGGAGGGATGCTGG + Exonic
1002333848 5:178464613-178464635 ACGTGGAAGTGCAGGAAAGCCGG + Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004194167 6:13488576-13488598 TGGTGGAGGTGGGGGCAAGCTGG - Intergenic
1005491735 6:26353654-26353676 TAGTGGAAGTGGGAGGAAGCGGG - Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006724838 6:36190811-36190833 TCCTGGATGTGAAGGGGAGGAGG - Intergenic
1006835775 6:36998059-36998081 TCGTCAGTGTGGAGGGCAGCGGG + Intergenic
1011276798 6:85639811-85639833 TGATGGAAGTGGAGGGCAGCAGG + Intronic
1011329085 6:86183956-86183978 TCAGGGAAGTGGAGGAAAGCCGG + Intergenic
1015663324 6:135600509-135600531 TCAGGGAAGTGGAGGAAAGCCGG + Intergenic
1017009267 6:150052372-150052394 TCATTGAGCTGGAGGGAAGCTGG - Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017764801 6:157597790-157597812 TCCTGGATGTGGGAGGAGGCTGG - Intronic
1018062126 6:160098425-160098447 TGGTGGATTTTGAGGGATGCAGG + Intronic
1018063182 6:160106227-160106249 GCGTGGAGGAGGAGGGAGGCCGG + Exonic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019019781 6:168908674-168908696 TGGAGGTTGTGGAGGCAAGCAGG + Intergenic
1019408980 7:898464-898486 TCGTGGAGGTGGGGGGAGGGCGG + Exonic
1019746260 7:2701899-2701921 GCAGGGAGGTGGAGGGAAGCGGG - Intronic
1023737577 7:43248471-43248493 TAGTGGAAGTTTAGGGAAGCTGG - Intronic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1024745379 7:52400056-52400078 TCAGGGAAGTGGAGGAAAGCTGG + Intergenic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1026975559 7:74495632-74495654 TCCTGGAGGAGGAGGGAAGGAGG + Intronic
1028984150 7:96996892-96996914 TCTGGGATGGGGAGGGAGGCAGG - Intergenic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1030777135 7:113548162-113548184 TAGTTGATGTGAAGAGAAGCTGG + Intergenic
1032330476 7:130974747-130974769 TCATGGCTGTGCAGGGCAGCTGG - Intergenic
1033026805 7:137782321-137782343 TCAGGGATGTGGGGGAAAGCGGG - Intronic
1033573432 7:142656682-142656704 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1036999021 8:13695458-13695480 GGGTGGATGTGGAGGGATGCTGG + Intergenic
1039245881 8:35607777-35607799 TCATGGCTGGGGAGGGAAGAAGG - Intronic
1039571809 8:38592927-38592949 TCATGGAAGTGGGGGAAAGCTGG - Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1047389295 8:124437149-124437171 TCCTGGCTGAAGAGGGAAGCAGG + Intergenic
1049199056 8:141331066-141331088 GCGGGGACGTGGAGGGCAGCCGG + Intergenic
1049869797 8:144965735-144965757 TCAGGGAAGTGGAGGAAAGCTGG + Intergenic
1052258154 9:26483724-26483746 TCATGGATGTGGAGAGTAGAAGG - Intergenic
1052414048 9:28155429-28155451 TAGAGAATGTGGAGGAAAGCAGG - Intronic
1052886038 9:33649076-33649098 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1055237217 9:74137975-74137997 TAGTGGTTGTGGAAGGATGCAGG - Intergenic
1057705510 9:97392368-97392390 GGGTGGATGTGGAAGGAGGCGGG + Intergenic
1059357328 9:113710178-113710200 GCGTGGATGGGGAGGGCACCAGG + Intergenic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1062737069 9:138143447-138143469 TCCTGGAGGAGGAGGGATGCTGG + Intergenic
1186122149 X:6374623-6374645 TCCTGCATGTGGAGTGAAGGGGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186823564 X:13315338-13315360 TGGTGGATTTGCAGGGAAACTGG + Intergenic
1190442874 X:50493516-50493538 TCTTGAAGGTGGAGGGGAGCTGG - Intergenic
1191100285 X:56719314-56719336 TCCAGGAAGTGGAGGAAAGCTGG - Intergenic
1192337653 X:70235475-70235497 TAGTGGCTGTACAGGGAAGCAGG + Intronic
1194478274 X:94388101-94388123 TGGGGGAAGTGGAGGGTAGCAGG + Intergenic
1195460303 X:105116100-105116122 CCCTGCAAGTGGAGGGAAGCCGG + Intronic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1199668503 X:150121158-150121180 TCAGGGAAGTGGAGGAAAGCCGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1200399256 X:156009708-156009730 TCCTGGAGGAGGAGGGATGCTGG + Intronic