ID: 901263135

View in Genome Browser
Species Human (GRCh38)
Location 1:7888398-7888420
Sequence AGGTTGAACCTGGACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901263135_901263142 25 Left 901263135 1:7888398-7888420 CCCCCAGAGTCCAGGTTCAACCT No data
Right 901263142 1:7888446-7888468 CCAACGCTCATTCACTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901263135 Original CRISPR AGGTTGAACCTGGACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr