ID: 901266472

View in Genome Browser
Species Human (GRCh38)
Location 1:7914293-7914315
Sequence TGTGCACCAGGGAGCTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901266472_901266490 27 Left 901266472 1:7914293-7914315 CCAGCGGAGCTCCCTGGTGCACA 0: 1
1: 0
2: 2
3: 15
4: 136
Right 901266490 1:7914343-7914365 CCGCCACCGTGAGCACCAGGAGG 0: 1
1: 0
2: 2
3: 12
4: 101
901266472_901266487 24 Left 901266472 1:7914293-7914315 CCAGCGGAGCTCCCTGGTGCACA 0: 1
1: 0
2: 2
3: 15
4: 136
Right 901266487 1:7914340-7914362 CACCCGCCACCGTGAGCACCAGG 0: 1
1: 0
2: 1
3: 17
4: 103
901266472_901266491 28 Left 901266472 1:7914293-7914315 CCAGCGGAGCTCCCTGGTGCACA 0: 1
1: 0
2: 2
3: 15
4: 136
Right 901266491 1:7914344-7914366 CGCCACCGTGAGCACCAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901266472 Original CRISPR TGTGCACCAGGGAGCTCCGC TGG (reversed) Intergenic
901266472 1:7914293-7914315 TGTGCACCAGGGAGCTCCGCTGG - Intergenic
901503985 1:9672551-9672573 TGTGCACTTGGGAGCTACTCAGG - Intronic
902755310 1:18545553-18545575 TGGGCACCAGGGAACTCAGCTGG + Intergenic
903177328 1:21588929-21588951 AGTCCACCAGGGAGCTCTGCTGG - Intergenic
903345127 1:22679648-22679670 TGTCCACCAAGGAGCCACGCAGG + Intergenic
904028981 1:27522249-27522271 TGTGCAGAAGGGAACTCTGCAGG + Intergenic
904361032 1:29971876-29971898 TGTGCTCCAGGGGGTTCCTCAGG + Intergenic
904675679 1:32197965-32197987 TGGACACCAGGCAGCTCCACTGG - Exonic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
910876996 1:91886646-91886668 TGTGCATGGGGGAGCTCTGCTGG - Intronic
912331714 1:108826277-108826299 TATGCACCAGGAAGCTGCACTGG - Intronic
916787357 1:168096274-168096296 AGGGCACCAGGGAGCTCTGCTGG + Intronic
921408315 1:214806675-214806697 TGTTCACCAAAGAGCTCTGCTGG + Intergenic
922704278 1:227780814-227780836 TCTGCACCAGGGGCCTCCCCAGG + Exonic
922977465 1:229797673-229797695 ATAGCACCAGAGAGCTCCGCAGG + Intergenic
1063391567 10:5653006-5653028 TGTGCACGAGGCAGCCCAGCGGG - Exonic
1065593307 10:27287570-27287592 TGTGCATGAGGGACCTCTGCAGG + Intergenic
1065657067 10:27962717-27962739 TGTGCATGAGGGACCTCTGCAGG - Intronic
1070978031 10:80621258-80621280 AGTGCACAAGGCAGCCCCGCCGG + Intronic
1072536503 10:96368388-96368410 TCTGCTCCAGGGAGCTTTGCAGG + Intronic
1072640154 10:97205545-97205567 TGTGCTCCAGGCAGCCCCTCTGG - Intronic
1073432825 10:103497743-103497765 TGGGCACATGGGAGCTCCTCGGG - Intronic
1074079434 10:110156162-110156184 AGGGCACCAGGGAGCTCTCCTGG + Intergenic
1076747437 10:132521502-132521524 GGGGCACCAGGGAGCTCTCCGGG - Intergenic
1077336741 11:2008649-2008671 TCTGCACCAGGGAGTTCCCCTGG + Intergenic
1079339893 11:19603141-19603163 TGGGCAGCAGGGAGGTCCACTGG + Intronic
1081814726 11:45932188-45932210 TGCGCACCACAGAGCTCCGCTGG + Intronic
1084230980 11:67752623-67752645 TGGGCACAAGGGAGCTTCGGGGG + Intergenic
1084425845 11:69084204-69084226 TGTACAGCAGGGAGCTCGGGTGG + Intronic
1089870133 11:121665291-121665313 TGTGCACAAGGGAACTTGGCTGG + Intergenic
1090158865 11:124470461-124470483 TCTGCACCAGAGAGCTGAGCTGG - Intergenic
1202819725 11_KI270721v1_random:63831-63853 TCTGCACCAGGGAGTTCCCCTGG + Intergenic
1096609890 12:52794184-52794206 TGTTGTCCAGGTAGCTCCGCAGG + Exonic
1101512163 12:105403244-105403266 TGGGCACCAGGGACCTTTGCTGG + Intergenic
1114137871 14:19873443-19873465 TATTTACCTGGGAGCTCCGCTGG + Intergenic
1114189563 14:20430154-20430176 TGTCCACCAGGGAGTTGCGGAGG - Exonic
1115164657 14:30434827-30434849 TATCCACCAAGGAGCTCAGCAGG - Intergenic
1115347497 14:32358928-32358950 TCTGCACCTGGGACCTCAGCAGG - Intronic
1119674574 14:76544262-76544284 TGAGCCCCAGGGAGCTCAGGGGG - Intergenic
1121690053 14:95871738-95871760 TGCTAACCAGGGAGCTCTGCTGG + Intergenic
1122773371 14:104106810-104106832 TGGGCACCAGGGCATTCCGCAGG - Exonic
1125431034 15:39593626-39593648 TGTGCCACAGGGCGTTCCGCAGG - Exonic
1125594186 15:40873863-40873885 TGTGCACCGGGGAGCTGGGGCGG - Intronic
1128263828 15:66251897-66251919 TGTGCACCAGGAAAATCCGCCGG + Intronic
1128660864 15:69500015-69500037 TGTGCTCCAGTGAGCTCAGTGGG - Intergenic
1131181308 15:90241778-90241800 TGTCACCCGGGGAGCTCCGCCGG + Exonic
1133449474 16:5891620-5891642 GGTGCACCAGGAAGCTCCGAGGG + Intergenic
1137582336 16:49640931-49640953 TGTGCCCCAGAGAGCCCAGCTGG - Intronic
1139442950 16:66977836-66977858 TGAGCACCAGGGGGCGCTGCAGG + Intergenic
1140541261 16:75758480-75758502 TTTTCACCAGGGAGCTTCCCTGG - Intronic
1146400202 17:32495502-32495524 TGTGCAGCAGGAAGCCCCGCTGG + Intronic
1147296858 17:39490639-39490661 TCTCCACCAGGGAGCTCTGGAGG - Exonic
1147670106 17:42171980-42172002 GGTGCACCAGCGAGGTCTGCAGG + Exonic
1149863166 17:60135544-60135566 TGTGCCCCAGAGAGCACTGCAGG - Intergenic
1150391224 17:64790933-64790955 TGTGCCCCAGGCAGGTCCCCAGG - Intergenic
1150410010 17:64934976-64934998 TGTGCCCCAGGCAGGTCCCCAGG - Intergenic
1151197552 17:72442507-72442529 TGTGAACCACGGAGCCCGGCTGG - Intergenic
1152217910 17:79045166-79045188 TCTGCACCTGGGAGGCCCGCAGG - Intronic
1154254239 18:12768700-12768722 TGTCCACCACAGAGCTCCCCAGG - Intergenic
1156368372 18:36450307-36450329 TTCCCACCAGGGAGCTCCGCTGG - Intronic
1158935393 18:62360082-62360104 TGTGCCCCAGGGTGGTCAGCTGG + Intronic
1160990206 19:1857326-1857348 TGTGCACCTGGGGGCCCGGCTGG - Intronic
1161313928 19:3609131-3609153 TGGGCACCAGGGAGCTACGGAGG - Intergenic
1161988882 19:7672760-7672782 TGTGCCCCAGGGAGCTGAGGCGG - Intergenic
1162968857 19:14168203-14168225 GTTCCAGCAGGGAGCTCCGCAGG + Intronic
1165329093 19:35131543-35131565 CTTGCCCCAGGGACCTCCGCGGG - Exonic
1166991943 19:46697837-46697859 TGTACCCCAGGGAGCTGCGAAGG + Exonic
1168113580 19:54208633-54208655 TGGGCTCCTGGGAGCTCCCCTGG + Intronic
925178699 2:1802592-1802614 GGTGCCCCAGGGACCTCGGCAGG - Intronic
925898391 2:8490457-8490479 TGTGCACCAGAGAACTCCCTTGG + Intergenic
927155138 2:20216984-20217006 TGTGCACCATGGATCTCCAAAGG - Intronic
935407846 2:102728013-102728035 TGTTCAGAAGGGAGCTACGCCGG - Intronic
936231035 2:110699725-110699747 TGTTAACCAAGGAGCTCCTCAGG - Intergenic
938288490 2:130137255-130137277 AGGCCACCAGGGAGCTCAGCGGG + Intergenic
938468041 2:131535681-131535703 AGGCCACCAGGGAGCTCAGCGGG - Intergenic
938796000 2:134718812-134718834 CGCGCACCGGGGAGCTCAGCGGG + Exonic
940911569 2:159214448-159214470 TGTGCACCATGGTTCTCAGCAGG - Intronic
944325706 2:198401177-198401199 TGTGAACCAGGGAGCGCAGGTGG - Intronic
946054493 2:216889010-216889032 TGAGCAGCAGGAAGCTCCCCTGG - Intergenic
947580456 2:231313601-231313623 TGTGCACAAGGGAGCTTTGCAGG - Intronic
948260830 2:236603462-236603484 TGTGCGCCAGGGAGCACCTCAGG - Intergenic
949042621 2:241856287-241856309 CGTGCAGGATGGAGCTCCGCAGG - Intronic
1172827715 20:37804620-37804642 TGTGAGCCAGGAAGCTCCTCAGG + Intronic
1174393534 20:50232711-50232733 TGTGCCCCAAGAAGCTCTGCTGG + Intergenic
1175219411 20:57408405-57408427 TGTGCGCCTGGGAGCTCCTCCGG - Exonic
1175626444 20:60492138-60492160 ATTGCACCAGGGAGCTTCTCTGG + Intergenic
1175963510 20:62648655-62648677 TGTGCACAGGAGAGCTCAGCTGG + Intronic
1179275137 21:39885366-39885388 AGGGCAACCGGGAGCTCCGCTGG - Intronic
1180074909 21:45457383-45457405 TGGGGACCAGGGAGGTCTGCAGG + Intronic
1180967182 22:19796704-19796726 CTTGCACCAGGGAGCCCAGCTGG + Intronic
1182295428 22:29309209-29309231 GGTGCCCCAGGGGGCTCTGCAGG + Intronic
1184233582 22:43171373-43171395 TGTGCACCAGGGAGGACAGGAGG + Intronic
1184662607 22:45972311-45972333 CCTGCATCGGGGAGCTCCGCGGG - Intronic
950579008 3:13850694-13850716 AGTGCACCAGGGAGCTCCGGGGG - Intronic
957964200 3:87301606-87301628 GGGGCTCCAGGGAGCTCCACAGG - Intergenic
960381813 3:116971707-116971729 TATCCTCCAGGGAACTCCGCAGG + Intronic
966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG + Intronic
966824817 3:183954647-183954669 AGTGCGCCAGGGAGATCCTCAGG - Intronic
967284759 3:187858272-187858294 TGGGCCCCTGGAAGCTCCGCCGG - Intergenic
968271654 3:197407758-197407780 GGAGCACCAGGGAGCTGCCCAGG - Intergenic
968688494 4:1977162-1977184 TGTGCACCAGGAGGCTCCGCCGG + Intronic
969450816 4:7271950-7271972 GGGGCAGCAGGGAGCTCTGCGGG + Intronic
969861466 4:10039253-10039275 TGTGCATGAGGGTGCTCCACTGG - Intronic
969921427 4:10544048-10544070 GGTCCACCAGGGAGCTCTGGAGG - Intronic
973623262 4:52748063-52748085 TGTGGACCAGGGAGCAGTGCAGG + Intronic
978847589 4:113292430-113292452 TTTGCACCAGGCCGCTCAGCAGG + Exonic
987075786 5:14380470-14380492 TCTGCTCCAGGGCGCTCCCCAGG + Intronic
989676736 5:43981759-43981781 CCTGCCCCAGGGAACTCCGCAGG + Intergenic
997718900 5:136062503-136062525 TAGGCACCAGGGAGTTCCTCAGG - Intronic
1002683721 5:180990480-180990502 CGTCCAGCACGGAGCTCCGCTGG + Intronic
1006752545 6:36387713-36387735 TGTGCGCCCGGGTCCTCCGCAGG + Exonic
1013406534 6:109848792-109848814 TGTTCAGCAGGGACCTCAGCTGG - Intergenic
1013619263 6:111872830-111872852 TGGCCGCCAGGGCGCTCCGCGGG - Intronic
1013956509 6:115848217-115848239 TGTGCATCAGGGAGACCCACAGG - Intergenic
1018214361 6:161512774-161512796 TGTGCACCAGGGAGGCCAGGAGG - Intronic
1020291011 7:6722176-6722198 TGGGCTCCTGGGAGCTCAGCTGG - Intergenic
1023834332 7:44059521-44059543 TCTGCACCAGGGAACACAGCAGG - Exonic
1024255310 7:47536421-47536443 TGTGGACCACAGAGCACCGCTGG + Intronic
1026480178 7:70771980-70772002 TGTGCGCCAGGTTGTTCCGCAGG + Intronic
1030535533 7:110761930-110761952 TGTTGACCAGGGAGCTATGCTGG - Intronic
1034275645 7:149822697-149822719 AGTTAACCAGGGAGCTGCGCAGG + Intergenic
1035584303 8:760086-760108 TGTGCAGCAGTCAGCTCTGCAGG - Intergenic
1038420719 8:27432380-27432402 TGGGCACCTGGCAGCTCTGCAGG + Intronic
1040412625 8:47169561-47169583 GGTGCAACAGGAAGCTCCACTGG + Intergenic
1049249906 8:141582755-141582777 TGAGCAGCAGCGGGCTCCGCAGG + Intergenic
1049497935 8:142945415-142945437 TGTGCACCACGGAGCACTTCCGG - Intergenic
1049653378 8:143787060-143787082 GGGGCACCAGGGAGCTCCAGAGG + Intergenic
1051096966 9:13477390-13477412 TGTCCACCAGGGTGCTCCTTGGG - Intergenic
1053100144 9:35364767-35364789 TGTGCTCCAGGGATATCTGCAGG - Intronic
1053161793 9:35818577-35818599 TGTGAACCAGGGAGCCCCGGGGG + Intronic
1057259390 9:93575807-93575829 TGAGCATCAGGGAAGTCCGCGGG + Intergenic
1058116878 9:101094426-101094448 TGTGCTCCAGAGAGCTTCTCTGG - Intronic
1060757829 9:126225822-126225844 TGTGAGCAAGAGAGCTCCGCTGG + Intergenic
1061119868 9:128635938-128635960 TGTACCCCAGGGAGCTTTGCCGG + Intronic
1061136143 9:128735026-128735048 TGTGCACCACTGAGCCCAGCAGG + Intronic
1061478698 9:130885710-130885732 TGTGCTGCAGGCAGCTCCGACGG - Intronic
1062389131 9:136327241-136327263 TGTGACCCAGGGACCCCCGCGGG + Intergenic
1186017525 X:5214414-5214436 GGTGCAGCAGGGGTCTCCGCTGG + Intergenic
1187254599 X:17630596-17630618 TGTGCCCCAGAGATCTCCGTGGG + Intronic
1193671312 X:84389770-84389792 TGTGCACTGGGCAGCTCCGGTGG - Intronic
1196950769 X:120874563-120874585 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196951609 X:120930965-120930987 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196952293 X:120935826-120935848 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196952978 X:120940687-120940709 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196953663 X:120945547-120945569 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196954348 X:120950408-120950430 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196955031 X:120955268-120955290 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196955719 X:120960151-120960173 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196956400 X:120965012-120965034 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196957082 X:120969872-120969894 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196957764 X:120974732-120974754 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196958446 X:120979592-120979614 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1196959127 X:120984452-120984474 GGTTCAGGAGGGAGCTCCGCAGG - Intronic
1199675237 X:150183154-150183176 CCTTCACCAGGGAGCTCGGCAGG + Intergenic