ID: 901266834

View in Genome Browser
Species Human (GRCh38)
Location 1:7917337-7917359
Sequence CAGGATAGACAAATTGACAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901266834 Original CRISPR CAGGATAGACAAATTGACAA TGG Exonic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901347321 1:8557417-8557439 CAGGATCGACATAATGAAAATGG - Exonic
901940022 1:12654902-12654924 CAGTAAAGATTAATTGACAAAGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
908056656 1:60294488-60294510 CAGGATGGAAAGATTGCCAAGGG - Intergenic
909736469 1:78968571-78968593 CAGTATAGATTAAATGACAAAGG - Intronic
912327983 1:108786632-108786654 AAGGATAGACAAATTGACCATGG - Intronic
912912948 1:113781170-113781192 CAGGATAGTCAATTTTAAAATGG - Intronic
915012390 1:152699452-152699474 AAGAATAGAAGAATTGACAATGG - Intergenic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918493854 1:185112156-185112178 CAGGAGATACATATTGGCAAGGG + Intergenic
919671153 1:200339397-200339419 CAGGATAATGAAATTGACCAGGG + Intergenic
920080542 1:203369634-203369656 CAGGAGAGGAAAAATGACAAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922633437 1:227138633-227138655 CAGGATAGGGAAATAGACTAGGG + Intronic
922995011 1:229949662-229949684 AAGGATAGACATATGAACAATGG + Intergenic
923392867 1:233531185-233531207 CAGTAAAGATTAATTGACAAAGG + Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924259689 1:242216589-242216611 CAGTATAGATTAAATGACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1064064674 10:12171352-12171374 CAGAATAGACAAACTGATAGAGG - Intronic
1066642035 10:37563792-37563814 CAGGATAGACAAATATTTAAAGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067096734 10:43306300-43306322 CAGTAAAGATTAATTGACAAAGG + Intergenic
1067517248 10:46961842-46961864 CAGAATGGACAAAATAACAAAGG - Intronic
1067555887 10:47270555-47270577 CAAGACAGACAAATAGACTATGG - Intergenic
1067645000 10:48089987-48090009 CAGAATGGACAAAATAACAAAGG + Intergenic
1068532448 10:58204899-58204921 AAGGATAGACAATATGAAAATGG + Intronic
1070228146 10:74533429-74533451 AATGATAGACAAATAGTCAATGG + Intronic
1071854800 10:89613346-89613368 CAGTGTGGACAATTTGACAAGGG - Intronic
1074263080 10:111873421-111873443 CAGGATAGACAGGGTGGCAAGGG + Intergenic
1078733467 11:13998272-13998294 CAGAATAGAGAAAATGACACAGG - Intronic
1079849082 11:25507014-25507036 AAGGGTAGAAAAATTAACAAAGG - Intergenic
1080285923 11:30611449-30611471 AAGGACAGACAAATAGATAATGG - Intergenic
1080356547 11:31453709-31453731 CAGCATAGAAAAACTGGCAAGGG + Intronic
1081928530 11:46851002-46851024 CAGTATAGATTAAATGACAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1082915040 11:58424335-58424357 GAGGAAAGACAAATTGAAGAAGG - Intergenic
1084663440 11:70560965-70560987 CAAGCTAGACAAATAGATAATGG + Intronic
1086502241 11:87465328-87465350 CAGGATAATAAAATTGAGAATGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086925726 11:92638701-92638723 CAGGATAGCAAAATTTACATCGG - Intronic
1088060537 11:105644087-105644109 CAGCATAGAAAAATTTTCAAAGG + Intronic
1088137875 11:106579072-106579094 CAATATAAACAAATTGACTATGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088412163 11:109546337-109546359 CAGAATAGGCAAATTCACACAGG + Intergenic
1091499075 12:998211-998233 CAGGATAGTAAAATAGACATTGG - Intronic
1092631970 12:10390506-10390528 ATAGATAGACAAATTGAGAAGGG + Intronic
1092836533 12:12494511-12494533 CAGGATAAACAAAATGGCAGTGG + Intronic
1093150586 12:15616619-15616641 CAGTAAAGATTAATTGACAAAGG + Intergenic
1093384656 12:18537461-18537483 CATGATAAAAAAACTGACAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093858924 12:24139411-24139433 CAGGATGGAAAAATGGAAAAAGG + Intergenic
1095577327 12:43756007-43756029 CAGGAAAGATAAATTGCCCAGGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096019085 12:48307288-48307310 CAAAAAAGACAAATTGTCAAAGG - Intergenic
1096025643 12:48358753-48358775 AAGGAGAGACAAATTGATTAGGG - Intergenic
1096419683 12:51446428-51446450 AAGGAGAGACAAATAGAGAAAGG + Intronic
1097247124 12:57612761-57612783 CAGGATAGAAAATTTCACCAGGG - Intronic
1097516841 12:60617289-60617311 CAGGACAGACTGATTGTCAAAGG + Intergenic
1098790897 12:74820550-74820572 CAGTATAGATTAAATGACAAAGG - Intergenic
1099780379 12:87187233-87187255 TAGGATGGAAAACTTGACAAGGG + Intergenic
1100040329 12:90309828-90309850 AAGGATAGACAAGATTACAAAGG + Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102550743 12:113690023-113690045 CAGAATAGGCAAATTCACAGGGG - Intergenic
1102850510 12:116240087-116240109 TAAGATAGAAAAATGGACAAAGG - Intronic
1103099501 12:118160359-118160381 CTGGGTAGAAAAAGTGACAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104304730 12:127599475-127599497 CAGGATAAACAGATTTTCAAGGG - Intergenic
1104344098 12:127980310-127980332 CAGTAAAGATTAATTGACAAAGG - Intergenic
1104599947 12:130146034-130146056 TTGGATGGACAAATTGGCAAGGG - Intergenic
1105455240 13:20534371-20534393 CAGTATAGATTAAATGACAAAGG + Intergenic
1107079185 13:36356200-36356222 CAGTAAAGATTAATTGACAAAGG - Intronic
1107090726 13:36476352-36476374 AAGGAAAGACACATTGAAAAGGG - Intergenic
1107170132 13:37331819-37331841 CAGGATAGTCAAAGTGTCTAGGG + Intergenic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1109154902 13:58896910-58896932 CAAGAAGAACAAATTGACAATGG + Intergenic
1110109262 13:71723067-71723089 TAGGATAGAGAAATGTACAACGG - Intronic
1111007243 13:82263891-82263913 CAGGATATAGCAATTGAGAAGGG + Intergenic
1114874382 14:26697638-26697660 CTGGATAGAGAAATTGCCAGAGG + Intergenic
1114909556 14:27173108-27173130 CATTATAGTCAAATTGACAAGGG - Intergenic
1116563385 14:46413138-46413160 CAGTAAAGATTAATTGACAAAGG - Intergenic
1116584363 14:46683912-46683934 CAGTAAAGATTAATTGACAAAGG - Intergenic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1117020592 14:51566202-51566224 TAGGATAGTCAAATGAACAAAGG + Intronic
1117469952 14:56033518-56033540 CAGAATAGAAAAATTGATAATGG + Intergenic
1120103844 14:80472849-80472871 CAGTATAGATTAAATGACAAAGG - Intergenic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1120461822 14:84806781-84806803 CTGGATGGACAATTTGGCAAAGG - Intergenic
1121061899 14:90918814-90918836 CAGGATAGACAAATGATCAATGG - Intronic
1121205753 14:92165635-92165657 AAAGATAAACAAATTGAAAATGG - Exonic
1121593701 14:95141518-95141540 CAGGAAAAACAAATTGGCAGTGG + Intronic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123204906 14:106702954-106702976 CAGTAAAGATTAATTGACAAAGG - Intergenic
1123209908 14:106749395-106749417 CAGTAAAGATTAATTGACAAAGG - Intergenic
1123890921 15:24777811-24777833 CAGAATAGAGAAATTGTCCATGG - Intergenic
1124044235 15:26133616-26133638 GGGGATAGACAAATAGACGAGGG + Intergenic
1125120054 15:36145525-36145547 AAGGATTGACAAAATAACAATGG - Intergenic
1125428492 15:39573385-39573407 CAGGATGGACAAACTGGCAAAGG + Intergenic
1125989294 15:44090097-44090119 CAGGATAGACAAGTTTAAAATGG - Intronic
1126949934 15:53869759-53869781 CAGTATAGATTAAATGACAAAGG + Intergenic
1130004541 15:80082398-80082420 CAGATAGGACAAATTGACAAAGG + Intronic
1131212993 15:90513619-90513641 CAGTAAAGATTAATTGACAAAGG + Intergenic
1135822181 16:25693532-25693554 CAGGATGGCTAAATTGACTAAGG + Intronic
1137061839 16:35798052-35798074 CAGTAAAGACTAATTGACAAAGG - Intergenic
1137062513 16:35804340-35804362 CAGTCAAGACTAATTGACAAAGG - Intergenic
1137062745 16:35806739-35806761 CAGTCAAGACTAATTGACAAAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1138073341 16:54015890-54015912 CAGGATAGAAAAATGGCCAAGGG - Intronic
1138326851 16:56179867-56179889 CAGGACAGCCATATAGACAATGG - Intergenic
1138984187 16:62306833-62306855 CAGGGCAGAGAAATTGACAGGGG - Intergenic
1138987316 16:62345463-62345485 TAGGATAGATAAATTAATAAAGG - Intergenic
1139143403 16:64295751-64295773 AAAGATAGACAAATAGTCAATGG - Intergenic
1139236833 16:65348679-65348701 AAGGTTAGAAAAATTGGCAAAGG - Intergenic
1140926213 16:79586419-79586441 CAGGATAGACAAAGCAACAGAGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1146150353 17:30463232-30463254 CAGGATAGAGATAGTGACAGGGG - Intronic
1147535536 17:41319239-41319261 CCGAGTAGAAAAATTGACAATGG + Intergenic
1148318939 17:46732801-46732823 GGGGATAGAAAAATTGAAAAGGG + Intronic
1152398917 17:80052176-80052198 CAGGATAGATATATAGAGAAAGG + Intronic
1153280877 18:3412742-3412764 CAGGCTAGGAAACTTGACAAGGG - Intronic
1153379985 18:4427621-4427643 TAGGAGAGACAAATCAACAAAGG + Intronic
1154287930 18:13077651-13077673 AAGGACAGACACATTGTCAACGG - Intronic
1155037399 18:22036454-22036476 TAGGATGGACAAAGTGAGAATGG - Intergenic
1156279047 18:35615239-35615261 AAGCATAGACAAATAGATAATGG + Intronic
1157114630 18:44851579-44851601 CAGGAGAGAGAAAGGGACAAAGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157989535 18:52478109-52478131 CAGGATATACATATAGACCAGGG - Intronic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158290721 18:55938932-55938954 CAGGAATGAAAAATGGACAAGGG + Intergenic
1158477232 18:57790952-57790974 CAAGATGGACAAATTGCCTAAGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159274895 18:66206107-66206129 CAGGGTAGGCAACTTGACCAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161303813 19:3556267-3556289 CAGGCTAGACAGACTGACAAAGG + Intronic
1161445733 19:4318118-4318140 CAGGAGAGACAAGATGGCAAAGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164129407 19:22348404-22348426 CAGGAAAGTCAAATTGCTAAGGG - Intergenic
1164811051 19:31156124-31156146 CAGAATAGGCAAATTAACATTGG - Intergenic
1164993537 19:32702187-32702209 CAGTAAAGATTAATTGACAAAGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
927747636 2:25635920-25635942 AAGGATAGACAAACAGACCAGGG + Intronic
927935991 2:27077092-27077114 CAGGACAGAAAAAGTGCCAAGGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928239235 2:29572197-29572219 CAGGATAAACAAATCCAAAATGG - Intronic
928415352 2:31087160-31087182 CAGAAGACACAACTTGACAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937039771 2:118812293-118812315 CCGAACAGAAAAATTGACAAAGG - Intergenic
937540961 2:122952905-122952927 CAGAATAGACAAATTCATAGAGG + Intergenic
937565302 2:123278617-123278639 TAGGATATACAAAATGTCAAGGG + Intergenic
937702143 2:124875487-124875509 CAGGTTAGATAAATTCACCAAGG - Intronic
939632550 2:144542950-144542972 CAGAATAGGCAAATTTACAAAGG - Intergenic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941311354 2:163936152-163936174 CAGGGTAGATAAACTGACTATGG + Intergenic
942093846 2:172519540-172519562 CAGTAAAGATTAATTGACAAAGG - Intergenic
942960573 2:181825512-181825534 CAGGATAGCCTCATTGAGAAGGG + Intergenic
945692864 2:213063419-213063441 CAGGATAAACAAATTTCCCAAGG - Intronic
946936626 2:224728493-224728515 TAGTATACACAAAATGACAATGG + Intergenic
947029958 2:225782654-225782676 GAGGATGGAGGAATTGACAAGGG - Intergenic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
948691995 2:239711948-239711970 CAGGATAGAAGAGGTGACAACGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181894141 22:26092271-26092293 GAAGATAAACAAATTGCCAAAGG + Intergenic
949586076 3:5439042-5439064 CAGCTTTGACAAATTGACAAAGG - Intergenic
949868490 3:8567090-8567112 AAGGATAGATAAACTGCCAATGG - Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950860521 3:16143971-16143993 CAGTAAAGATTAATTGACAAAGG + Intergenic
950996355 3:17501597-17501619 CAGGGTAGACAATTTTAGAAGGG - Intronic
951437399 3:22680605-22680627 CAGGTTATACAGAGTGACAAGGG + Intergenic
954795309 3:53158394-53158416 CAGGCTAGACACATTGCCCAGGG - Intronic
955063665 3:55516118-55516140 CCTGATAGACTAATTAACAACGG + Intronic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958266487 3:91443776-91443798 CAGAATCGACAAATTAACATTGG - Intergenic
959140918 3:102486151-102486173 CAGGATAAACAACTTGATATGGG + Intergenic
959317287 3:104823716-104823738 CAGTATAGATAAAATGACAAAGG - Intergenic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
963180316 3:142348645-142348667 CAGCACAGACAAATGGACACTGG + Intronic
964174169 3:153805352-153805374 AAGGCTAGATAAATTGCCAAAGG - Intergenic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965780237 3:172278345-172278367 CAGGATAGAACAACTTACAAAGG - Intronic
965814788 3:172625267-172625289 CATGAAAGAAAAAGTGACAAAGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966346656 3:178988504-178988526 CAGTAGAGATTAATTGACAAAGG + Intergenic
967310562 3:188102249-188102271 CAGGATAACAAAACTGACAAAGG - Intergenic
968204903 3:196790777-196790799 TAGTATAGATTAATTGACAAAGG + Intronic
968378771 4:70073-70095 TAGTAAAGACTAATTGACAAAGG + Intronic
969548678 4:7849378-7849400 CAGCATAGAAAAATCAACAAAGG + Intronic
972754272 4:42028795-42028817 CAGGATTGAAAAATTCAAAATGG + Intronic
973020218 4:45195626-45195648 CAGGATTAACACATAGACAAAGG - Intergenic
974052340 4:56952619-56952641 CAAGAAAGAAAAATGGACAAGGG - Intergenic
974175384 4:58315822-58315844 CAGTATAGATATAATGACAAAGG + Intergenic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
974648420 4:64724287-64724309 GAAGATGAACAAATTGACAATGG - Intergenic
974669392 4:65009373-65009395 AAGGAGAGAAAAATTGACGAGGG + Intergenic
974931776 4:68368049-68368071 CAGTAAAGATTAATTGACAAAGG - Intergenic
975423768 4:74202165-74202187 CAGTAAAGATTAATTGACAAAGG + Intronic
979486032 4:121271423-121271445 CTGGGTAGACAAGCTGACAAAGG + Intergenic
979520347 4:121659042-121659064 GAGGATAGAACAATTCACAATGG + Intergenic
980432675 4:132724984-132725006 AAGGAAAAACAAATTGTCAAGGG - Intergenic
980686139 4:136231575-136231597 GAGGAAAGACAAACTGACGAGGG + Intergenic
980746311 4:137021653-137021675 CAGGGTAGACATAGTTACAAAGG + Intergenic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983438202 4:167744716-167744738 CAGGATAGAAGAAGAGACAAAGG + Intergenic
984176634 4:176426672-176426694 CAGTAAAGACAACTTCACAATGG - Intergenic
984268716 4:177524947-177524969 CAGTAAAGATTAATTGACAAAGG - Intergenic
986726238 5:10599535-10599557 TAGGATAGGCAAATTCATAAAGG - Intronic
987287404 5:16470695-16470717 CAGGGTAGATAAATTGTCCAAGG - Intergenic
988234320 5:28521182-28521204 CAGTAAAGATTAATTGACAAAGG + Intergenic
989495687 5:42109388-42109410 CAGTAAAGATTAATTGACAAAGG - Intergenic
992151438 5:73908466-73908488 CAGAAGGGACAAATTGAAAATGG - Intronic
992567795 5:78017697-78017719 CAGGAAAGAAAAATAGGCAAAGG + Intronic
993816031 5:92546626-92546648 AAGGGTAGTCAAATGGACAATGG - Intergenic
994469863 5:100189406-100189428 AAGGATAGTCAAATAGACCAGGG - Intergenic
995027994 5:107446869-107446891 CAGGATATATAAATACACAAAGG + Intronic
995575754 5:113531380-113531402 CAGTATAGATTAAATGACAAAGG + Intronic
996758255 5:126958739-126958761 CAGAGGAGACAAGTTGACAACGG + Intronic
997577336 5:134991435-134991457 TAGGATAGACATATAGACCAAGG + Intronic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
1003816140 6:9842665-9842687 AAAGAAAGAGAAATTGACAATGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1009688143 6:66990539-66990561 CAGGCTAGACTAATTAATAAAGG - Intergenic
1009749546 6:67866234-67866256 CAGTATAGACTAATTGTTAAAGG - Intergenic
1009801679 6:68545783-68545805 CAGTAAAGATTAATTGACAAAGG + Intergenic
1010416557 6:75618090-75618112 GAGGAAAAACAAACTGACAATGG - Intronic
1010938094 6:81885341-81885363 CAGGATAGGCAAACTCACATGGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012023813 6:93962516-93962538 CAGAAAGGACAAATTGAGAAGGG + Intergenic
1012347778 6:98212796-98212818 CAGTATAGACAAAATGACATTGG + Intergenic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1013788380 6:113808422-113808444 CAAGAAAGAGAAATTGACAAAGG + Intergenic
1014082425 6:117303007-117303029 AAGGATAGTCAAATTAAAAAAGG - Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1018080435 6:160255078-160255100 CAGGAGAGACACATTAACAAGGG - Intronic
1020644566 7:10799045-10799067 CAGGATGGCCAGAATGACAAGGG + Intergenic
1021191757 7:17628507-17628529 CAGGAGAAGCAAATTGAAAATGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1023347375 7:39285293-39285315 CATGATGCACAGATTGACAAAGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024086139 7:45893308-45893330 CATGATATACAAATTGACATAGG - Exonic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1033398150 7:140995019-140995041 CAGGAAAAAAAAATTGACACAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1037430884 8:18812240-18812262 CAGGATATTTAAATTGTCAAGGG - Intronic
1037546097 8:19924185-19924207 AAGGATAGACATATAGTCAATGG + Intronic
1038464869 8:27752294-27752316 CAGGACGGTCAAAATGACAAGGG + Intronic
1040842165 8:51795840-51795862 CAGTAAAGATTAATTGACAAAGG + Intronic
1041435416 8:57834562-57834584 CAGAATAGAAAAATCTACAAAGG + Intergenic
1041671948 8:60500411-60500433 CAGGATAGACAAAGTGAAGGGGG - Intergenic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043930434 8:86084333-86084355 AAGGAAAGAAAAATTGACAAAGG - Intronic
1044003680 8:86916165-86916187 CAGGAGAGAGAATTTGACTAAGG + Intronic
1044392735 8:91670847-91670869 CAGGAAAGATAAATTGAAGAGGG + Intergenic
1045169263 8:99645833-99645855 CTGGATAGCCAAATTGGTAATGG - Intronic
1045252970 8:100496638-100496660 CAGGATAGAAAACCTGAGAAGGG + Intergenic
1046510447 8:115195702-115195724 TAGGTTTGACAAATGGACAATGG + Intergenic
1047576255 8:126159001-126159023 CAGCTTAGCTAAATTGACAAAGG - Intergenic
1048685021 8:136895086-136895108 CAGGATATAGAAACTGATAAAGG - Intergenic
1050576772 9:7005025-7005047 CAGTAAAGATTAATTGACAAAGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052422927 9:28267116-28267138 CAGGAAAGACATAGTTACAAAGG - Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1057155427 9:92834030-92834052 CAGTAAAGATTAATTGACAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061554023 9:131355338-131355360 AAGGCTAGACACATAGACAATGG - Intergenic
1061674104 9:132206009-132206031 CAGGTTAGACAACTTGCCCAGGG - Intronic
1185699300 X:2218345-2218367 CAGTAAAGATTAATTGACAAAGG - Intergenic
1191030858 X:55969047-55969069 CTAGATAGAAAAATTAACAAAGG + Intergenic
1192617724 X:72645431-72645453 CAAGATAGAAAAATACACAAAGG - Intronic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1196835367 X:119808730-119808752 CAGGCTAGACAAAGAGGCAAGGG + Intergenic
1196837226 X:119824508-119824530 CAGGCTAGACAAAGAGGCAAGGG + Intergenic
1196978240 X:121183554-121183576 CAGTAAAGATTAATTGACAAAGG - Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1197641126 X:128969335-128969357 GAAGATTGACAAATTGACAGTGG - Intergenic
1198299587 X:135322056-135322078 CAGCAAAGATTAATTGACAAAGG - Intronic
1199106275 X:143873035-143873057 TAGAATAGACAAATTGAAGAGGG + Intergenic
1199172992 X:144753564-144753586 CAGTATAGATTAAATGACAAAGG + Intergenic
1199825195 X:151491676-151491698 CAGAATAGGCAAATTCACAGAGG - Intergenic
1200976396 Y:9216206-9216228 CAGTAAAGATTAATTGACAAAGG + Intergenic
1201853926 Y:18520045-18520067 CAGTAACGACTAATTGACAAAGG + Intergenic
1201879395 Y:18800339-18800361 CAGTAACGACTAATTGACAAAGG - Intronic
1202134772 Y:21650324-21650346 CAGTAAAGATTAATTGACAAAGG - Intergenic