ID: 901271288

View in Genome Browser
Species Human (GRCh38)
Location 1:7953982-7954004
Sequence CTGGGCCCAGCAGGTGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901271282_901271288 5 Left 901271282 1:7953954-7953976 CCTGCGGGCTGCGGTCACCAGAA 0: 1
1: 0
2: 1
3: 5
4: 67
Right 901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG 0: 1
1: 0
2: 4
3: 32
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901271288 Original CRISPR CTGGGCCCAGCAGGTGCCAA GGG Intergenic
900353333 1:2247759-2247781 CTGGGCCCCACAGGTGCCCTTGG + Intronic
900422507 1:2561702-2561724 CTGGGACCAGCAGCTCCCACTGG + Exonic
900902594 1:5527064-5527086 AGGGGCCCATCAGGTCCCAAAGG + Intergenic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
901721797 1:11204587-11204609 CAGGGCCCAGCAGGAGCGCAGGG + Exonic
901854891 1:12038345-12038367 CTGGGCCCTGCAGCTGCCAATGG - Intergenic
903189697 1:21649835-21649857 CTGGGCCAAGCTGGTGAGAAGGG - Intronic
903575584 1:24337739-24337761 CGGACCCCAGCAGGTGGCAAAGG + Exonic
904602751 1:31682950-31682972 CTGGCCCCAGGAGGTCCCACAGG + Exonic
904679861 1:32221896-32221918 CTGGGCCCAGCAGTTGCTACAGG - Exonic
904813499 1:33179380-33179402 CTGCACCCAGCAGATGCCCATGG - Intronic
905168949 1:36098785-36098807 CAGGGCCCATCAGGGGCCAAAGG - Exonic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
905417654 1:37815389-37815411 CTGGGCCCATCAGGAGCCTGGGG + Exonic
907525779 1:55053205-55053227 CTGGGCCCTGCAGGTCACACTGG + Intronic
911906250 1:103571628-103571650 CTGAGCCCAGCAGAACCCAATGG - Exonic
911909719 1:103617466-103617488 CTGAGCCCAGCAGAACCCAATGG - Exonic
911912817 1:103656356-103656378 CTGAGCCCAGCAGAACCCAATGG - Exonic
911915638 1:103695592-103695614 CTGAGCCCAGCAGAACCCAATGG + Exonic
911920229 1:103750495-103750517 CTGAGCCCAGCAGAACCCAATGG - Exonic
911975578 1:104489919-104489941 CTGGACCCACCTGGTGACAAGGG + Intergenic
913578007 1:120196925-120196947 CTGGGCGGAGCAGGTGGCAGAGG + Intergenic
913580816 1:120224968-120224990 CTGCACCCAGCATGAGCCAAAGG - Intergenic
913627362 1:120673431-120673453 CTGCACCCAGCATGAGCCAAAGG + Intergenic
913630165 1:120701427-120701449 CTGGGCGGAGCAGGTGGCAGAGG - Intergenic
914343563 1:146779672-146779694 CTGGGCCCTGCAGGGGGCAGTGG - Intergenic
914559923 1:148808345-148808367 CTGGGCGGAGCAGGTGGCAGAGG + Intronic
914562749 1:148836406-148836428 CTGCACCCAGCATGAGCCAAAGG - Intronic
914610080 1:149293816-149293838 CTGCACCCAGCATGAGCCAAAGG + Intergenic
914612910 1:149321870-149321892 CTGGGCGGAGCAGGTGGCAGAGG - Intergenic
914899931 1:151706451-151706473 CTCAGCCCTGCAGGTGCCACTGG - Intronic
914958894 1:152189012-152189034 CCGGGCCCAGCAGCTGCCTGGGG - Intergenic
915232924 1:154459110-154459132 CTGGGCCCAGCTGGTCCCATTGG + Intronic
915597596 1:156904418-156904440 CTGGGCCCAGCTGGCGGCGATGG - Intronic
915962601 1:160279573-160279595 TCGGGCCCACCAGGTGCCAGTGG - Exonic
916245993 1:162688841-162688863 CTGTGACTGGCAGGTGCCAAGGG - Intronic
916792327 1:168136065-168136087 CTTGGCCCAGAAGGCGCCGAGGG + Intronic
916856741 1:168757843-168757865 CTGGGAGCATCAGCTGCCAATGG + Intergenic
918304861 1:183236478-183236500 CCTGGCCCAGCAGTTGACAAGGG + Exonic
920247159 1:204596790-204596812 CTGGGCCAAGCAGGTACCAATGG + Intergenic
924009109 1:239644837-239644859 CAGGGCCCAGCAGGGTCCCATGG + Intronic
924917677 1:248590354-248590376 CTGGGCCCAGCAGCTGTGATTGG + Intergenic
1062896685 10:1108749-1108771 CAGGGCCCTGCAGGTTCCACGGG - Intronic
1063156993 10:3389056-3389078 AGGGGACCTGCAGGTGCCAATGG + Intergenic
1065534913 10:26707357-26707379 TTGGTCACAGCTGGTGCCAAGGG - Intronic
1065917473 10:30365431-30365453 CTTGGCCCAGAAGGAGCCAGAGG - Intronic
1066064217 10:31750510-31750532 CGGGGCCCAGCGGCTGCCCAGGG - Intergenic
1067055633 10:43048343-43048365 CTGTGCCCAGCAGCTGCCCAGGG - Intergenic
1072623858 10:97098585-97098607 CTGGGCTGGGCAGGTGCCCAAGG + Intronic
1072899125 10:99391949-99391971 CTTGGCTCAGAAGGTGCCATTGG + Exonic
1073030038 10:100518921-100518943 CTGTGACCAGCAGGTGGCACTGG - Intronic
1073523308 10:104155347-104155369 ATGGGCACAGCAGCTGGCAAAGG + Intronic
1074991442 10:118712262-118712284 CTGGGTCCCACAGCTGCCAAGGG + Intronic
1075260942 10:120963466-120963488 CTGGGCCGAGCAGGTGCAAGTGG - Intergenic
1075836445 10:125457373-125457395 CTGTGCACAGCAGATGCCACAGG + Intergenic
1076320755 10:129579897-129579919 CTGGGACCAGAAAGTGTCAAGGG - Intronic
1077158230 11:1100995-1101017 CTGGCCCCGGCATGTACCAATGG + Intergenic
1077244133 11:1527838-1527860 CCAGGGCCAGCAGGTGCCCAAGG + Intergenic
1077265069 11:1644656-1644678 CTGGTCCCTACAGGTGCAAAAGG + Intergenic
1077357208 11:2123884-2123906 CTGGCCACAGCAGGTGCCATTGG + Intergenic
1077368989 11:2172811-2172833 CTGGGAGCAGGAGGTGCCAGTGG - Intergenic
1077473801 11:2777055-2777077 CTGGGCCCAGCAGCCTGCAATGG + Intronic
1077887244 11:6395217-6395239 CTGGACCCAGCAGGGGCAGAAGG - Exonic
1078039429 11:7844922-7844944 CTGGGCCCTGCCAATGCCAAAGG + Intergenic
1078428390 11:11269194-11269216 ATGGGCTAAGCAGGTGCCTATGG + Intergenic
1078455537 11:11471820-11471842 CTGGGCAGGGCAGGAGCCAAGGG - Intronic
1080585052 11:33674362-33674384 CTGGGGCCAACAGGACCCAAGGG + Intergenic
1081618131 11:44602635-44602657 CTGGGCCTAGAAGGGACCAAAGG - Intronic
1081764375 11:45599296-45599318 CTGGGGTCAGCAGGGGGCAATGG + Intergenic
1083299165 11:61731240-61731262 CAGGGCCCAGCAGTTCCCCAGGG - Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1084948512 11:72651993-72652015 CTGGGGCCAGCAAGTGTCCATGG - Intronic
1084961972 11:72721565-72721587 CTGGGTCCACCAGGAGCCCACGG - Intronic
1085507544 11:77068770-77068792 CTGGGGGCAGGAGGTGCCCAGGG + Intronic
1086847805 11:91773668-91773690 CTGGACCCAGCAGTTCCCAGGGG - Intergenic
1089121587 11:116139436-116139458 CTAGGTCCAGCAGGTGGAAAAGG - Intergenic
1089188219 11:116635482-116635504 CTGCCTCCAGCAGGTGCCAGAGG - Intergenic
1090917393 11:131177588-131177610 CTGGGCCCAGCACTTCCCAGAGG - Intergenic
1091207478 11:133831600-133831622 CTGGGTCCAGCAGGTCCTCAGGG + Intergenic
1091673241 12:2467683-2467705 GTGGGCCTGGCAGGTGCTAAGGG - Intronic
1092397680 12:8142631-8142653 CAGGGCCCAGCAGGTGCTGAGGG + Intronic
1095982618 12:47981783-47981805 CCTGGCCCAGCTGGTGCTAATGG - Exonic
1096536067 12:52275606-52275628 ATGGGGCCAGAAGATGCCAAAGG - Intronic
1097986289 12:65786267-65786289 ATGGGCCCAGCAAGTAGCAAGGG + Intergenic
1098740825 12:74171423-74171445 ATGGGCCAAGCAGCTGACAAAGG + Intergenic
1099077681 12:78131063-78131085 CTGGGCCCTGAGGGTTCCAAGGG + Intronic
1101966887 12:109287834-109287856 GGGTGCCCAGCAGGTACCAAGGG - Exonic
1102697990 12:114815087-114815109 CTGGACTCAGCAGCTGCCTAGGG + Intergenic
1102910444 12:116709513-116709535 CTGAGTCCAGCACGTGCCTAGGG + Intergenic
1103200715 12:119085785-119085807 CTTGGACCAGGAGGTGGCAATGG + Intronic
1103484625 12:121274260-121274282 CTGGGACCCGGAGGTGTCAAGGG + Exonic
1103704823 12:122865836-122865858 CAGGGCCCAGCAGGGGGCAGTGG - Exonic
1103943957 12:124516163-124516185 CTTGGGCCAGCAGGAGCCAGTGG - Intronic
1103971535 12:124675726-124675748 CTGGGCCCAGCCTCTGCCGAAGG + Intergenic
1104485414 12:129147970-129147992 ATGGGCTCTGCAGGTGCCCATGG - Intronic
1104735199 12:131132158-131132180 CTGAGCCCAGCAGATGGCCAGGG - Intronic
1104877517 12:132046035-132046057 CTGGGTCCACCAGGAGCCCAAGG - Intronic
1105247043 13:18662731-18662753 CTCTGCTCAGAAGGTGCCAATGG + Intergenic
1106132749 13:26953193-26953215 CTGGGACCACCTGGTGCCCAGGG - Intergenic
1106555308 13:30803896-30803918 CTGTGCACAGCAGCTGCCCAGGG + Intergenic
1107069458 13:36254953-36254975 CAGGGGCCAGGAAGTGCCAAAGG - Intronic
1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG + Intronic
1109210658 13:59531661-59531683 CTGGGCCCAGCAGGGGCTGAGGG + Intergenic
1113592492 13:111510970-111510992 CTGGACCCAGCAGCTGCCTGCGG - Intergenic
1113748728 13:112764248-112764270 CGGGGCCCCGCAGGTGTCAGAGG - Intronic
1113885344 13:113655969-113655991 CTGAGCCCAGCTGGTGCTGAAGG - Intronic
1114615726 14:24067338-24067360 CTCAGTCCAGCAGTTGCCAAAGG + Intronic
1116671200 14:47845689-47845711 CTGGGAACTGCAGGTGCCAAAGG + Intergenic
1118331108 14:64816792-64816814 CTTGGCTGAGGAGGTGCCAAGGG - Intronic
1118891189 14:69910667-69910689 CTGGGCTCAGCAGCTGCATAGGG + Intronic
1119903233 14:78279685-78279707 CAGGTCCCAGCATGTTCCAATGG - Intronic
1119968497 14:78943400-78943422 CTGGGCTCAGCAGCAGTCAAGGG + Intronic
1120771930 14:88388491-88388513 CTGGACCCAGAATGAGCCAAAGG - Intronic
1121175894 14:91890424-91890446 CTGGGCCAAGCAGCTGCCAGGGG + Intronic
1121336976 14:93083576-93083598 CTGGTACCTGGAGGTGCCAAAGG - Intronic
1121446372 14:93981581-93981603 CTGGGCACAGCAGGAGACACAGG - Intergenic
1122117258 14:99533959-99533981 CTGTGGCCTGCAGGGGCCAAGGG + Intronic
1122804003 14:104247620-104247642 CAGGGCCCAGCAGCCCCCAAAGG - Intergenic
1122814060 14:104303701-104303723 CAGGGCCCAGCAGGATCCAGAGG - Intergenic
1123449052 15:20349141-20349163 GTGGGTCCAGGAGATGCCAAGGG + Intergenic
1123473582 15:20571743-20571765 CTCGGCCCAGAAGGAGCCAGAGG + Intergenic
1123644427 15:22428610-22428632 CTCGGCCCAGAAGGAGCCAGAGG - Intergenic
1123665743 15:22608518-22608540 CTCGGCCCAGAAGGAGCCAGAGG - Intergenic
1123733880 15:23166754-23166776 CTCGGCCCAGAAGGAGCCAGAGG + Intergenic
1123752017 15:23364134-23364156 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1124284383 15:28388059-28388081 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1124298314 15:28523555-28523577 CTCGGCCCAGAAGGAGCCAGAGG - Intronic
1124319564 15:28702932-28702954 CTCGGCCCAGAAGGAGCCAGAGG - Intronic
1124482947 15:30092499-30092521 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1124489399 15:30144570-30144592 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1124520630 15:30404719-30404741 CTCGGCCCAGAAGGAGCCAGAGG - Intronic
1124538027 15:30561500-30561522 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1124544487 15:30613561-30613583 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1124564450 15:30800996-30801018 CTCGGCCCAGAAGGAGCCAGAGG + Intergenic
1124754130 15:32393757-32393779 CTCGGCCCAGAAGGAGCCAGAGG - Intronic
1124760623 15:32446085-32446107 CTCGGCCCAGAAGGAGCCAGAGG - Intronic
1124778009 15:32602977-32602999 CTCGGCCCAGAAGGAGCCAGAGG + Intronic
1125134788 15:36328820-36328842 CTGTGGGCAGCAGGTGCGAAGGG - Intergenic
1125501142 15:40240933-40240955 CTGGGCCAAGCCAGTGCCACCGG + Intronic
1125609978 15:40963418-40963440 CTGTGCCCAGCAGGTGTTATTGG + Intergenic
1125716159 15:41821121-41821143 CAGGTCCCAGCTGGTGGCAAAGG - Intronic
1125761954 15:42102990-42103012 CTGGGCCTTGCAGGTGGCATAGG - Intergenic
1127172645 15:56319642-56319664 CTGGGCCCAGCAGAAACCTAGGG + Intronic
1127772645 15:62243710-62243732 CTTGGCCCAGAAGGAGCCAGAGG - Intergenic
1128336616 15:66790286-66790308 GTGGGCTCAGATGGTGCCAAGGG - Intergenic
1128388140 15:67165109-67165131 GTGGGGACAGCAGGTGCCAGGGG + Intronic
1128414249 15:67429715-67429737 TGGGGCCCAGCTGGGGCCAATGG - Intronic
1128787702 15:70410457-70410479 CTGGGGCCAGCTGCTGCCAGGGG + Intergenic
1129264429 15:74386333-74386355 ATGGGCTCAGCAGGTGCAAAGGG + Intergenic
1129691406 15:77715770-77715792 CTGTCCCCAACAGGTGCCCAGGG + Intronic
1129763188 15:78143766-78143788 CTGGTGGCAGCAGCTGCCAAGGG + Intronic
1130027592 15:80283219-80283241 CTGGGACCAGCAGGTGAGCAAGG - Intergenic
1130894221 15:88157998-88158020 CCGGGCCCGTGAGGTGCCAAAGG - Intronic
1131260214 15:90884151-90884173 CTGGGCCCAGCATCTGCCTGGGG + Intronic
1131282312 15:91032005-91032027 CTTGGCCCAGAAGGAGCCAGAGG - Intergenic
1132079821 15:98854423-98854445 CTGGGCTCATGAGGTGCCTAGGG + Intronic
1132184528 15:99792007-99792029 CTCGGCCCAGCAGAAGCCAGAGG + Intergenic
1134009880 16:10843931-10843953 CTGGGCCCCGCATTGGCCAATGG - Intergenic
1134763532 16:16735149-16735171 CTGGGCCCGGCCGGTGACATTGG + Intergenic
1134982520 16:18624008-18624030 CTGGGCCCGGCCGGTGACATTGG - Intergenic
1136269251 16:29138868-29138890 GTGGGCCCAGGAGGAGCCATTGG - Intergenic
1136349349 16:29696941-29696963 CTGGGCCCAGCACCTGGCACTGG - Intronic
1137300318 16:47143278-47143300 CTGGGCCCAGCAGGGCCCTCCGG - Intronic
1138381807 16:56607864-56607886 CAGGCCCCAGCAGATGCTAACGG - Intergenic
1138382370 16:56611436-56611458 CAGGCCCCAGCAGATGCTAACGG - Intergenic
1138589859 16:57993821-57993843 CTGGGTACAGAAGGTGCGAAAGG - Intergenic
1138660193 16:58512119-58512141 CTGGGCCCAGCTGGTGCTGTAGG + Exonic
1139990428 16:70935662-70935684 CTGGGCCCTGCAGGGGGCAGTGG + Intronic
1140479325 16:75253881-75253903 CTGCGCCCAGCCAGTGCCAGGGG + Intronic
1141478840 16:84292771-84292793 CTGGGCCTAGCGGGAGGCAAAGG + Intergenic
1141678336 16:85529518-85529540 CTGCCCCCAACAGGTGCCAAGGG - Intergenic
1141699482 16:85635901-85635923 CTGGGCCCAGCAGCGGCCGTGGG + Intronic
1142072734 16:88100140-88100162 GTGGGCCCAGGAGGAGCCATCGG - Intronic
1142488766 17:263959-263981 CTGGGTCCAGCAGGAAACAAGGG + Intronic
1142549362 17:728503-728525 CTGGGCACAGCAGCTCACAACGG - Intergenic
1142709350 17:1715142-1715164 CTGTGCCAAGCAGGTGCCCTTGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143379045 17:6484354-6484376 CTGGGCCCAGCTGGCCCTAAAGG + Intronic
1143639683 17:8189010-8189032 CAGGGCCCAGCAGGACCCTAAGG - Exonic
1145013859 17:19384519-19384541 CTGGGCCCAGTTGATGCCATTGG + Exonic
1145059170 17:19721389-19721411 CTGGGCCTGGAAGGTGCCCAGGG - Intergenic
1146296589 17:31655022-31655044 CAGGGCCCAGCAGCAGCCAGGGG + Intergenic
1147140622 17:38458733-38458755 CTGTGGCCAGCAGGGGCCAGGGG - Intronic
1147170827 17:38617759-38617781 GTGGGCCCTGCAGGTGCCCACGG + Intergenic
1148049860 17:44764521-44764543 CTGGGCCCAGCTTGTTCCCAGGG + Intronic
1148087186 17:45001268-45001290 CAGGCCCCAGCAGGTGTGAATGG - Intergenic
1148465818 17:47864739-47864761 CTGGGCACCGAAGGTGCCAGTGG + Intergenic
1148535521 17:48435280-48435302 CTGGGCTCAGCAGTGCCCAACGG - Intergenic
1148746956 17:49923918-49923940 CAGGGCCCTGAAGGTTCCAATGG - Intergenic
1148747489 17:49926898-49926920 ATGGGCCCAGGAGGCCCCAAAGG - Intergenic
1148783977 17:50136228-50136250 TGGGGGCCAGCAGGAGCCAAAGG + Intronic
1150229919 17:63544200-63544222 CTGGGCCTAGCTGGTTCCACAGG - Intronic
1151822996 17:76507140-76507162 CTGGGCTGAGCAGGTGACAGGGG - Intergenic
1151825875 17:76523851-76523873 CTGGGCCCACCAGGGGCCCTGGG + Intergenic
1151957100 17:77385896-77385918 CTCGGGCCAGCAGTTTCCAAAGG - Intronic
1152044828 17:77929055-77929077 CTGGTCCCAGCAGGTGGCTGTGG + Intergenic
1152339592 17:79716723-79716745 GTGGGTCCAGGAGATGCCAAGGG - Intergenic
1152697628 17:81804700-81804722 CTGGGCCGCGCCGGTGCCACCGG - Intronic
1154064730 18:11096261-11096283 CTTGGGCCAGCAGGTTCCATTGG - Intronic
1154172722 18:12062975-12062997 CAGGGCCCAGCTGGACCCAAGGG - Intergenic
1155837906 18:30610203-30610225 CTTGGCCCAGGATGGGCCAATGG + Intergenic
1156520471 18:37717887-37717909 GTGGGCCCAGAAGGAGCTAAGGG + Intergenic
1157391019 18:47303486-47303508 CTGGGCCCAGAAAGTTCCAGGGG + Intergenic
1159005348 18:63005519-63005541 CCGGGCCCAGCAGGTGCTTCTGG + Intergenic
1160574969 18:79848128-79848150 GTGGGCTCAGCAGCTGCCAGGGG + Intergenic
1160923925 19:1533949-1533971 CCGGGTCCAGCAGGTGGCACAGG - Exonic
1161027754 19:2044482-2044504 AGGGTCCCAGCAGGTGCCAGGGG - Intronic
1161028072 19:2045791-2045813 CTGGGTCCAGCAGCCGCCCAGGG + Intronic
1161041524 19:2113146-2113168 GTGGGCCAAGCAGGGGCCAGGGG - Intronic
1161429413 19:4222803-4222825 CTGGGCCACGCAGGGGCCAGGGG + Intronic
1161479529 19:4503622-4503644 CTGGGCCCAGCAGCTGCCCCTGG - Exonic
1161997096 19:7719897-7719919 CTGGGGGCAGCAGGGCCCAAGGG - Intergenic
1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG + Intronic
1162322361 19:9977655-9977677 TTGGGCCCAGCAGGAGGCATTGG - Exonic
1162395251 19:10414464-10414486 GAGGGCCCACCAGGTGCTAAAGG + Intronic
1163031250 19:14545611-14545633 CTGAGCCCAGCAGCTGGCACAGG + Intronic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163740131 19:19006715-19006737 CAGGGCCCAGCAGCTCCCCAAGG + Intronic
1164156857 19:22602407-22602429 CTGGGCCCAGAAGCAGCCAGAGG + Intergenic
1166197973 19:41219236-41219258 CTGGGCAGAGCCGGTGGCAAGGG + Exonic
1167513260 19:49908204-49908226 CTGGGGCCCGCAGGTCCCTAGGG - Exonic
925275606 2:2645809-2645831 CTGAGGCAAGCAGGTGCCACGGG - Intergenic
925821754 2:7805542-7805564 CTGGGCCCCACAGATGCTAAAGG + Intergenic
926142626 2:10377447-10377469 GTGGGCACAGCAGGTGCCCGCGG - Intronic
926387649 2:12353067-12353089 GTGGGCCCAGCAGCTGGGAATGG + Intergenic
927467890 2:23350764-23350786 CTGGGCCCAGAGGTTGCAAAGGG + Intergenic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
928272970 2:29873714-29873736 CTGGGCAAAGCAGGGGCCCATGG + Intronic
930093917 2:47552263-47552285 CTGTGCCCTGCAGGTGGGAAAGG - Intronic
932446217 2:71783077-71783099 CTGGCCCCTGCTGGTGGCAAGGG - Intergenic
934714202 2:96533866-96533888 CCAGGCTCAGCAGTTGCCAAAGG - Intergenic
934853275 2:97714249-97714271 CAGGGCCCAGCAGGAGCCCAGGG - Intronic
934925676 2:98380380-98380402 CTGGCCCCAGCAGGCACCAGAGG - Intronic
935443769 2:103135453-103135475 ATGGGCACAGCATGTGCCGATGG + Intergenic
936705003 2:115061777-115061799 GTAGGCACAGCAAGTGCCAAGGG + Intronic
936974917 2:118209231-118209253 CTGGGCCCTGGAGGTTACAAGGG + Intergenic
937245327 2:120488795-120488817 CTGCCAACAGCAGGTGCCAAGGG + Intergenic
939263016 2:139834299-139834321 CTGGGCCCAGAAGCTCCCATGGG - Intergenic
942484262 2:176422778-176422800 CTGGGCCCACCTGGCCCCAAAGG + Intergenic
944687897 2:202134085-202134107 CTGGCCCCAGCAGGAACCAATGG - Intronic
944892301 2:204130095-204130117 CTGGGCCCAGCAGCTCTCATTGG - Intergenic
945102627 2:206275317-206275339 CTCGGCCCCACAGGTGCCCAGGG - Intronic
945770816 2:214040024-214040046 GTGGGCCCAGGTGGAGCCAATGG + Intronic
946053918 2:216885110-216885132 CAAGGCCGAGGAGGTGCCAAGGG - Intergenic
947386230 2:229593335-229593357 AGGGGTCCAGCAGGTGCAAAGGG - Intronic
947592253 2:231392613-231392635 CGGAGCCCAGCAGGGGCCACGGG - Intergenic
947621389 2:231593468-231593490 CATGTCACAGCAGGTGCCAATGG + Exonic
947828369 2:233121915-233121937 CTGCAACCAGCAGCTGCCAAGGG - Intronic
948594934 2:239073838-239073860 CTGGGTCCAGCAAGAGTCAAAGG - Intronic
948648769 2:239425913-239425935 CTGGGCACAGCTGATGCCACGGG + Intergenic
948792545 2:240386403-240386425 CTGGGCCCACCAGGTCCTAGTGG - Intergenic
1168816244 20:739263-739285 CTGCGCACAGCAGCTGCCCAAGG - Intergenic
1169388497 20:5170592-5170614 CAGGGCCGAACAGGTGCCAACGG - Intronic
1170083614 20:12504552-12504574 CTGGGCCTGGCATGTGGCAAAGG + Intergenic
1171481333 20:25458015-25458037 TTGGGCCCGGCAGGTGCCGTGGG - Intronic
1173819185 20:46009799-46009821 CTCTGCCCAGCTGGGGCCAAAGG - Intronic
1173894819 20:46542681-46542703 CTGGGCCCTGCAGTTTCCATAGG + Intronic
1175281549 20:57807175-57807197 ATGGACCCAGCAAGGGCCAAGGG - Intergenic
1175414934 20:58794939-58794961 CTGGGCCCAGGAGGGGCCCCTGG - Intergenic
1175930408 20:62491277-62491299 CTGGGCACAGCAGGAGCAAGGGG - Intergenic
1176454267 21:6894787-6894809 CTCTGCTCAGAAGGTGCCAATGG + Intergenic
1176832441 21:13759835-13759857 CTCTGCTCAGAAGGTGCCAATGG + Intergenic
1176889692 21:14299579-14299601 CTGGACCCAGCTCTTGCCAAAGG - Intergenic
1177225335 21:18245615-18245637 CCGGGCTCAGCACCTGCCAAAGG + Intronic
1178365624 21:31986815-31986837 CAGGGAACAGCAGGTGCCCATGG - Intronic
1179657157 21:42852539-42852561 CAGGGGCCAGCAGGTGCGACAGG + Intronic
1180081412 21:45489444-45489466 CTGGCCCCAGCAGGTGCTCACGG + Intronic
1180082159 21:45491875-45491897 CTGGGCCCTGCATCTGCCCAGGG - Intronic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180957952 22:19749646-19749668 CAGGGCTCAGCAGGTGCAAGGGG + Intergenic
1181182261 22:21076702-21076724 TTATGCACAGCAGGTGCCAAAGG - Intergenic
1181282846 22:21731998-21732020 CAAGGCCCTGCAGGTGCCAGAGG + Intronic
1181543718 22:23588583-23588605 GTCTGCCCAGCAGGTGCCTAGGG + Intergenic
1181625802 22:24121363-24121385 CAGGGCACAGCAGGTGACACAGG + Intronic
1182923981 22:34105574-34105596 CTGGACCAAGCAGTTGGCAATGG - Intergenic
1183307336 22:37089684-37089706 TGGGGCCCTGCAGGTGCCACAGG + Exonic
1183324793 22:37185333-37185355 CTGTGGCCAGCGGCTGCCAACGG - Exonic
1183708510 22:39489202-39489224 CTGTGGCCAGGAGGTGCCACTGG + Exonic
1183961812 22:41415830-41415852 CTGAACCAAGCAGGGGCCAAGGG - Intergenic
1184442984 22:44529930-44529952 CTTGGCCCAGCATGTTCCATTGG + Intergenic
1185292749 22:50035345-50035367 CTGCCCCCAGCAGGTGTGAATGG - Intronic
1185310493 22:50151627-50151649 CTGGGCCCAGCAGCTGCTCACGG - Intronic
949290711 3:2462322-2462344 TTGTGCCCAGCAAGAGCCAATGG + Intronic
950400931 3:12768864-12768886 CTCGGCCCTGCAGGAGCCCATGG + Intronic
950462830 3:13135479-13135501 CAGGGCCCAGGAGGTGACATGGG + Intergenic
950671880 3:14532226-14532248 CTGGTCCCCGCAGGTGGCAGAGG + Intronic
951029210 3:17862934-17862956 CTGGGCCCACCTGGGGCCAGGGG - Intronic
952942064 3:38453275-38453297 CTAAGCCCAGCAGGTGGAAAAGG - Intergenic
954104713 3:48403778-48403800 CTATGCCCAGCAGGTACCAGGGG - Intergenic
954780595 3:53056622-53056644 CTAAGCCCAGCAGGTGGCTATGG - Intronic
956080025 3:65548470-65548492 CTGGGCTCAGCTGGAGCAAATGG - Intronic
958892267 3:99795165-99795187 CAGGGGCCACCAGGTCCCAAGGG + Exonic
961371330 3:126433740-126433762 CTGGGCACAGCCAGTGCCCATGG - Intronic
961602527 3:128072587-128072609 CTGAGGCCAGCAGGTGCAGAGGG - Intronic
963106088 3:141648545-141648567 CTGGGCCCAGCAGATGACAGGGG - Intergenic
966472856 3:180311373-180311395 CTGATGCCAGGAGGTGCCAAAGG + Intergenic
966881005 3:184351286-184351308 CTGGGACCAGCAGAAGCCAAGGG - Intronic
967895969 3:194396746-194396768 GTGGGCCCAGCCGGTGACCACGG - Exonic
968487005 4:867645-867667 CTGGGCCGAGGAGGTGCCGAGGG - Intronic
968589725 4:1451284-1451306 CTGGACGCAGCAGGTGCTCAGGG + Intergenic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
969303116 4:6309106-6309128 CTGGGCCGCGCAGGAGCCCACGG + Intergenic
969513145 4:7631229-7631251 CTGAGCCCTGCAGGAGCCAGCGG - Intronic
970591239 4:17562250-17562272 ATGGGGCCAGCAGGCTCCAAAGG - Intergenic
971190581 4:24424851-24424873 ATGTTCCCAGCAGGTGTCAACGG - Intergenic
971264763 4:25087953-25087975 CTGGGTTCAGCAGGTGCAGAGGG + Intergenic
977168553 4:93730989-93731011 CTTTGCCCAGCAGGTGTCACGGG - Intronic
977667312 4:99655769-99655791 CTGGGCCTGGCAGGTGACAAGGG - Intergenic
978450875 4:108832387-108832409 CATGGCCCTGCAGGTCCCAAAGG - Exonic
979609055 4:122670502-122670524 TTGGGCCCTGCAGGAGCCCACGG - Intergenic
982102299 4:151979709-151979731 ATAGTCCCAGCAGGTGCAAAAGG + Intergenic
985493241 5:191276-191298 CTGAGCCAAGCAGCTCCCAACGG + Intergenic
985493248 5:191307-191329 CTGAGCCAAGCAGCTCCCAACGG + Intergenic
985493255 5:191338-191360 CTGAGCCAAGCAGCTCCCAACGG + Intergenic
986810991 5:11359732-11359754 CTGGGCCTAGTAGGGGACAAAGG + Intronic
986963522 5:13244066-13244088 CTAGGCCGAGGAGGTGCCGAGGG - Intergenic
989520804 5:42397446-42397468 CTGGACCCCGCACCTGCCAAGGG - Intergenic
989606053 5:43245669-43245691 CTGAGGACAGCAGGTGCCCAGGG - Exonic
990252911 5:53935094-53935116 CTGTACCCAGCAAGTGCCAAAGG - Intronic
992500498 5:77338062-77338084 CTGGGCCCCGCAGTGGCCCACGG - Intronic
992992349 5:82297194-82297216 GAGGGACCAGCAGGTGCTAAGGG + Intronic
993126818 5:83845608-83845630 CTCTCCCCAGCAGGTGCCTAAGG + Intergenic
994511491 5:100709397-100709419 CTTGGCCCAGCAGTTAGCAAAGG + Intergenic
994660078 5:102642404-102642426 CTGTGCCCACCAGGGGCCTAGGG + Intergenic
994916979 5:105993664-105993686 CAGGCTCCAGCAGGTCCCAAAGG + Intergenic
995388343 5:111612386-111612408 CTGGGGCCAGCAGCTGCGGAGGG - Intergenic
995700362 5:114928976-114928998 CTGGGGCCAGCAGCTGCGGAGGG + Intergenic
997260579 5:132462986-132463008 TTGGGCCCAGCAGGGGTCAGAGG - Exonic
997827079 5:137116091-137116113 CCCAGCCCAGCTGGTGCCAAGGG + Intronic
998352561 5:141511114-141511136 AAGGCCCCAGCAGGTGGCAATGG + Exonic
1001080136 5:168661496-168661518 ATGGCCACAGAAGGTGCCAAGGG - Intergenic
1002471740 5:179439550-179439572 CTGGGCCCAGAGGTTGGCAAAGG - Intergenic
1002683807 5:180991006-180991028 CTGGGCTGAGGAGGTTCCAAAGG + Intronic
1003185451 6:3826470-3826492 CTGGGCCCTGCCTGTGCCCAAGG + Intergenic
1003270306 6:4602340-4602362 CTGGGCCCCGCAGGTCACACTGG - Intergenic
1003309513 6:4957284-4957306 CTGGGCACAGCAGGAGCCTAGGG + Intergenic
1003493515 6:6643914-6643936 CTGGGCCCAGCAGGTGGGAAAGG + Intronic
1003529538 6:6926518-6926540 TTGGGCCCAGCAGCTGAAAAGGG + Intergenic
1005989371 6:30893486-30893508 CTGTGCCCTGCAGGTCCCACTGG - Intronic
1006792969 6:36715717-36715739 CTGGACACAGCAGGGGTCAAGGG + Intronic
1006950892 6:37820119-37820141 CTGGGCCCAGCCCGGGCCTACGG + Intronic
1007417572 6:41700932-41700954 CAGGGCCCAGCTGGTCCCAGTGG - Intronic
1008763098 6:54878141-54878163 CTGAACCCAGCAGAGGCCAAAGG - Intronic
1009423667 6:63490844-63490866 CTGGGACCAACGGGAGCCAATGG + Intergenic
1010324521 6:74549755-74549777 CTGGGCCCACCCAGGGCCAAGGG - Intergenic
1011914542 6:92487839-92487861 CTGGGCCCACCAGGGGCCTGGGG - Intergenic
1013980196 6:116120824-116120846 GTGGGCCCAGCAGGAGCAAAGGG - Exonic
1017716643 6:157217936-157217958 CTGGGCTCAGCAGGTGGAGAGGG + Intergenic
1018906194 6:168077595-168077617 CCAGGCCCAGCAGGGGCCACAGG + Intronic
1019068395 6:169321795-169321817 CTGGGCCCTGCAGGGGCGCAAGG + Intergenic
1019148628 6:169989406-169989428 CTGGCCTGAGCAGGTGCCAGGGG - Intergenic
1019411092 7:907066-907088 CTGGACCCAGCAGCTGCGGACGG - Intronic
1019999952 7:4749957-4749979 CCGGGCCTAGAAGGTGCCACTGG - Intronic
1020009340 7:4799843-4799865 CGGGGGCCTGTAGGTGCCAAGGG - Intronic
1020016354 7:4834304-4834326 CTGGGCCCAGCTGGACCCCAGGG + Intronic
1022492092 7:30828762-30828784 CTGTGCCCATCAGGGCCCAAGGG + Intronic
1023015932 7:35968687-35968709 CTGGTCCCAGCCGCAGCCAACGG + Intergenic
1023340286 7:39212344-39212366 CTGAGCTCAGGAGATGCCAATGG + Intronic
1025019376 7:55468619-55468641 ATGGGCCCAGCAGGTGGCCCAGG + Intronic
1025959109 7:66205157-66205179 CTGGGTCCGGCAGGCGCCGAGGG - Intergenic
1026848371 7:73710085-73710107 CTGGGCCCAGCAGGCACAAGGGG + Intronic
1030085464 7:105811837-105811859 CTTGGCCCACCAGGAGCCATGGG - Intronic
1032403740 7:131641186-131641208 CTGGGTCAAGCATGTGCCATGGG + Intergenic
1032471771 7:132184202-132184224 CTGGTCCCAGCAGGGGGCAGCGG + Intronic
1032850224 7:135788773-135788795 ATTGGCCCAGCAGATGCCAGAGG + Intergenic
1033038891 7:137900388-137900410 CTGGGCACAGCAAGTGCTAGAGG + Intronic
1033311885 7:140267671-140267693 CTGGGCCCAGTGTGTGCCATGGG - Intergenic
1034285214 7:149879523-149879545 CTGGGCACAGCAGCGGCCGAGGG + Exonic
1034415925 7:150964183-150964205 CTGACCCCAGAAGGTGCCTAAGG - Intronic
1034491013 7:151392994-151393016 CTGGGGACAGAAGGTGCCCATGG - Intronic
1035568516 8:657974-657996 CTGGGCCCACCAGCCCCCAAGGG + Intronic
1035579725 8:731994-732016 CTGTGTCCAGCAGGTGCCTGGGG - Intronic
1037417516 8:18667690-18667712 CTGGTCCCATCAGCTGCCTAAGG - Intronic
1038439118 8:27559360-27559382 CTGGCCCCAGCAGGTGAGAATGG - Intergenic
1039580125 8:38658822-38658844 CTGGGATCAGCAGCTGCCTATGG + Intergenic
1041195978 8:55401669-55401691 CTGGGTCCATCTGGGGCCAAAGG + Intronic
1041315559 8:56558495-56558517 TATGGCCCAGCAGGAGCCAAGGG + Intergenic
1047727181 8:127694132-127694154 CTGGGCCCATCTGGTGGCAGAGG - Intergenic
1048785036 8:138041615-138041637 CTGGGTCAACCAGGTTCCAAAGG + Intergenic
1048993586 8:139775446-139775468 CTGGGCCCAGCCCAGGCCAAAGG - Intronic
1049116670 8:140694661-140694683 CTGGGCCTAGCTCATGCCAAAGG + Intronic
1049799805 8:144512518-144512540 CTTGGCCCAGCAGCTGCCTGAGG - Exonic
1050064287 9:1742601-1742623 CTGGGCACAGCAGAGGCCTATGG - Intergenic
1053269421 9:36739956-36739978 CGTGGCCCCGCAGGTGCCATGGG - Intergenic
1053493218 9:38527116-38527138 TTGAGCCAGGCAGGTGCCAAGGG - Intergenic
1055031906 9:71778816-71778838 GTGGACCCAGCAGATGCCAATGG + Intronic
1056113716 9:83421693-83421715 CTGGAGCCAGCAGTTGCCAATGG + Intronic
1057183039 9:93040077-93040099 TTGGGCCCAGCCGGTGCCTGGGG + Intergenic
1057277196 9:93682229-93682251 CTGGGTCCAGCCGGGGCGAAAGG - Intergenic
1057786551 9:98092392-98092414 GAGGGCACAGCAAGTGCCAAGGG - Intronic
1059324541 9:113496243-113496265 CTGGGCCTAACAGGTGCTCAAGG + Intronic
1060246445 9:121950549-121950571 CTGAGGCCAGCAGGTGCCACAGG + Intronic
1060849283 9:126860938-126860960 CTGACCCCAGCAGGTGCCCGGGG - Intronic
1061075684 9:128340330-128340352 CTGGGGACAGCAGGGGGCAAGGG + Intergenic
1061611823 9:131751792-131751814 GTGGGCCTAGCAGCTGCCACAGG - Intergenic
1061918353 9:133768905-133768927 CTGGGCCAAGCTGGTTCCACTGG - Intronic
1061964261 9:134004284-134004306 ATGGGCACAGCAGGTACCCAGGG + Intergenic
1062154594 9:135039617-135039639 CTGGGCCCAGCCGTGGCCAGCGG - Intergenic
1062192375 9:135254624-135254646 TTGGGCTCAGCTGGTGCCCAGGG + Intergenic
1062298964 9:135853307-135853329 CTGGGCCAAGCAGGTGCTCCTGG + Intronic
1062535441 9:137019168-137019190 CTGGCTGCAGCAGGTGCCAAGGG - Exonic
1062657462 9:137611719-137611741 CTGGGCCTGGCAGCTGCCGAGGG + Intronic
1185542671 X:915995-916017 CTGAGCCCTGCAGGTGGCTAGGG + Intergenic
1185839506 X:3375533-3375555 GAGGGGCCAGCAGGTGCAAAAGG + Intergenic
1186500867 X:10049729-10049751 CTGGGGACAGCAGGGGACAATGG - Intronic
1189274851 X:39778259-39778281 CTGGGCTCAGTCAGTGCCAAGGG - Intergenic
1189282518 X:39828794-39828816 CAGGGCTCAGCAGCTCCCAAGGG - Intergenic
1191048909 X:56169737-56169759 CTGGACCCACCAGGGGCCTAGGG + Intergenic
1192231080 X:69265460-69265482 CTGGGGGCTGCAGGTGACAAAGG + Intergenic
1193079420 X:77390910-77390932 CAGCTCCCAGCAGGGGCCAATGG + Intergenic
1193187154 X:78527024-78527046 CAAGTCCCAGCAGGTCCCAAAGG + Intergenic
1197429504 X:126342936-126342958 CTGGACCCACCAGGTGCCTGGGG + Intergenic
1198549751 X:137732801-137732823 CTGGTTCCTGCAGGTGCAAAGGG - Intergenic
1198989068 X:142490111-142490133 CTGGGCCCATCAAGTACCATGGG - Intergenic
1200067661 X:153511942-153511964 CTGGGCACAGCAGGGCCCAGCGG + Intergenic
1202372895 Y:24210326-24210348 CTGGGCCCTGCAGGAGGCCATGG - Intergenic
1202497887 Y:25459794-25459816 CTGGGCCCTGCAGGAGGCCATGG + Intergenic