ID: 901274577

View in Genome Browser
Species Human (GRCh38)
Location 1:7981178-7981200
Sequence GAAACTTCCCACAGTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901274577_901274582 18 Left 901274577 1:7981178-7981200 CCCCACTCACTGTGGGAAGTTTC 0: 1
1: 0
2: 2
3: 16
4: 146
Right 901274582 1:7981219-7981241 GTTTCCTCATCCGTTGCCTGAGG 0: 1
1: 0
2: 7
3: 36
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901274577 Original CRISPR GAAACTTCCCACAGTGAGTG GGG (reversed) Intronic
900989171 1:6090200-6090222 GGCACATCCCACAGGGAGTGGGG - Intronic
901274577 1:7981178-7981200 GAAACTTCCCACAGTGAGTGGGG - Intronic
904268418 1:29331737-29331759 GAAACTTCCAGCAGTTAATGTGG - Intergenic
907527794 1:55063811-55063833 GAAATGCCCCACAGTGAGGGAGG - Exonic
907718682 1:56951449-56951471 GAAACATCTCACAGACAGTGGGG - Intronic
909115756 1:71534011-71534033 AAAACTTCACACAGCGAGTGTGG + Intronic
919467904 1:197944550-197944572 GAAAAGTGCAACAGTGAGTGGGG - Intergenic
919662182 1:200258127-200258149 GAGGCTTCCCACAGTGATTTAGG - Intergenic
920254912 1:204648250-204648272 GCACCTTCCCACAGTGAGAGAGG + Intronic
923995548 1:239489995-239490017 TGAAGTTCCCACAGTGAGTAGGG - Intronic
924430168 1:243989826-243989848 CAAACTTCCCAAATTTAGTGGGG - Intergenic
1063096891 10:2916117-2916139 GAAGCTTCCCTGAGTCAGTGGGG - Intergenic
1064733887 10:18360884-18360906 GCTTCTTCCCACAGTGAGTAGGG - Intronic
1066748455 10:38627485-38627507 AAAAGTTCCCACAGTGAGTTTGG + Intergenic
1066968223 10:42290290-42290312 AAAAGTTCCCACTGTGAGTTTGG - Intergenic
1074467017 10:113692315-113692337 GAAAGTCCACACAGGGAGTGGGG + Intronic
1074489039 10:113922356-113922378 AAAACTTACCACAATGAGTGAGG + Intergenic
1076575711 10:131465372-131465394 GAAACTTCCCTCCCAGAGTGGGG + Intergenic
1080037136 11:27721821-27721843 GAAAGTTCCCAGAGAAAGTGAGG + Intronic
1080451134 11:32379858-32379880 CAACCTCCCCACAGTGAGTCAGG - Intergenic
1081368308 11:42264420-42264442 AAAACTTGCCATAGTGAGGGAGG - Intergenic
1082180258 11:49108386-49108408 GGATCTTCTCAGAGTGAGTGGGG - Intergenic
1083822978 11:65182956-65182978 GAAGCGTCCCACGGTGAGAGGGG + Exonic
1091839668 12:3611803-3611825 AAAAAGTCCCACAGAGAGTGTGG + Intronic
1095395798 12:41761170-41761192 GAAACTTCACACAGAAGGTGGGG + Intergenic
1096607965 12:52780328-52780350 GAAAGATCCTACAGTGAATGAGG - Intergenic
1097600018 12:61679728-61679750 GAAACCTCCCCCATTGAGTGTGG - Intergenic
1100388386 12:94124719-94124741 GCAACTTTCGACTGTGAGTGAGG + Intergenic
1101060964 12:100971125-100971147 CAAACATCCCACTGTGTGTGTGG - Intronic
1101481714 12:105104383-105104405 GAAGCTTCACACAGAGAATGTGG + Intergenic
1104545496 12:129708960-129708982 AGAACTTTCCAGAGTGAGTGTGG + Intronic
1107080358 13:36367773-36367795 GAATCATCACATAGTGAGTGAGG - Intronic
1107704887 13:43092091-43092113 AAAACCTCCTACAGTGATTGTGG + Intronic
1108582685 13:51840252-51840274 GAGGCTTCCCAAAGTGAGTCAGG + Intergenic
1109598145 13:64584867-64584889 GAAACTTCCCCAAGTGAATAAGG - Intergenic
1111251442 13:85606888-85606910 GAAACTTCCCAGAATGAGTGTGG - Intergenic
1113317923 13:109203787-109203809 GAAACCTCCTACAGTGACAGAGG - Intronic
1116125443 14:40778401-40778423 GAAATTTCCCAGAGTTAGTGGGG + Intergenic
1117885503 14:60357354-60357376 GAAAATTCTCACAGGAAGTGAGG - Intergenic
1120159623 14:81131356-81131378 GAAAGTTACCAAAGTGAGTAAGG - Intronic
1120540698 14:85747189-85747211 CAAACTTCTCACACTCAGTGCGG - Intergenic
1122563094 14:102631136-102631158 GTCACTTCTCACAGTGAGTTTGG - Intronic
1123927995 15:25137343-25137365 GAAACTTCCCACAGCAAGTAGGG - Intergenic
1125093505 15:35824345-35824367 TAAACTCCCCACTGTAAGTGTGG + Intergenic
1130094458 15:80845701-80845723 TAACCTTCCCACAGTGACTTTGG + Intronic
1130384756 15:83401379-83401401 GACTCTTCCCATACTGAGTGAGG + Intergenic
1132128583 15:99252477-99252499 GAATCTTCCTTCAGTGAGTGTGG + Intronic
1135925724 16:26692183-26692205 GAACCTACCGACGGTGAGTGAGG + Intergenic
1136461573 16:30414244-30414266 GAAACTCCCCACAGTATGTTTGG - Intronic
1137646994 16:50084193-50084215 GAGAATTCCTTCAGTGAGTGCGG + Exonic
1142348003 16:89566125-89566147 GCAGCCTCCCACAGTGGGTGGGG + Exonic
1143505912 17:7365082-7365104 GTACCTTCCCACAATGAATGGGG - Intergenic
1150424008 17:65062701-65062723 GCAACTGGCCACAGTGAATGAGG - Intergenic
1155094819 18:22545430-22545452 GAAAGTTCACACAGTGAGTGTGG - Intergenic
1158674787 18:59508305-59508327 GAAACTTGCCTCACTGGGTGTGG + Intronic
1162125604 19:8498213-8498235 AAGACATCCCGCAGTGAGTGTGG - Exonic
1165423556 19:35733615-35733637 GAAAACCCCCACAGTGCGTGGGG + Exonic
1166055001 19:40283433-40283455 GAAAGGTCCCACAGTCTGTGAGG - Intronic
925145492 2:1580757-1580779 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145571 2:1581125-1581147 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145652 2:1581494-1581516 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145664 2:1581547-1581569 GATCCTTCCCACAGTGAAGGGGG + Intergenic
925145682 2:1581653-1581675 GATCCTTCCCACAGTGAAGGAGG + Intergenic
925145734 2:1581919-1581941 GATGCTTCCCACAGTGAAGGGGG + Intergenic
928108366 2:28487656-28487678 GAAACTTGCCACACAGAGAGCGG - Intronic
928884954 2:36137755-36137777 GTAACTTGCCACAGTGATGGTGG - Intergenic
932632440 2:73356942-73356964 GAAACTTCACACAGTGCTGGTGG + Intergenic
933545351 2:83704203-83704225 GTAACTTTCCACAGAGAATGAGG + Intergenic
934311430 2:91869627-91869649 AAAAGTTCCCACCGTGAGTTTGG + Intergenic
934517845 2:94999832-94999854 ATGACTTCCCACAGTGAATGGGG + Intergenic
936159065 2:110070515-110070537 GTGACTTCCCACAGGGAATGGGG - Intergenic
936185596 2:110300817-110300839 GTGACTTCCCACAGGGAATGGGG + Intergenic
940540198 2:155005188-155005210 GAAATTTCCCAAGGTGAGTAAGG + Intergenic
944342294 2:198616202-198616224 GGAACTTCAGACAGTGATTGTGG + Intergenic
945276762 2:207995555-207995577 TCAAATTCCCACAGTGAGGGAGG - Intronic
946228662 2:218278482-218278504 GAGACTTAACACAGTGAGAGGGG - Intronic
1175296435 20:57912047-57912069 GAGAGTACCCACAGTGAGTGTGG - Intergenic
1176412248 21:6455330-6455352 GAACCTTCCTGCACTGAGTGGGG - Intergenic
1179378362 21:40874404-40874426 GAAACTACCCACATACAGTGTGG + Intergenic
1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG + Exonic
1179939500 21:44628636-44628658 GCTTCTACCCACAGTGAGTGGGG - Intronic
1183403101 22:37616314-37616336 GGAACTTCCCACGGTGAGGCGGG + Intronic
1184443048 22:44530450-44530472 GACACTACCCACAGGGACTGTGG - Intergenic
1184884749 22:47335912-47335934 CAAGCTCCCCAAAGTGAGTGAGG + Intergenic
949996313 3:9619995-9620017 CACAGATCCCACAGTGAGTGCGG + Intergenic
951039063 3:17968031-17968053 CAAACTTCCCTCAGTGGGGGAGG + Intronic
952189625 3:31008965-31008987 TCACATTCCCACAGTGAGTGAGG - Intergenic
955191826 3:56768874-56768896 AAAGCCTCCCACAGTGACTGTGG - Intronic
961395268 3:126582878-126582900 GAAACTGTCCACAGGGAGAGTGG - Intronic
961603767 3:128078768-128078790 GAAACTTCTCATAGTTGGTGAGG + Intronic
961636644 3:128337151-128337173 GAAGCGTCCCTCAGTGAGCGTGG + Intronic
962422759 3:135242477-135242499 GCAACTTCCCAGAGAGACTGTGG + Intronic
963429846 3:145186054-145186076 GAACCTTCTCACAGTGATTTAGG - Intergenic
963654096 3:148023856-148023878 AAATCTTTCCCCAGTGAGTGTGG + Intergenic
964283478 3:155092322-155092344 GATAGTTCCAACTGTGAGTGAGG + Intronic
964478967 3:157123208-157123230 GAAACTGCCCAGAGAGAGTGAGG + Intergenic
971603505 4:28626492-28626514 GAATCTTCCCACAGGGACTCTGG + Intergenic
978438113 4:108707572-108707594 GAAAATTCCCACAGAAGGTGTGG + Intergenic
979195614 4:117916888-117916910 GAGACTTCACACAGGGAGTGGGG + Intergenic
979349439 4:119627985-119628007 GAACCTTGCCAAAGTGAGTGCGG - Intronic
979889068 4:126066419-126066441 GAGACTGCCCACATTGAGGGTGG + Intergenic
980336914 4:131487613-131487635 GAAATTTCCAACAGTAATTGTGG + Intergenic
985091540 4:186367724-186367746 GGAAATTTCCACACTGAGTGTGG - Intergenic
985480149 5:104982-105004 GAAACACTCCACAGTGGGTGAGG + Intergenic
985480172 5:105102-105124 GAAACACTCCACAGTGGGTGAGG + Intergenic
985843621 5:2328392-2328414 GATACTTACAACAGTGAATGGGG + Intergenic
987839592 5:23206259-23206281 GAAATTTCCCAGTGAGAGTGTGG - Intergenic
988975819 5:36514975-36514997 TCAACTGCCCACACTGAGTGAGG - Intergenic
989754888 5:44940388-44940410 TAAACTTGCCTCAGTGTGTGGGG - Intergenic
991219474 5:64195987-64196009 CAAACTCCACACAGTGACTGTGG + Intronic
993964004 5:94337748-94337770 GAAGTTACCTACAGTGAGTGAGG + Intronic
994883099 5:105523222-105523244 GAAAATTCTAACAGTGAGTCTGG + Intergenic
999071586 5:148749182-148749204 GAAACTTCTTACAGTCAGTAGGG + Intergenic
1000474933 5:161695155-161695177 GAAACTACTTACAGTGAATGTGG + Intronic
1003503066 6:6718222-6718244 GAAAGTTTCCACAGTGAGACTGG - Intergenic
1003633052 6:7805866-7805888 GAGGCTTCCCACAGTAAGCGAGG + Intronic
1003831665 6:10018611-10018633 GGAACTGCAGACAGTGAGTGAGG + Intronic
1003990098 6:11477847-11477869 GACATTTCCCAAGGTGAGTGAGG - Intergenic
1005382189 6:25246991-25247013 GACACTTCCCAGAGAAAGTGAGG + Intergenic
1006190305 6:32203623-32203645 GACACTTCCCACTGTGAGCTTGG + Intronic
1006680494 6:35793813-35793835 GGAGATTCCCACAGAGAGTGAGG - Intergenic
1009082600 6:58794698-58794720 GAAATGTTCCACAGTGTGTGTGG - Intergenic
1012340571 6:98117309-98117331 GAGCCTTCCTACAGTGAGTATGG + Intergenic
1013160981 6:107544553-107544575 GAAGCTTCCCTGAGTAAGTGGGG + Intronic
1016917355 6:149257065-149257087 GAAAATTGCCACAGTCAGAGTGG + Intronic
1018915179 6:168128594-168128616 GAAACTCTCCACAGAGAGGGTGG + Intergenic
1019433499 7:1010460-1010482 GGATCTTCCCACACTGTGTGGGG - Intronic
1022248762 7:28586255-28586277 GAAAGACCCCTCAGTGAGTGTGG + Intronic
1022777222 7:33539879-33539901 GTAATTTCCTACAGTCAGTGAGG + Intronic
1024000510 7:45186365-45186387 GAAACTTGCCACAGTCAGGAAGG - Intergenic
1024783599 7:52880441-52880463 GAAGGTTCCCACAGTGAGAAAGG + Intergenic
1026342879 7:69449173-69449195 GAAACTTCCCCCAGTGATGCTGG - Intergenic
1026709972 7:72729276-72729298 GACACTTCATAAAGTGAGTGAGG + Intronic
1027152543 7:75742743-75742765 GCCACTTTCCACAGTGACTGTGG - Intergenic
1028380565 7:90194622-90194644 GAACCGTCCCCCAGTGATTGAGG + Intronic
1028470915 7:91205734-91205756 GAAACTCACCATAGTAAGTGGGG + Intronic
1029167179 7:98600658-98600680 GACACTTCTCACAGTGGGTGTGG - Intergenic
1031936198 7:127738154-127738176 GAAGCTGCCCACAGTGAGAAAGG - Intronic
1033343244 7:140508040-140508062 GAAATTTCCCTCAGTGAAGGTGG + Intergenic
1035061808 7:156074955-156074977 GAAACTCCCCCCACTGATTGAGG - Intergenic
1035200376 7:157260242-157260264 GAATGTTACAACAGTGAGTGCGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037535603 8:19821037-19821059 GTAACTTCCCATAGCCAGTGAGG + Intronic
1038672980 8:29597187-29597209 CAATCTAGCCACAGTGAGTGTGG - Intergenic
1040059337 8:43091300-43091322 GAAACTTCCCACTTTCAGTTTGG + Intergenic
1041417299 8:57625489-57625511 TAAACGACCCACAGTGAATGTGG - Intergenic
1042174994 8:66029854-66029876 GAAACTTTTGACAGTGAGGGTGG + Intronic
1046262200 8:111783099-111783121 GGAACTTCATACAGTGAATGAGG + Intergenic
1047042344 8:121009871-121009893 GAGACTTCCCAGAGTGTTTGAGG + Intergenic
1049948134 9:617972-617994 GTAACTGCCCACAGTAAGTGTGG - Intronic
1060004237 9:119985600-119985622 GAAAGTCCCCATAGTGTGTGTGG + Intergenic
1061721781 9:132556475-132556497 GAAACTTCACAAAGACAGTGAGG - Intronic
1061806190 9:133138979-133139001 GCACGTTGCCACAGTGAGTGTGG - Intronic
1062589221 9:137265967-137265989 GACACTGCCCAGGGTGAGTGTGG + Exonic
1188194495 X:27215811-27215833 GAAACTGCCCAGAGAGAGTGTGG + Intergenic
1188308363 X:28586497-28586519 AAATCTTCCCTAAGTGAGTGGGG - Intergenic
1189440478 X:41031400-41031422 GAAATTACCCACACTGCGTGCGG - Intergenic
1190045259 X:47106436-47106458 GTAATTTCCCACTGTGAGTTAGG - Intergenic
1192162942 X:68802325-68802347 GGAACTTCCCAGAGTCAGTGAGG - Intergenic
1192848761 X:74931577-74931599 AATACTTCCCACAGTGAATAAGG - Intergenic
1192930386 X:75800303-75800325 AAAACTTCCCAGAGTGTGAGAGG + Intergenic
1192995101 X:76505293-76505315 AAAGGATCCCACAGTGAGTGGGG + Intergenic
1195511277 X:105718133-105718155 GAAACCTCACAAACTGAGTGAGG - Intronic
1198055131 X:132986378-132986400 GAATTTTCCCCCAGTGTGTGAGG + Intergenic
1200041144 X:153370429-153370451 GAAACTTCCCACACTGCTGGTGG - Intergenic