ID: 901278152

View in Genome Browser
Species Human (GRCh38)
Location 1:8009296-8009318
Sequence TCCTTCCTATAGAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901278147_901278152 25 Left 901278147 1:8009248-8009270 CCTCACATATACTGACAAGGAAC 0: 1
1: 0
2: 0
3: 6
4: 151
Right 901278152 1:8009296-8009318 TCCTTCCTATAGAAAGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901278152 Original CRISPR TCCTTCCTATAGAAAGTGGG AGG Intronic
901205220 1:7490810-7490832 TCCTTGATGCAGAAAGTGGGAGG + Intronic
901278152 1:8009296-8009318 TCCTTCCTATAGAAAGTGGGAGG + Intronic
902041303 1:13494427-13494449 TCCTTGCTATATAATGTGGTAGG + Intronic
904019848 1:27455222-27455244 TCCTTCCTATGAAAAGGGGTGGG - Intronic
904374846 1:30073906-30073928 TCCTTCCTGAAGAACCTGGGAGG - Intergenic
905792087 1:40795185-40795207 TGCTTCCTATAGCAAGTGCTTGG + Intronic
910246337 1:85142742-85142764 CCCCTCCTCTAGAAACTGGGTGG + Intergenic
912623386 1:111188278-111188300 TGCTTCCTATATCAAGCGGGAGG - Exonic
916007799 1:160677914-160677936 TCTGTCCAATAGAAAGTGGGCGG - Intergenic
916099988 1:161386371-161386393 TCCTTCCTCTTGAACTTGGGTGG + Intergenic
920292133 1:204930677-204930699 GCCTTCCCATTGAAAGTGGGTGG - Intronic
920696817 1:208187043-208187065 TCCTTCCTGTAGGAAGGTGGGGG + Intronic
920810655 1:209282494-209282516 TCCTGCTTATAGAAATTTGGAGG - Intergenic
920915134 1:210252838-210252860 TCCTTCCTGTAGGGAGGGGGTGG - Intergenic
921125012 1:212169764-212169786 TCCTTGCTTAAGTAAGTGGGTGG - Intergenic
921530077 1:216271245-216271267 CCCTTCCTATAGAAAGTCTGGGG - Intronic
924526286 1:244853434-244853456 TTCTTTCTAAAGAAAGTGGGTGG - Exonic
1065018370 10:21482190-21482212 TCCTACCCATAGAAACTTGGGGG - Intergenic
1067037571 10:42931537-42931559 TGCTTCCTAGAGCAGGTGGGAGG + Intergenic
1068144454 10:53049397-53049419 GCCCTCCTACAGAAATTGGGAGG + Intergenic
1068395047 10:56449398-56449420 TCCTTGCTATACTAAGGGGGGGG - Intergenic
1069795213 10:71047436-71047458 TCATTCCTACAGAAACTGTGTGG - Intergenic
1072760874 10:98055494-98055516 CCATGCCTATAGAAAGTGTGAGG - Intergenic
1074468622 10:113706756-113706778 TCCCTCAAATAGTAAGTGGGAGG - Intronic
1075276152 10:121094349-121094371 TTCTGCCTATAGAAAGTTGAGGG + Intergenic
1075568068 10:123519040-123519062 TCCTTCAGATAGGAAGGGGGTGG - Intergenic
1078908776 11:15711761-15711783 TTCTTCGTCTACAAAGTGGGAGG + Intergenic
1080044413 11:27794199-27794221 TCCTTCCTGTAGAGTGTGGGTGG - Intergenic
1080098795 11:28435576-28435598 TCCTGCCTATAGAAAATTAGGGG + Intergenic
1081077596 11:38696009-38696031 TACTTCCTAGATATAGTGGGGGG + Intergenic
1081714210 11:45237065-45237087 TCTTTCCTATAGGAACTAGGAGG - Intergenic
1082795053 11:57372715-57372737 TCCTGCCAATGGAAAGTGGCTGG - Intergenic
1086524671 11:87711362-87711384 TCCTTCCTTTGGAAAGGGGAGGG + Intergenic
1086723957 11:90158582-90158604 TCATACCTCTAGTAAGTGGGGGG - Intronic
1087794342 11:102439337-102439359 TCCTTCCTCTGGAAGCTGGGAGG - Intronic
1088111570 11:106267569-106267591 TACTTCCTAGATACAGTGGGGGG - Intergenic
1088355761 11:108942388-108942410 TCCTTCCTATGAGAAGTGGTAGG - Intergenic
1088596845 11:111447588-111447610 TCCTTCCTAGAGAAGCTGGTGGG - Intronic
1088972271 11:114784214-114784236 TCCTTCTCATAGAATGTGTGAGG - Intergenic
1097307404 12:58084800-58084822 TCCCTCCTCTTGAACGTGGGTGG + Intergenic
1099189792 12:79550606-79550628 TCCTTCTGAGGGAAAGTGGGGGG - Intergenic
1099826055 12:87779500-87779522 TTCTGCCTATAGGAAGTGGAGGG - Intergenic
1100672029 12:96823961-96823983 TCCTTCATCTATAATGTGGGTGG - Intronic
1101836514 12:108299461-108299483 TCCTTCCTGTAGTAAGTGGAAGG + Intronic
1101859255 12:108469265-108469287 TCCTCTTTATAGAAAGTGAGTGG + Intergenic
1104357130 12:128097071-128097093 TCCCTTGTACAGAAAGTGGGAGG + Intergenic
1108748542 13:53421287-53421309 TCCATCCTGTAGAAGTTGGGAGG - Intergenic
1110225160 13:73112011-73112033 TACTTTAGATAGAAAGTGGGGGG - Intergenic
1110422467 13:75328522-75328544 TTCTTCCTATTTAAAGTGAGGGG - Intronic
1110428739 13:75399184-75399206 TCCTGCCTATAGAAGTTTGGGGG - Intronic
1111968800 13:94888753-94888775 TCCTTACTTTACAAAGTTGGGGG - Intergenic
1116075003 14:40100386-40100408 TCCTTTCCATAGAAATTGGAGGG + Intergenic
1121155859 14:91683331-91683353 CCATTTCTATGGAAAGTGGGTGG - Intronic
1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG + Intronic
1123007600 14:105331690-105331712 TCCTTCCTTTGGAGGGTGGGAGG - Intronic
1125760351 15:42092207-42092229 TCCCTCATGTAGAAAATGGGAGG - Intronic
1127198894 15:56621591-56621613 CGCTTCCTATAGAAAGTTGGGGG + Intergenic
1127865413 15:63028677-63028699 TCCTTCTTTTAGAAAGTTGCTGG + Intergenic
1128999095 15:72318612-72318634 TTCTTCCTGTAGAGAGAGGGAGG - Intronic
1129058555 15:72840301-72840323 TCCTTCCCCTTGAGAGTGGGCGG - Intergenic
1129128537 15:73468006-73468028 TCCTTACAAGAGAAAGAGGGAGG - Intronic
1129943480 15:79518917-79518939 TGCTTCCTAGAGGAAGTGTGGGG + Intergenic
1131583503 15:93668618-93668640 TCCTTGCTGTGGACAGTGGGTGG + Intergenic
1132423919 15:101698006-101698028 TCCTTCCTGTAGAAGGCTGGGGG - Intronic
1141590124 16:85062906-85062928 TCCTTCTTAGAGGAAGAGGGTGG + Intronic
1142537643 17:630602-630624 GGCTTCCTATAGAAAGTGATGGG + Intronic
1143118299 17:4592814-4592836 GCCTTCCTAGAGGAGGTGGGAGG + Intronic
1143330145 17:6128455-6128477 TGCTTCCTACTGAGAGTGGGTGG - Intergenic
1148694393 17:49550285-49550307 TGCTTCTGAGAGAAAGTGGGCGG - Intergenic
1149447512 17:56725041-56725063 TCATGTCTAGAGAAAGTGGGAGG - Intergenic
1149547261 17:57512826-57512848 TCCTAACTGTAGAAAGAGGGAGG + Intronic
1150651110 17:67010774-67010796 TCCTTCCTGTGGAAATGGGGTGG + Intronic
1150951548 17:69808159-69808181 TCCTTGTTATAGAAAATGGCAGG + Intergenic
1151220265 17:72606461-72606483 TTCTTCCCATAGTCAGTGGGGGG - Intergenic
1151224707 17:72639930-72639952 TCCTTCCAGTAGAATGCGGGAGG - Intergenic
1151541083 17:74764783-74764805 TCCTCCCTATGGAAAGGGTGAGG - Intronic
1151782855 17:76258837-76258859 TCCTCCCCAGAGAAAGTGGCTGG + Intergenic
1156451969 18:37271846-37271868 TCCTCCCTATGCCAAGTGGGTGG + Intronic
1156460426 18:37318637-37318659 TTCTTGCAGTAGAAAGTGGGGGG - Intronic
1157189644 18:45570067-45570089 TTCATCCTATAGCAAGTGTGTGG + Intronic
1157565302 18:48675584-48675606 TCCTCCCTGCAGCAAGTGGGAGG + Intronic
1159744388 18:72212979-72213001 TCCTTCCTATGGAAATTTTGGGG + Intergenic
1161330454 19:3684381-3684403 TCCTTCCCCTTGAAAGTGGGCGG + Intronic
1162142630 19:8593726-8593748 TCTTTCCTCTAAAAAGTAGGTGG + Intronic
1164146626 19:22516748-22516770 TCATTCCCATGGCAAGTGGGGGG - Intronic
925588248 2:5484735-5484757 TCCTACCTACTGAAATTGGGAGG + Intergenic
927003215 2:18821436-18821458 TCCTTCCTCTAGAAGGAGAGAGG + Intergenic
927315455 2:21676106-21676128 TCCTTCCTGGAGAAAGTTGGGGG - Intergenic
927428869 2:23009522-23009544 TCCTTACTATAGAGATTGGATGG - Intergenic
929582487 2:43091074-43091096 TCCTTCCCATAGAATTTTGGGGG + Intergenic
929789977 2:45014874-45014896 TCTTTCCTGCAGAAAGTGGTGGG - Intergenic
930366246 2:50443385-50443407 TCAGTCGTATAGAAAGTGTGAGG + Intronic
930985036 2:57575372-57575394 TTCAGCCTATAGAAAGTTGGGGG - Intergenic
932829999 2:74980191-74980213 TCATTCCTAGAGAATGAGGGGGG - Intergenic
933094966 2:78166631-78166653 TCCTTTCTTTAGAAATTTGGAGG + Intergenic
935623923 2:105152740-105152762 TCCTTCCTGTAGAAAGGGAGAGG - Intergenic
935700839 2:105810429-105810451 TCCTTCCTTCAGAAAAAGGGGGG + Intronic
935765021 2:106358546-106358568 TCTTTCCTTTAGTCAGTGGGTGG + Intergenic
938774403 2:134528963-134528985 TGCTCACTTTAGAAAGTGGGGGG + Intronic
939551711 2:143623964-143623986 CCCTTCCTACGGAAAGAGGGAGG + Intronic
939807799 2:146794747-146794769 TTCTTCATATAGAAATTGAGAGG + Intergenic
939842442 2:147205732-147205754 TACTTCCTAGATACAGTGGGAGG + Intergenic
943849655 2:192701868-192701890 TCCTCCCAATAGAAAGGGAGGGG + Intergenic
944981679 2:205127844-205127866 TCATTTCTCTAGAAAGTGTGAGG - Intronic
945500943 2:210574173-210574195 TTCTTCATATAAAAAGTGAGGGG + Intronic
946961569 2:224991069-224991091 TCCTTCCAGTAGAAATTGGCTGG - Intronic
948706342 2:239795786-239795808 TCCTTCCTCTTGGAGGTGGGGGG + Intronic
1170021460 20:11840885-11840907 TCCTGCTTAAATAAAGTGGGAGG - Intergenic
1172065449 20:32216592-32216614 TCCTTCCTGCAGAAAGAGAGTGG - Exonic
1172634441 20:36400688-36400710 TTGTTCGTATGGAAAGTGGGAGG + Intronic
1175549233 20:59805938-59805960 TCCTTCCTCTGGCAGGTGGGCGG + Intronic
1176726621 21:10440836-10440858 TCCTCCCTCTAGAGTGTGGGTGG - Intergenic
1177953805 21:27571351-27571373 TCCTTCCTTTGGAAAGAGTGTGG + Intergenic
1181794823 22:25299233-25299255 CCCTTCCTGTAGAAGGTGGTTGG - Intergenic
1184510392 22:44929972-44929994 TCCCTCCTAGTGACAGTGGGTGG - Intronic
949471184 3:4398737-4398759 TTCTTCCAAAAGCAAGTGGGAGG - Intronic
954438601 3:50509293-50509315 TCCATCCTATTGAAGCTGGGAGG - Intergenic
954926945 3:54244176-54244198 TTCTACCAAAAGAAAGTGGGAGG - Intronic
955521322 3:59778257-59778279 TCAATCCTATAGTCAGTGGGAGG + Intronic
955686888 3:61558206-61558228 TCCTTCTTCTTGAAAGTGGGTGG + Intergenic
955990614 3:64623186-64623208 TCATTCCTATTGAATGTGGGAGG - Intronic
964680413 3:159331781-159331803 TCTTTCCTATAGACAGAGTGAGG + Intronic
967124977 3:186415170-186415192 TCCTTCCTAGAGAAAACTGGAGG + Intergenic
971497913 4:27287617-27287639 TCCTTCATATAAAAATTAGGGGG - Intergenic
974481495 4:62449535-62449557 CCCTTCCTCTGGAACGTGGGTGG + Intergenic
975712746 4:77176704-77176726 TCCTTTCCATAGGATGTGGGAGG + Intronic
977973144 4:103233673-103233695 TACTTCCTAGATACAGTGGGGGG - Intergenic
978853049 4:113360978-113361000 TTCTTTCTCAAGAAAGTGGGGGG - Intronic
979024558 4:115552310-115552332 TACTTCCAAAAGAAAGTGGTGGG + Intergenic
981267360 4:142802518-142802540 TCTTTCCTATAACAAGTGAGTGG - Intronic
983039891 4:162913286-162913308 TGCTTACTATAGCAAGTTGGAGG - Intergenic
986040932 5:3993555-3993577 TCCTTATTAAAGAAAGTGAGTGG + Intergenic
986222188 5:5778026-5778048 TCCTTTTTATAGTAAGTGTGTGG + Intergenic
988426115 5:31066663-31066685 TCCCTCCTCTTGAATGTGGGTGG - Intergenic
989467653 5:41775635-41775657 TCCTTCCTAGAGATTGTGTGTGG + Intronic
990981747 5:61607627-61607649 TCCTTCCTCTCGGAAGTGGCTGG - Intergenic
992371618 5:76149763-76149785 TCTTTCTTATACACAGTGGGGGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994040284 5:95251331-95251353 TACTTCTCATAGAAGGTGGGAGG + Intronic
994794040 5:104270733-104270755 TGCTTCCTCTAGAAAGGGTGAGG - Intergenic
994977126 5:106822965-106822987 TCCTTCCTGTGGAAATTGGTGGG + Intergenic
995814848 5:116156563-116156585 TCATATCTATAGAAAGTTGGGGG + Intronic
1003807201 6:9738410-9738432 TCCTGCCCATAGAAAGTTGGGGG - Intronic
1003930786 6:10922239-10922261 TACTTCCTGTAGAAATTGTGAGG - Intronic
1004580932 6:16951290-16951312 TCCTTCATCTATAAAGTGAGGGG - Intergenic
1005050832 6:21682563-21682585 TCATACCTATAGAAAGGGAGAGG - Intergenic
1007060524 6:38936309-38936331 TCTTTCCCATCTAAAGTGGGAGG - Intronic
1008373064 6:50758462-50758484 AACTGCCTTTAGAAAGTGGGAGG - Intronic
1011260275 6:85463104-85463126 TCCTACATAAAGAAAGTGGTGGG + Intronic
1012515326 6:100052934-100052956 CACTTCCTCTAGAAAGTGTGTGG - Intergenic
1012953966 6:105548556-105548578 TCATTGCTATAGAGAGTGAGTGG - Intergenic
1014291096 6:119559735-119559757 TCTTTCCCATAGAAAGTTGAAGG + Intergenic
1016665462 6:146634453-146634475 CCCTGCCTATAGACAGTGGGTGG - Intronic
1017004358 6:150019564-150019586 GCCTTCCCACAGAAAGTAGGTGG - Intronic
1018715020 6:166525465-166525487 TCCTTCCTTTAGAGAGGGGGTGG - Intronic
1019806589 7:3130891-3130913 TCCTTCATATTGACAGTGGTTGG + Intergenic
1023153150 7:37221455-37221477 TCCTTCCTTAAAAAAGTGGGTGG - Intronic
1023485596 7:40682742-40682764 TTCTTCCCAGAGAAAGTAGGTGG - Intronic
1024046745 7:45590380-45590402 CACTTCCTTTAGAAAGTGGGTGG + Intronic
1024188527 7:46980942-46980964 TCATTCATATAGAAAGGAGGTGG - Intergenic
1031087236 7:117314854-117314876 TCCTTCCTATAGCTAGTTGAAGG - Intronic
1034603484 7:152287117-152287139 TCCTCCCTCTAGAGTGTGGGTGG + Intronic
1034910608 7:154995210-154995232 TTCTTCCTGTGTAAAGTGGGAGG + Intronic
1041585461 8:59512265-59512287 TCCTTCCTCTAGAAGTTGGCAGG + Intergenic
1046726390 8:117679011-117679033 TCCTCCCCATAGAAAGTAAGTGG - Intergenic
1048051828 8:130825320-130825342 TCCTTCCTACAGAGAGGGGTTGG - Intronic
1048992265 8:139767459-139767481 TCCGTCCCAGACAAAGTGGGAGG + Intronic
1049073707 8:140376996-140377018 TCCTTCCTCTAGCATGTGGTGGG - Intronic
1050306180 9:4308188-4308210 TCCTTCCAGCAGAAAGTGGGTGG - Intronic
1052104379 9:24494470-24494492 TTCTTCATCTATAAAGTGGGAGG - Intergenic
1052504148 9:29330642-29330664 TTCTGCCTATAGAAACTTGGAGG + Intergenic
1056913542 9:90725364-90725386 TCCTTCCTGTAGACAGTGAGAGG + Intergenic
1057832053 9:98414735-98414757 TCCTACCAATGGAATGTGGGTGG + Intronic
1058311082 9:103503550-103503572 TCCTGCCTATAGAAAGTTGGAGG + Intergenic
1059353266 9:113680951-113680973 TCCTTCCTAGAGTGTGTGGGAGG - Intergenic
1060223401 9:121776055-121776077 TCCTTGCTATGTGAAGTGGGCGG + Intronic
1061482317 9:130903237-130903259 TCCTGCCTCTGGAAGGTGGGTGG - Exonic
1186907180 X:14123710-14123732 CCCTTCCCAGAGATAGTGGGAGG - Intergenic
1187874245 X:23790672-23790694 TCATTCTTATAGAAACTGTGAGG - Intergenic
1187912295 X:24122151-24122173 CCCCTCCTCTTGAAAGTGGGAGG - Intergenic
1198494894 X:137182205-137182227 TTCTTCCTATAGAGAGGGAGGGG - Intergenic
1201911616 Y:19138693-19138715 TCCTTCCTAAAGAGGGTGGTAGG - Intergenic