ID: 901290755

View in Genome Browser
Species Human (GRCh38)
Location 1:8122480-8122502
Sequence ACTAACAACCACATACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901290754_901290755 8 Left 901290754 1:8122449-8122471 CCTTATTTATTTAAAGGTTTGTT 0: 1
1: 0
2: 11
3: 93
4: 1230
Right 901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901290755 Original CRISPR ACTAACAACCACATACCTAA AGG Intergenic
901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG + Intergenic
906715779 1:47967876-47967898 ACTAACATCATGATACCTAACGG + Intronic
908336575 1:63131446-63131468 ATTAACAATCACTTACATAAAGG + Intergenic
910057274 1:83047673-83047695 AATAACAACCACCAAACTAATGG - Intergenic
911276123 1:95861586-95861608 ACTAACCACCACATCACTAAAGG - Intergenic
911788820 1:101984909-101984931 ACAAATTACCACAAACCTAATGG + Intronic
913170173 1:116224922-116224944 AGTGACAACCACAAACCAAAGGG - Intergenic
914415665 1:147479235-147479257 ACAAATTACCACATACTTAAGGG + Intergenic
916697858 1:167258490-167258512 AATATCCAGCACATACCTAATGG + Intronic
918485248 1:185022058-185022080 ACTTACCACTACATTCCTAAAGG + Intergenic
924354065 1:243151195-243151217 ACTGACACCAACATGCCTAAAGG - Intronic
1063803174 10:9604985-9605007 ACAAACATCCAGACACCTAAAGG - Intergenic
1063956014 10:11267983-11268005 ACTCACAACCCCCTACCTGAAGG + Intronic
1064265177 10:13820201-13820223 ACAAATAACCACAAACCTGATGG - Intronic
1064761103 10:18621846-18621868 ACTAACAACCCTACACCAAATGG + Intronic
1065955433 10:30689492-30689514 AATAACAAAAACATACCTACCGG + Intergenic
1066125113 10:32334060-32334082 AGAAACAACCACATGCCCAAAGG + Intronic
1070740183 10:78898163-78898185 GCTAATAAAGACATACCTAAGGG - Intergenic
1074292506 10:112149096-112149118 ATTAACATCCACTTACCTAGTGG + Intergenic
1075528933 10:123210594-123210616 ACTAACACCTCCATGCCTAAGGG - Intergenic
1076427434 10:130377575-130377597 ACAAACAACCACAAACCTCGTGG - Intergenic
1081342934 11:41949860-41949882 ACAAATTACCACATACTTAATGG - Intergenic
1088709823 11:112498277-112498299 GGTAATAACCACATATCTAAAGG - Intergenic
1091862677 12:3800673-3800695 TTTAACAACCACTTATCTAAAGG + Intronic
1093013701 12:14135050-14135072 AGTAAGAACCACATACATATAGG + Intergenic
1097163840 12:57070979-57071001 ACTAACAACCAAATCAGTAATGG + Intronic
1099702625 12:86106696-86106718 AGAAACAAACACATAACTAAAGG - Intronic
1101326806 12:103722974-103722996 ACTAACAACTAACTAACTAATGG - Intronic
1102308195 12:111822821-111822843 ACTAACCTCCACATCCCTAGTGG - Intergenic
1107777989 13:43867033-43867055 ACAACCAGCCACATACTTAATGG - Intronic
1108128970 13:47276598-47276620 ATTAAGGACCACATACCCAAAGG + Intergenic
1109115906 13:58384204-58384226 TCTAACAACCTCACACTTAATGG + Intergenic
1109690396 13:65880686-65880708 AATAACATCCTAATACCTAATGG + Intergenic
1111969929 13:94901496-94901518 ACTAACAACCTCATTCATGAGGG + Intergenic
1112939240 13:104841152-104841174 AGATACTACCACATACCTAATGG + Intergenic
1113662577 13:112117549-112117571 ACTTAAAACAAGATACCTAAGGG + Intergenic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1114888336 14:26883379-26883401 ACAAAGAACCACAAACCTGATGG - Intergenic
1115286085 14:31713921-31713943 ACTAAGAACCAGATACAGAAGGG - Intronic
1118243321 14:64082746-64082768 ACTAATTACCACAAACTTAATGG - Intronic
1118650217 14:67883341-67883363 AACAAAAACCACAGACCTAAAGG + Intronic
1121463653 14:94100685-94100707 ACAAACAAACACAAACCTATGGG - Intronic
1123144402 14:106115014-106115036 ACCAGCAACTACATACCTATGGG - Intergenic
1124384129 15:29192208-29192230 AATGACCATCACATACCTAAAGG + Intronic
1124642740 15:31406586-31406608 ACCAATAACCACACACTTAATGG + Intronic
1126233734 15:46357439-46357461 ATTAACAACATCATACCTAGAGG + Intergenic
1129594832 15:76954422-76954444 ACTAGTAACCAATTACCTAAGGG + Intergenic
1130262566 15:82369123-82369145 CCTAACAACATCATACTTAATGG - Intergenic
1130278665 15:82499824-82499846 CCTAACAACATCATACTTAATGG + Intergenic
1136694795 16:32067969-32067991 ACCAGCAACTACATACCTATGGG + Intergenic
1136795296 16:33011231-33011253 ACCAGCAACTACATACCTATGGG + Intergenic
1136874624 16:33843151-33843173 ACCAGCAACTACATACCTATGGG - Intergenic
1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG + Exonic
1139378618 16:66516304-66516326 ACAAACAACCACATACACAGTGG - Intronic
1140587833 16:76315146-76315168 ATTAACGACCAGATACCCAATGG - Intronic
1140692343 16:77496605-77496627 ACAAACAACCACATTCCAAGAGG + Intergenic
1142116888 16:88361838-88361860 ACGATGAACCACAGACCTAAAGG - Intergenic
1203097551 16_KI270728v1_random:1272891-1272913 ACCAGCAACTACATACCTATGGG + Intergenic
1145085614 17:19936724-19936746 ACTAACAATCACATATTTATGGG + Intronic
1146021529 17:29283301-29283323 ACTATTAACCAGTTACCTAATGG + Intronic
1146196364 17:30816408-30816430 AATGACAATCACATACATAATGG + Intronic
1146739559 17:35270621-35270643 ACTAAAAAACCCATACCTCAGGG + Exonic
1147207590 17:38848989-38849011 GCTAACAACCTCCTACCTTAAGG + Exonic
1148287569 17:46409027-46409049 CCTCACAATCACATGCCTAAAGG - Intergenic
1148309737 17:46626606-46626628 CCTCACAATCACATGCCTAAAGG - Exonic
1148929402 17:51115981-51116003 ACTAAGAACTAAATTCCTAAAGG + Intronic
1149217723 17:54377330-54377352 ACAAACAAACACAAACCAAAAGG - Intergenic
1150111508 17:62504300-62504322 AGTAAAAACCACCTACCTTATGG - Intronic
1155307674 18:24494751-24494773 ACTCACAACCACATCACTAATGG - Intergenic
1156890967 18:42188806-42188828 ACTGATTACCACATACCTATAGG - Intergenic
1158327901 18:56329972-56329994 ACTAATAACCACAAACTTGATGG - Intergenic
1158342146 18:56478022-56478044 AGTTACTACCACATACCTTAAGG + Intergenic
1162624969 19:11878078-11878100 AATTACAACCACAATCCTAAAGG + Intronic
1167882882 19:52476759-52476781 ACTAACCTCCACATCCCTAGTGG - Intronic
929939196 2:46318648-46318670 ACTAAAAACCACAGAGCTTACGG - Intronic
930470650 2:51807786-51807808 ACAAACAATCACATAACGAAAGG + Intergenic
930950675 2:57140630-57140652 ACTAACAACCACAGACATCTGGG - Intergenic
931775465 2:65536645-65536667 AATCACAACTACATACCTATTGG - Intergenic
932611196 2:73201675-73201697 AATTAAAACCACATACCTAGGGG + Intergenic
932636692 2:73395402-73395424 ACTACAGACCACATACATAATGG - Intronic
935400022 2:102650601-102650623 AATAGCAAACACATACCTACAGG - Intronic
939256071 2:139746604-139746626 ACTAAAAATTACATACCTAATGG + Intergenic
943414241 2:187579248-187579270 ACTAACAATCACAAAGCTAATGG + Intergenic
946384827 2:219376780-219376802 CCTATTAACCAGATACCTAATGG - Intronic
948072450 2:235138775-235138797 ACAAACTACCAAAAACCTAATGG + Intergenic
1170285655 20:14705521-14705543 ACTAAGAACCACAAGTCTAATGG - Intronic
1170355132 20:15484296-15484318 TCTAACCACCACATGACTAAAGG - Intronic
1171297157 20:24027978-24028000 ACCTACAACCACATACACAATGG + Intergenic
1173430435 20:42982924-42982946 ACTACCTCCCACATACCTTACGG + Intronic
1174940217 20:54918852-54918874 ACTAATAACCACAAACTTAGTGG + Intergenic
1176652647 21:9564545-9564567 ACCCACAACCACATACCTTGGGG - Intergenic
1177179144 21:17726207-17726229 AATAGCAACCACATAACCAAGGG - Intergenic
1183433073 22:37777571-37777593 GCCAACAACCACATATGTAATGG + Intergenic
949131098 3:502123-502145 AGTAATAGCCACATTCCTAAAGG - Intergenic
949150782 3:764807-764829 ATTAACTACCACATACTGAATGG - Intergenic
951417595 3:22443938-22443960 ACTCACAACCACATATATAAGGG - Intergenic
951921167 3:27855619-27855641 ACTCAAAACCACACAACTAATGG + Intergenic
952331380 3:32367246-32367268 ACTGAAAACCAAATACCTACCGG + Intronic
955343521 3:58143832-58143854 ATAAACAACCACAGACCCAAAGG - Intronic
955421733 3:58744999-58745021 GCTAACAACCACATTAATAATGG + Intronic
956227961 3:66980864-66980886 ACTGACAACCATTTTCCTAAAGG + Intergenic
957440189 3:80236357-80236379 ACAAACAACCACAAACGTAGTGG + Intergenic
958787769 3:98616865-98616887 TGTAACAACCACAAACTTAATGG + Intergenic
959036980 3:101378086-101378108 TCTTACCACCACATTCCTAAAGG + Intronic
959239589 3:103772772-103772794 ACAAATAACCACAAACTTAATGG + Intergenic
960345413 3:116524446-116524468 ACTCTCAACCAAATACTTAATGG - Intronic
960771761 3:121200776-121200798 ACTCAAAACCACACAACTAATGG - Intronic
963246882 3:143072011-143072033 TATAACAACCACAAACTTAATGG + Intergenic
963757872 3:149255073-149255095 TCTAACAGAAACATACCTAAGGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967011604 3:185440073-185440095 AATAAAAACCACATACAGAAGGG + Intronic
967153761 3:186673982-186674004 AATTAAAACCACTTACCTAAAGG + Intronic
967685672 3:192412865-192412887 ACTAACAACCAGGTATTTAAAGG + Intronic
968439585 4:616535-616557 TCTTACAACCACATCACTAAAGG - Intergenic
968668173 4:1833005-1833027 ACGACCAACCACATTCCCAAAGG + Intronic
971123845 4:23730896-23730918 ACTAAAAAGCAGATACATAAAGG + Intergenic
973116597 4:46467812-46467834 ACTAAGTACCACATACTTAGTGG - Intronic
973902792 4:55494950-55494972 ACAAATAACCACAAACTTAATGG - Intronic
977250986 4:94688666-94688688 ACACACAAGCACATACATAAAGG + Intergenic
979790156 4:124770118-124770140 TCTTACAACCACATAACAAATGG + Intergenic
981652087 4:147071870-147071892 ACTAGCAATCATAAACCTAATGG + Intergenic
982102272 4:151979435-151979457 ACTAAAAAAAGCATACCTAATGG + Intergenic
987466454 5:18277637-18277659 ACAAATAACCACAAACCTAGAGG + Intergenic
987884375 5:23794608-23794630 TCTCACAACCACATTACTAAAGG - Intergenic
989401368 5:41011094-41011116 ATTAACATCCAAATTCCTAAAGG - Intronic
994288884 5:98003874-98003896 ACAAACAAACACAAACCTCATGG + Intergenic
996233454 5:121095955-121095977 ACTTACCACCACATTACTAAAGG + Intergenic
998705757 5:144757933-144757955 ACTTACCACCACATTACTAAAGG + Intergenic
1000974257 5:167747972-167747994 AAAAACGATCACATACCTAAAGG - Intronic
1002406529 5:179037983-179038005 ACTAGCTACCACATACATAAAGG + Intergenic
1004121025 6:12822340-12822362 TCTAAGAACCAGAGACCTAAGGG + Intronic
1006184418 6:32172722-32172744 ACTCACAGCCATATACCCAAGGG + Intronic
1006219496 6:32476557-32476579 ACTAACCTCCACATCCCTAGTGG - Intergenic
1006228819 6:32564585-32564607 ACTAACCTCCACATCCCTAGTGG - Intronic
1009566282 6:65314849-65314871 ACTAACAATCCCATACAGAAGGG + Intronic
1011377869 6:86709556-86709578 ACTAACCACCACATACATACAGG + Intergenic
1014905827 6:127025679-127025701 ACTTACAACCCCATAGCTTAAGG - Intergenic
1017607919 6:156153068-156153090 AATAAAAACCACATACGTCATGG - Intergenic
1018525850 6:164709308-164709330 AATAAAAATCACATACCTAGTGG - Intergenic
1024183819 7:46927256-46927278 ACCAACAACCACATACTTTCAGG + Intergenic
1024887322 7:54159099-54159121 ACTAACGACCACAAAAGTAAGGG + Intergenic
1027689460 7:81324522-81324544 ACTAATATACACATACTTAAAGG + Intergenic
1027802448 7:82772758-82772780 GCTAAGAAGCACATACCAAAAGG - Intronic
1028980507 7:96962689-96962711 ACTAGCAACCACAGAACTGAAGG - Intergenic
1030361934 7:108604435-108604457 ACTGACAGCCAGATACCTACTGG - Intergenic
1030742051 7:113121234-113121256 AGTAAGGACCACATACATAATGG - Intergenic
1030760360 7:113342606-113342628 ACAAATTACTACATACCTAATGG + Intergenic
1030994260 7:116338963-116338985 ACAATCAAGCTCATACCTAATGG - Intronic
1031114851 7:117656369-117656391 GCTCACAGCCACATACCCAAAGG - Intronic
1035863395 8:3054774-3054796 ACGAAAAACCACAGACATAAAGG + Intronic
1039758436 8:40547982-40548004 CCTGACAACCACATGCCAAATGG - Intronic
1039827896 8:41190270-41190292 TCTACCGACGACATACCTAAAGG + Intergenic
1040802157 8:51354573-51354595 ACTAAAAGGCACATATCTAACGG + Intronic
1042456268 8:69007663-69007685 ACAAACTACCACACACCTAGTGG + Intergenic
1043327813 8:79073973-79073995 ACAAATAACCACAAACATAATGG + Intergenic
1044038754 8:87338857-87338879 CCTTACAACCACATTACTAAAGG - Intronic
1045330013 8:101147484-101147506 ACTATAACCCACAGACCTAAGGG - Intergenic
1045856590 8:106771456-106771478 AACAACAACCACAAACCAAACGG - Intergenic
1048652102 8:136489456-136489478 ACTCACAACCACATAGATAAGGG + Intergenic
1050359101 9:4811625-4811647 ATTCACAAACACATACATAACGG - Intronic
1052089847 9:24314751-24314773 ATTAGCACCCACAGACCTAAGGG + Intergenic
1058843796 9:108935478-108935500 ACTCAAAAAGACATACCTAAAGG - Intronic
1203630377 Un_KI270750v1:68086-68108 ACCCACAACCACATACCTTGGGG - Intergenic
1188405957 X:29810026-29810048 ACTAACAACCAAATTCTTACAGG - Intronic
1190342272 X:49306847-49306869 ACAAACAAACAGATAACTAAAGG + Intronic
1191802432 X:65095909-65095931 ACTTACAACCACATCACTAAAGG + Intergenic
1194717678 X:97305946-97305968 TTTAACAACCTCATACCTAATGG + Intronic
1195151499 X:102075013-102075035 AATTACAATCACATACCTAGAGG + Intergenic
1196699644 X:118654019-118654041 ACTAACTACCACATACACTAAGG - Intronic
1201384674 Y:13425746-13425768 ACTAGGAACCACCTACCTACAGG + Intronic