ID: 901293522

View in Genome Browser
Species Human (GRCh38)
Location 1:8143122-8143144
Sequence GGTCAGAGAATCCGCCACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901293522_901293526 14 Left 901293522 1:8143122-8143144 CCGTGGTGGCGGATTCTCTGACC No data
Right 901293526 1:8143159-8143181 CAGAGACTTAAATCTTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901293522 Original CRISPR GGTCAGAGAATCCGCCACCA CGG (reversed) Intergenic
No off target data available for this crispr