ID: 901294396

View in Genome Browser
Species Human (GRCh38)
Location 1:8149290-8149312
Sequence ATCTTCATGGGGCATATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901294396_901294404 8 Left 901294396 1:8149290-8149312 CCCAATATATGCCCCATGAAGAT No data
Right 901294404 1:8149321-8149343 CCTTTGTATCTCTAACATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901294396 Original CRISPR ATCTTCATGGGGCATATATT GGG (reversed) Intergenic
No off target data available for this crispr