ID: 901298484

View in Genome Browser
Species Human (GRCh38)
Location 1:8180393-8180415
Sequence CCATTCTTCTTAAGGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901298484_901298494 19 Left 901298484 1:8180393-8180415 CCATGTGTCCTTAAGAAGAATGG No data
Right 901298494 1:8180435-8180457 GATTATAATCCCAGGACTTTGGG No data
901298484_901298490 -9 Left 901298484 1:8180393-8180415 CCATGTGTCCTTAAGAAGAATGG No data
Right 901298490 1:8180407-8180429 GAAGAATGGGCCGGGCACAGTGG No data
901298484_901298495 22 Left 901298484 1:8180393-8180415 CCATGTGTCCTTAAGAAGAATGG No data
Right 901298495 1:8180438-8180460 TATAATCCCAGGACTTTGGGAGG 0: 303
1: 31300
2: 337313
3: 258452
4: 135741
901298484_901298492 11 Left 901298484 1:8180393-8180415 CCATGTGTCCTTAAGAAGAATGG No data
Right 901298492 1:8180427-8180449 TGGCTCATGATTATAATCCCAGG No data
901298484_901298493 18 Left 901298484 1:8180393-8180415 CCATGTGTCCTTAAGAAGAATGG No data
Right 901298493 1:8180434-8180456 TGATTATAATCCCAGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901298484 Original CRISPR CCATTCTTCTTAAGGACACA TGG (reversed) Intergenic
No off target data available for this crispr