ID: 901300404

View in Genome Browser
Species Human (GRCh38)
Location 1:8196277-8196299
Sequence TCCCAGAAACCTCTAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300404_901300407 -4 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300407 1:8196296-8196318 GGGAGCCTGCAGGAATGGTGAGG No data
901300404_901300416 23 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300416 1:8196323-8196345 TGGGCAAAATAGGGTTGGCTAGG No data
901300404_901300411 4 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300411 1:8196304-8196326 GCAGGAATGGTGAGGGACCTGGG No data
901300404_901300414 18 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300414 1:8196318-8196340 GGACCTGGGCAAAATAGGGTTGG No data
901300404_901300406 -9 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300406 1:8196291-8196313 TTTCTGGGAGCCTGCAGGAATGG No data
901300404_901300410 3 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300410 1:8196303-8196325 TGCAGGAATGGTGAGGGACCTGG No data
901300404_901300412 13 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300412 1:8196313-8196335 GTGAGGGACCTGGGCAAAATAGG No data
901300404_901300413 14 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300413 1:8196314-8196336 TGAGGGACCTGGGCAAAATAGGG No data
901300404_901300408 -3 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300408 1:8196297-8196319 GGAGCCTGCAGGAATGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300404 Original CRISPR TCCCAGAAACCTCTAGAAAC TGG (reversed) Intergenic