ID: 901300409

View in Genome Browser
Species Human (GRCh38)
Location 1:8196301-8196323
Sequence AGGTCCCTCACCATTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300409_901300421 24 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300421 1:8196348-8196370 GAAAGAGGAAGGGTAAGTTTGGG No data
901300409_901300420 23 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300420 1:8196347-8196369 AGAAAGAGGAAGGGTAAGTTTGG No data
901300409_901300413 -10 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300413 1:8196314-8196336 TGAGGGACCTGGGCAAAATAGGG No data
901300409_901300416 -1 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300416 1:8196323-8196345 TGGGCAAAATAGGGTTGGCTAGG No data
901300409_901300417 9 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300417 1:8196333-8196355 AGGGTTGGCTAGGAAGAAAGAGG No data
901300409_901300419 14 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300419 1:8196338-8196360 TGGCTAGGAAGAAAGAGGAAGGG No data
901300409_901300418 13 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG No data
901300409_901300414 -6 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300414 1:8196318-8196340 GGACCTGGGCAAAATAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300409 Original CRISPR AGGTCCCTCACCATTCCTGC AGG (reversed) Intergenic