ID: 901300413

View in Genome Browser
Species Human (GRCh38)
Location 1:8196314-8196336
Sequence TGAGGGACCTGGGCAAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300404_901300413 14 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300413 1:8196314-8196336 TGAGGGACCTGGGCAAAATAGGG No data
901300400_901300413 28 Left 901300400 1:8196263-8196285 CCACTGCAGGAATTCCAGTTTCT No data
Right 901300413 1:8196314-8196336 TGAGGGACCTGGGCAAAATAGGG No data
901300409_901300413 -10 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300413 1:8196314-8196336 TGAGGGACCTGGGCAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300413 Original CRISPR TGAGGGACCTGGGCAAAATA GGG Intergenic