ID: 901300415

View in Genome Browser
Species Human (GRCh38)
Location 1:8196321-8196343
Sequence TAGCCAACCCTATTTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300415_901300419 -6 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300419 1:8196338-8196360 TGGCTAGGAAGAAAGAGGAAGGG No data
901300415_901300420 3 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300420 1:8196347-8196369 AGAAAGAGGAAGGGTAAGTTTGG No data
901300415_901300423 29 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300423 1:8196373-8196395 ACTGAACCCACTGATAATGGTGG No data
901300415_901300422 26 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300422 1:8196370-8196392 GACACTGAACCCACTGATAATGG No data
901300415_901300424 30 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300424 1:8196374-8196396 CTGAACCCACTGATAATGGTGGG No data
901300415_901300421 4 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300421 1:8196348-8196370 GAAAGAGGAAGGGTAAGTTTGGG No data
901300415_901300418 -7 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300415 Original CRISPR TAGCCAACCCTATTTTGCCC AGG (reversed) Intergenic
No off target data available for this crispr