ID: 901300416

View in Genome Browser
Species Human (GRCh38)
Location 1:8196323-8196345
Sequence TGGGCAAAATAGGGTTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300409_901300416 -1 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300416 1:8196323-8196345 TGGGCAAAATAGGGTTGGCTAGG No data
901300404_901300416 23 Left 901300404 1:8196277-8196299 CCAGTTTCTAGAGGTTTCTGGGA No data
Right 901300416 1:8196323-8196345 TGGGCAAAATAGGGTTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300416 Original CRISPR TGGGCAAAATAGGGTTGGCT AGG Intergenic