ID: 901300418

View in Genome Browser
Species Human (GRCh38)
Location 1:8196337-8196359
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300415_901300418 -7 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG No data
901300409_901300418 13 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type