ID: 901300419 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:8196338-8196360 |
Sequence | TGGCTAGGAAGAAAGAGGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
901300415_901300419 | -6 | Left | 901300415 | 1:8196321-8196343 | CCTGGGCAAAATAGGGTTGGCTA | No data | ||
Right | 901300419 | 1:8196338-8196360 | TGGCTAGGAAGAAAGAGGAAGGG | No data | ||||
901300409_901300419 | 14 | Left | 901300409 | 1:8196301-8196323 | CCTGCAGGAATGGTGAGGGACCT | No data | ||
Right | 901300419 | 1:8196338-8196360 | TGGCTAGGAAGAAAGAGGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
901300419 | Original CRISPR | TGGCTAGGAAGAAAGAGGAA GGG | Intergenic | ||