ID: 901300421

View in Genome Browser
Species Human (GRCh38)
Location 1:8196348-8196370
Sequence GAAAGAGGAAGGGTAAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300409_901300421 24 Left 901300409 1:8196301-8196323 CCTGCAGGAATGGTGAGGGACCT No data
Right 901300421 1:8196348-8196370 GAAAGAGGAAGGGTAAGTTTGGG No data
901300415_901300421 4 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300421 1:8196348-8196370 GAAAGAGGAAGGGTAAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300421 Original CRISPR GAAAGAGGAAGGGTAAGTTT GGG Intergenic
No off target data available for this crispr