ID: 901300422

View in Genome Browser
Species Human (GRCh38)
Location 1:8196370-8196392
Sequence GACACTGAACCCACTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901300415_901300422 26 Left 901300415 1:8196321-8196343 CCTGGGCAAAATAGGGTTGGCTA No data
Right 901300422 1:8196370-8196392 GACACTGAACCCACTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901300422 Original CRISPR GACACTGAACCCACTGATAA TGG Intergenic
No off target data available for this crispr