ID: 901302716

View in Genome Browser
Species Human (GRCh38)
Location 1:8211250-8211272
Sequence AGCCCAGGTGGAGCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901302705_901302716 14 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 901302705 1:8211213-8211235 CCGATTCTGACTCCCAGAAAATG 0: 1
1: 0
2: 1
3: 20
4: 226
Right 901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG 0: 1
1: 0
2: 2
3: 36
4: 332
901302711_901302716 1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 901302711 1:8211226-8211248 CCAGAAAATGGGGAGCTTGGAGC 0: 1
1: 0
2: 0
3: 9
4: 174
Right 901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG 0: 1
1: 0
2: 2
3: 36
4: 332
901302710_901302716 2 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 901302710 1:8211225-8211247 CCCAGAAAATGGGGAGCTTGGAG 0: 1
1: 0
2: 0
3: 24
4: 243
Right 901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG 0: 1
1: 0
2: 2
3: 36
4: 332
901302704_901302716 21 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 901302704 1:8211206-8211228 CCAGGCTCCGATTCTGACTCCCA 0: 1
1: 0
2: 1
3: 8
4: 173
Right 901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG 0: 1
1: 0
2: 2
3: 36
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901302716 Original CRISPR AGCCCAGGTGGAGCAGCCTC GGG Intergenic
900214645 1:1475037-1475059 AGGCCTGGTTGAGCAGCCTCAGG + Intronic
900221854 1:1513386-1513408 AGGCCTGGTTGAGCAGCCTCAGG + Intronic
900289746 1:1918901-1918923 AGGCCCGCTGGAGCAGCCTGTGG - Exonic
900501687 1:3008886-3008908 AGCCCATGTGGGGCAGGCTCAGG + Intergenic
901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG + Intergenic
901535919 1:9883019-9883041 AGCACGGGTGGGGCAGCCGCAGG + Intronic
901581696 1:10249701-10249723 AGACCAGCTGGAGCAACCTAGGG + Intronic
902089704 1:13893306-13893328 ACCCCAGGAGAAGCAGCCCCGGG + Intergenic
902317485 1:15633452-15633474 AGTCCTGGTGGAGCAGCAGCAGG + Exonic
902331476 1:15733058-15733080 AGCCCCGGTGGTTCTGCCTCTGG + Intronic
902546842 1:17195547-17195569 AACCCAGGTGCAGGAGCCTGAGG - Intergenic
902788860 1:18751509-18751531 AGAGCAGGTGGATCAGCCACTGG + Intergenic
903560711 1:24224940-24224962 AGCCTTGGTTCAGCAGCCTCAGG - Intergenic
903884344 1:26532156-26532178 AGCCCAGGTGGAGTAATCTATGG + Intronic
905003188 1:34689516-34689538 AGCCCAGGTTGGGCAGCATGTGG + Intergenic
905230506 1:36512300-36512322 AGCCCATTTGGAGCAGCCCGGGG + Intergenic
905267036 1:36761363-36761385 AGGGCAGATGGGGCAGCCTCAGG + Intergenic
905863767 1:41366149-41366171 AGCCCTGCTGGAGCAGGCTGGGG - Intronic
907179113 1:52553733-52553755 TCCCCAGGGGGAGCAGCCTTGGG - Intergenic
908408046 1:63834167-63834189 AGCTGAGATGGAGAAGCCTCCGG + Intronic
916022122 1:160802032-160802054 CGCCCACGTCTAGCAGCCTCGGG - Intronic
917515593 1:175705027-175705049 AGCCCAGCTGAAGGAGACTCTGG - Intronic
918245759 1:182657602-182657624 ATCCCAGGTGGAACAGCTTCAGG - Intronic
918305778 1:183244797-183244819 AGCCAAGGTGGAAGTGCCTCTGG - Exonic
918999722 1:191814682-191814704 GACCCAGGTGGAGTAGCCACGGG - Intergenic
920051166 1:203165981-203166003 AGCCCAGCTGGGGCAGGCTCAGG - Exonic
920379805 1:205528926-205528948 TGCCCTGGTGGAGCAGCCCTAGG + Intronic
921047779 1:211489825-211489847 GGCCCAGGTGGTGAGGCCTCAGG + Intronic
922887626 1:229032054-229032076 AGCCCAGGCCGGCCAGCCTCTGG - Intergenic
1064322881 10:14322029-14322051 AGCCTGGCTGGAGAAGCCTCAGG - Intronic
1066652058 10:37665668-37665690 AGGCCAGGTGGAGAAGGCACTGG + Intergenic
1067035832 10:42915908-42915930 AGGCCAGGTGGAGAAGGCACTGG + Intergenic
1067432626 10:46253861-46253883 AGCCGGGTTGGAGCAGCCTCAGG + Intergenic
1067440635 10:46307603-46307625 AGCCGGGTTGGAGCAGCCTCAGG - Intronic
1067727073 10:48778506-48778528 AGCCCAGGTGCAGCACCTACTGG - Intronic
1067795750 10:49320401-49320423 GGCCCAGGTGATGCAGACTCTGG + Intronic
1068938277 10:62657330-62657352 AGCCCATCTGGAGCAGCCGCTGG + Intronic
1070820387 10:79350777-79350799 AGCCCAGCTGAAGCATCCACAGG - Intronic
1072247583 10:93556905-93556927 AGCCCCAGTGGAGCAGACTCAGG - Intergenic
1072508100 10:96090301-96090323 AGCCCAGCTGCAGCCGCTTCCGG - Intergenic
1072791421 10:98320987-98321009 AGGCCAGGTGGTGCTGGCTCTGG + Intergenic
1073242563 10:102067685-102067707 AGCCCTGCTGGAGCAGACTGGGG + Exonic
1075314291 10:121439538-121439560 AGGCCAGGTGGAGGAGCCCCAGG + Intergenic
1075693347 10:124416249-124416271 AGCCCAGGTTGGGCATCCTGTGG + Intronic
1075842505 10:125517163-125517185 TGCCCGGGTGTAGCTGCCTCAGG - Intergenic
1075883203 10:125872744-125872766 AGCCCAGCTGGAACTGACTCTGG + Intronic
1076690437 10:132221213-132221235 AGCCCAGGTGCGTCAGCATCAGG - Intronic
1076747112 10:132520016-132520038 AGCCCAAGTGCTGCTGCCTCTGG + Intergenic
1076776351 10:132700074-132700096 CCCCCAGGAAGAGCAGCCTCAGG + Intronic
1076877007 10:133220874-133220896 TGCCCAGGTGGGGCACGCTCAGG + Intronic
1076918762 10:133440707-133440729 AGACCAGGTGCAGGAGCCTCCGG - Intergenic
1076922306 10:133460397-133460419 AGCCCAGGTGGGGCTGCCCCAGG - Intergenic
1077199693 11:1299794-1299816 GGCACAGGTGACGCAGCCTCAGG - Intronic
1077278367 11:1728885-1728907 AGCACAGGTGGGGCAACTTCTGG - Intergenic
1078145775 11:8721075-8721097 AGCCCAGCTGGAGAAGCCAGAGG + Intronic
1078355517 11:10629134-10629156 AGTCGAGAAGGAGCAGCCTCTGG - Intronic
1079346848 11:19660263-19660285 AGCCCTGCTGGGGCAGCCCCTGG - Intronic
1079391146 11:20023215-20023237 AAGCCTGGTGGAGCAGCCTGTGG + Intronic
1080587758 11:33696955-33696977 AGCACAGGTGGAACAGCTTTTGG - Intergenic
1080861532 11:36154362-36154384 ACCCCAGGTGGCACAGCCTAGGG + Intronic
1081714028 11:45235904-45235926 AGCCCAAGTGAACCAGGCTCAGG + Intergenic
1083398916 11:62410796-62410818 TGCCCAGATGGAACAGCATCAGG + Intronic
1083609704 11:63999042-63999064 GGCCCAGGCTGAGCAGCCCCTGG - Intronic
1083774521 11:64887977-64887999 AGGCCTGGGGGAGCAGCCCCTGG - Intronic
1084493203 11:69489343-69489365 AGCCCAACGGCAGCAGCCTCTGG - Intergenic
1085203786 11:74718078-74718100 ACCCCAGGTGGCTCAGCCTTTGG + Intronic
1087826682 11:102772536-102772558 AGCCCAGGTGTGGCAGGCTTTGG - Intronic
1088172817 11:107017791-107017813 AGTCCAGGTTGACCCGCCTCCGG + Exonic
1089029791 11:115313754-115313776 AGTACAGGAGGAGCAACCTCAGG - Intronic
1090186045 11:124739870-124739892 AGCCAATCAGGAGCAGCCTCCGG - Exonic
1090758604 11:129816111-129816133 AGCCCAGCTGGGGCCCCCTCCGG + Intronic
1091558405 12:1593358-1593380 AGCTGAGGTTGAGGAGCCTCAGG + Exonic
1091615888 12:2051516-2051538 AGACCAGGGGGATCAGCCACAGG + Intronic
1093462471 12:19419226-19419248 AGCCGAGGAGGAGGAGGCTCCGG - Intronic
1093583174 12:20807328-20807350 GCCCCAGGTGAGGCAGCCTCTGG - Intergenic
1096774824 12:53957402-53957424 AGCCCAGGGGACACAGCCTCAGG + Exonic
1102447495 12:113014932-113014954 AGCTCAGCTGGAGGAGCCTCGGG - Intergenic
1102491528 12:113292263-113292285 AGCCAAGAAGGAGAAGCCTCTGG - Intronic
1103007673 12:117435159-117435181 AGCCCAGAAGGAGCAGTTTCTGG - Intronic
1104016393 12:124965087-124965109 AGCTCTGGTGGAGCAGCCTGGGG - Intronic
1104786072 12:131448620-131448642 CTCCCAGGTGCAGGAGCCTCAGG + Intergenic
1104968603 12:132521052-132521074 CACCAAGGTTGAGCAGCCTCAGG - Intronic
1105299256 13:19117888-19117910 ACCACAGGCAGAGCAGCCTCGGG + Intergenic
1105324220 13:19355590-19355612 ACCCCCGGGGGAGCAGCATCGGG - Intergenic
1106903987 13:34385903-34385925 AGCACAGGTGGATAAGCATCAGG + Intergenic
1107100417 13:36584794-36584816 AGATCAGGTGGAGCAAACTCTGG - Intergenic
1109745892 13:66622370-66622392 AGCCCCGGTGCAGGAGCCACTGG + Intronic
1113639171 13:111944824-111944846 AGCCCAGGTAGAGCAAACTAGGG - Intergenic
1113906322 13:113820932-113820954 CGTCCAGGTCCAGCAGCCTCCGG + Exonic
1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG + Intronic
1117566916 14:57002723-57002745 AGCCTTGGTGGGGCAGCATCAGG + Intergenic
1118753904 14:68824496-68824518 ACCCCAAGTTGAGCAGCATCTGG - Intergenic
1118839954 14:69502543-69502565 AGCCCAGGTGCAGCAGGCCTGGG + Intronic
1119746897 14:77051218-77051240 AGCTCGGGTGGGGCTGCCTCTGG + Intergenic
1121048073 14:90802411-90802433 AGCACAGGTGAAGGAGCCGCTGG + Intronic
1122151725 14:99729448-99729470 GGGCCAGGTGAATCAGCCTCTGG + Intergenic
1122415991 14:101549729-101549751 AGCCAAGCTGGAGCAGCGTGTGG - Intergenic
1122459657 14:101884581-101884603 AGCCCCGCTGGAGCAGCCGGTGG + Intronic
1123092032 14:105746201-105746223 AGCCAAGGCAGAGCAGCCGCAGG - Intergenic
1125688716 15:41579225-41579247 AGCCTTGGTGGGGGAGCCTCTGG + Exonic
1126165455 15:45650971-45650993 AGCCGAGGCGGAGCTGCCCCCGG + Intronic
1127764666 15:62173318-62173340 AGCCAGTGTGGAGCAACCTCAGG - Intergenic
1128769947 15:70274468-70274490 AGACCAGCTGGCCCAGCCTCTGG + Intergenic
1129356474 15:74995444-74995466 AGCTCAGGAGGAGCAGCCTTAGG + Intronic
1131279002 15:91005904-91005926 AGCCCAAGGGCAGCAGCCTTGGG + Intronic
1131399582 15:92113685-92113707 GCCCCAGATGGGGCAGCCTCCGG - Intronic
1131488238 15:92839961-92839983 AGACCAGGTGCAGCTGCCTGGGG - Intergenic
1132210522 15:100018616-100018638 AGCACAGCTGGAGAGGCCTCAGG - Intronic
1132277832 15:100584816-100584838 AGCACAGGTGGAACATCCTGGGG - Intronic
1132645901 16:999156-999178 ACCCCAGGTGGGGCAGCTCCCGG + Intergenic
1132670674 16:1101041-1101063 AGCCCAGGAGCAGGAGCCCCCGG - Intergenic
1132852752 16:2032325-2032347 AGCTCAGGTGAAGAAACCTCAGG - Intronic
1133056293 16:3147150-3147172 AGGCCAGGTGGGGCAGGGTCTGG + Intronic
1133218888 16:4309859-4309881 TGCCCAGGAGGTGCAGCCCCAGG - Intergenic
1133658184 16:7887537-7887559 AACCCAGGTTGTGCACCCTCTGG + Intergenic
1133732601 16:8589844-8589866 AGCCCAGGACCAGCAGCCGCGGG + Intergenic
1134053784 16:11156482-11156504 ACCCCAGCTGGAGCAGAATCAGG - Intronic
1134809115 16:17151922-17151944 AGCCCAGGTACTCCAGCCTCAGG - Intronic
1134844148 16:17425666-17425688 AGCCCAGGTGTAGCAGCAGGTGG - Intronic
1135280934 16:21153019-21153041 AGCCCCGGTGCAGGAGCCACTGG + Intronic
1135832652 16:25789712-25789734 AGCACAGGTGGAGGACCTTCTGG - Intronic
1138600011 16:58048615-58048637 AGCCCTGGTGCTGCAGCCTGTGG + Intergenic
1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG + Intergenic
1141779645 16:86150991-86151013 TGCCCAGGTGGAGGAGGCTGGGG + Intergenic
1141944171 16:87298225-87298247 AGGACATGTGGTGCAGCCTCAGG + Intronic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142485427 17:244593-244615 GTCCCAGGAGGAGCAGCGTCTGG + Intronic
1142560553 17:806589-806611 AGCCCAGGAGGAGAGGCGTCTGG - Intronic
1142985371 17:3691892-3691914 AGTTGAGGTGGAGCAGGCTCAGG + Intronic
1143117108 17:4587296-4587318 AGCCCAGCGGCAGCTGCCTCAGG - Intronic
1143242400 17:5454931-5454953 AGCCCAGGTTGAGCAAACTTGGG - Intronic
1143968085 17:10771277-10771299 GGCCTAGCTGGAGCAGGCTCTGG - Intergenic
1145909957 17:28536731-28536753 AGCCCAGATCAAGCAGCTTCCGG - Intronic
1145988891 17:29066208-29066230 AGAACAGGTGGAGCAGCCTGCGG + Intergenic
1146812899 17:35917891-35917913 AGTCCAGGAGGCTCAGCCTCTGG - Intergenic
1146910616 17:36646313-36646335 TGCCCAGATGGAGCGGCCCCAGG - Intergenic
1147232153 17:39027376-39027398 AGTCCAGGAGGCTCAGCCTCTGG + Intergenic
1147555801 17:41478328-41478350 AGGCAGGGTGGAGCTGCCTCTGG - Intronic
1147762269 17:42806720-42806742 AGACCAGGTCGAGCAGTGTCAGG - Exonic
1147951836 17:44111788-44111810 AGCTGAGGCTGAGCAGCCTCTGG - Intronic
1148219547 17:45851834-45851856 GCCCCAGGTGGCCCAGCCTCAGG + Intergenic
1148776262 17:50097141-50097163 GGCCCATTTGGAGCTGCCTCTGG - Intronic
1150133033 17:62679670-62679692 AGCCCAGATGGAGAGGCCCCAGG + Intronic
1150784609 17:68152348-68152370 AGTCCAGGAGGCTCAGCCTCTGG - Intergenic
1151103768 17:71588090-71588112 AGACCAGGTGGGGCTGGCTCAGG + Intergenic
1151351834 17:73536478-73536500 TGCCCAGGTGGCCCAGCCTGGGG - Intronic
1151636453 17:75352163-75352185 AGCTCAGGAGGAGCAGGTTCAGG + Intronic
1151958560 17:77392992-77393014 GGGGCAGGTGGAGCAGGCTCCGG - Intronic
1151972537 17:77466291-77466313 GGCCCAGTGGGCGCAGCCTCAGG + Intronic
1152005660 17:77678800-77678822 AACCCAGGTGGTACAGCCTGTGG + Intergenic
1152453806 17:80401196-80401218 AGCTGAGGAGGAGCAGCCTGGGG - Intergenic
1152661254 17:81543291-81543313 AGCCCAGGTGGAGCTGAGGCAGG + Intronic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1152790293 17:82274985-82275007 AGCCCAGGAGGACCAGCCGAGGG - Intergenic
1156383835 18:36587972-36587994 AACCCATGTGGTCCAGCCTCAGG - Intronic
1156915723 18:42463190-42463212 ACCCGAGGTGGAGCAGTCTGGGG - Intergenic
1157625131 18:49044806-49044828 ACTCCATGAGGAGCAGCCTCGGG - Intronic
1158401387 18:57124342-57124364 AGCCCAGGAAGCACAGCCTCTGG - Intergenic
1158485335 18:57861237-57861259 AGCCCAGGGGGTGGAGCCTGGGG - Intergenic
1159015861 18:63101312-63101334 TGCCCAGGAGCTGCAGCCTCAGG - Intergenic
1160032424 18:75274008-75274030 AGCCCAGGAGGAGGCGCCGCCGG - Intronic
1161077110 19:2291149-2291171 TGGCCAGGTGGCGCAGCCGCAGG + Exonic
1161524018 19:4742503-4742525 AGGCCACGTGCAACAGCCTCGGG - Intergenic
1162781541 19:13009530-13009552 AGGCCAGAAGGAGGAGCCTCAGG - Intronic
1163270498 19:16250425-16250447 AGCCAGGGTCGAGCAGGCTCTGG - Intergenic
1163332954 19:16653027-16653049 AGCCCAGGTGGAGCAGGATCTGG + Intronic
1163429643 19:17259597-17259619 AGCCCAGATGGAGCAACTCCGGG - Exonic
1165408804 19:35645826-35645848 AGCCCAGGAGGAGAAGGGTCAGG + Intergenic
1165741345 19:38206990-38207012 AGCCCAGGTGCAGTGGCCTCTGG - Exonic
1165912556 19:39238065-39238087 AGCTCAGGAGGAGGAGCCACGGG + Intergenic
1165914430 19:39248832-39248854 TGCCCAGGTGGAGACGGCTCTGG - Intergenic
1165920799 19:39296867-39296889 AGCTCACCTGGAGAAGCCTCAGG - Exonic
1166232345 19:41432257-41432279 AGGGCCGGAGGAGCAGCCTCGGG - Exonic
1166246248 19:41529075-41529097 AGAGCAGGTGGAGATGCCTCAGG + Intergenic
1167504229 19:49862801-49862823 AGACCAGGCGAAGCAGCCCCAGG - Intronic
1168113559 19:54208545-54208567 AGCCCAGATGGTGCAGCAGCTGG - Intronic
1168407396 19:56118070-56118092 AGCCCAGGTGGGGCGGCCCCAGG - Intronic
1168485644 19:56759926-56759948 AGCCCAGGTGCAGCAGGTGCAGG + Intergenic
925293642 2:2764134-2764156 AGCCCAGGTGACTGAGCCTCCGG - Intergenic
926628826 2:15118648-15118670 AGCCCATGTGGAGTGGCCACGGG + Intergenic
927846061 2:26473504-26473526 GGCCCAGGTGGACCGGCCACGGG - Exonic
928003657 2:27543754-27543776 AGCCCAGGTGCAGCAGCTTAGGG - Intronic
928024725 2:27730250-27730272 AGGCCTGGTGGAGCAGCATCTGG - Intergenic
928024745 2:27730320-27730342 AGGCCTGGTGGAGCAGCGTCTGG - Intergenic
929195482 2:39180364-39180386 TGCCCGGCTGGGGCAGCCTCAGG - Intronic
929671443 2:43879009-43879031 AGCACGGCTGGGGCAGCCTCAGG - Intergenic
929847286 2:45542534-45542556 AGCCCATCTGGAGCAGCTGCTGG - Intronic
931379957 2:61743493-61743515 ACCCCAGGTGGAGTGGCCACTGG + Intergenic
932419600 2:71593765-71593787 CGCCCAGATGGAGGACCCTCAGG + Intronic
932619788 2:73258722-73258744 ACCCCGGCTGGAGTAGCCTCTGG - Exonic
934677476 2:96259862-96259884 GGCCCAGCTGAAACAGCCTCTGG - Intronic
934949138 2:98564475-98564497 AGCCCAGGTGGGGCATGCCCTGG - Intronic
936351683 2:111717425-111717447 AGCCCAGGTGGTACAGCGTGAGG + Intergenic
937203356 2:120220062-120220084 AGCCCAGCTGTAGCTCCCTCAGG + Intergenic
937865602 2:126749147-126749169 AGGACAGGTCGCGCAGCCTCGGG - Intergenic
938548199 2:132353543-132353565 TGCCCTGGTGCAGCCGCCTCCGG - Intergenic
939143259 2:138379851-138379873 ACCCCAGGTGGCCCAGGCTCTGG + Intergenic
939844658 2:147228765-147228787 AGTCCATGTGGATTAGCCTCTGG - Intergenic
940931605 2:159438551-159438573 ATCCCAGCAGAAGCAGCCTCAGG - Exonic
941818750 2:169824821-169824843 CGCACTGCTGGAGCAGCCTCAGG + Exonic
942713411 2:178864102-178864124 AGCGCAAGTGGAGCAGGCTGAGG - Intronic
945900817 2:215535119-215535141 AGCATAGTTGGAGAAGCCTCAGG - Intergenic
947452634 2:230222644-230222666 AGCCCAGGAGGTCCAGTCTCTGG + Intronic
947933502 2:233983852-233983874 TGACCAGGAGGAGCAGGCTCTGG - Intronic
948329792 2:237155884-237155906 AGCCCAGGGGACGCAGCCCCAGG + Intergenic
948335780 2:237206031-237206053 AGTCCATGGGGAACAGCCTCGGG - Intergenic
948892316 2:240913453-240913475 AGCTCAGCTGGAACTGCCTCAGG - Intergenic
1168878550 20:1186762-1186784 AGCCCTGGTGGACCTGCCTAGGG - Intronic
1170019236 20:11817316-11817338 TGCCCAGGCAGAGCAACCTCTGG + Intergenic
1170366994 20:15608962-15608984 AGCCCAGAATGAGCAGCATCAGG - Intronic
1170903442 20:20488443-20488465 AGCCCAGGAGCAGAAACCTCTGG - Intronic
1171877072 20:30586315-30586337 TGCCCCGGTGCAGCCGCCTCCGG - Intergenic
1172123532 20:32612209-32612231 GTCTCAGGTGGGGCAGCCTCTGG + Intergenic
1173828404 20:46062332-46062354 AGCACAGATGGGGCAGCCACAGG - Exonic
1173837371 20:46134778-46134800 ATCCCAGGAGGAGCCCCCTCAGG - Intergenic
1174452029 20:50626315-50626337 AGCCCAGGCCCAGCATCCTCTGG + Intronic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175515669 20:59568389-59568411 TGCCCAGGTGGAGGAGGGTCAGG + Intergenic
1175861523 20:62152682-62152704 ACACCAGGTGGAGGAGACTCAGG + Intronic
1175876576 20:62232986-62233008 GGCCCAGGTTGAGGAGCCACCGG - Intronic
1176081020 20:63273040-63273062 AGCTCTGGGGCAGCAGCCTCAGG - Intronic
1176140807 20:63544243-63544265 GGCCCAGCGAGAGCAGCCTCGGG - Exonic
1176196034 20:63836627-63836649 AGCGCAGCTGGAGCAGGCCCTGG + Intergenic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1178071088 21:28967756-28967778 AGCCCAGGTAAAACAGCCTGGGG + Intronic
1178350905 21:31872848-31872870 CGCCCAGGTCGGGCCGCCTCCGG - Intergenic
1179383971 21:40924722-40924744 AGTCAAGGAGGAGCAGCTTCAGG + Intergenic
1179656756 21:42850589-42850611 GGACCAGGAGCAGCAGCCTCTGG + Intronic
1179785518 21:43727774-43727796 AGGCCCTGTGGAGCAGACTCTGG + Intronic
1179880707 21:44292338-44292360 AGTCCAGGAGGTGCAGCCCCGGG + Exonic
1179959206 21:44758859-44758881 AGCCCAGGTGGAGGAACATCAGG + Intergenic
1180229156 21:46416119-46416141 AGCTCAGGTGAAACAGCTTCAGG + Exonic
1180705629 22:17808249-17808271 AGCCGACGTGGAGCAGACTCCGG - Intronic
1181014012 22:20057997-20058019 GGACCAGGTGGGGCAGGCTCAGG - Intronic
1181771713 22:25130729-25130751 AGCACAGGTGACCCAGCCTCTGG + Intronic
1182325890 22:29512386-29512408 AGCCAAGGTGGACCAGACTCTGG - Intronic
1182759277 22:32708918-32708940 AGCCCAGATGGAGCTGCTTTGGG + Intronic
1183628640 22:39020267-39020289 AGCCTGGGAAGAGCAGCCTCTGG - Exonic
1183632058 22:39039599-39039621 AGCCTGGGAAGAGCAGCCTCTGG - Intergenic
1183637938 22:39076427-39076449 AGCCTGGGAAGAGCAGCCTCTGG - Intronic
1184047619 22:41981319-41981341 TGCCAAGATGGAGCAGCCCCTGG + Intronic
1184191085 22:42894964-42894986 AGCCCATGTAGCTCAGCCTCAGG - Intronic
1184249178 22:43250572-43250594 AGCCAGGCAGGAGCAGCCTCAGG + Intronic
1184470348 22:44692376-44692398 AGCTAAGGTGGAGGAGCCCCGGG - Intronic
1184687718 22:46104073-46104095 AGCCCAGGTGGCCTAGCCTGAGG - Intronic
1184791220 22:46701312-46701334 AGCCTCGGGGCAGCAGCCTCTGG + Intronic
1185275199 22:49947709-49947731 AGCCCAGCTGGGGCAGACCCAGG + Intergenic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
949539343 3:5020121-5020143 AACCCATGTGGAGCGGCCTGAGG + Intergenic
951411585 3:22372778-22372800 AGCCCAGGTGCACCAGGCTGGGG + Intronic
954462422 3:50634900-50634922 TGCCCCCATGGAGCAGCCTCTGG - Intronic
954579770 3:51696916-51696938 ACCCCTGGAGGGGCAGCCTCAGG - Intronic
954762919 3:52890060-52890082 TGCTCAGGTGGAGCTTCCTCAGG + Intronic
954999128 3:54910612-54910634 AGCACAGGTGGAGAACCCTGGGG - Intronic
955055453 3:55451258-55451280 AGCATAGCTGGAGAAGCCTCAGG + Intergenic
955950601 3:64239026-64239048 AGCCCTGCTGGTGCATCCTCAGG + Intronic
958642906 3:96831352-96831374 AGCCCACGTGGAGGAGGATCAGG - Intronic
961414164 3:126745282-126745304 AGCCCAGGTGTAACAGAGTCCGG - Intronic
961416988 3:126766556-126766578 AGCCCAGGAGGTGAAGACTCTGG - Intronic
961628229 3:128278391-128278413 AGGCCAGGTGGAGGAGCCGTTGG + Intronic
963742847 3:149097659-149097681 AGCCCAGGTGCAGGATCCACTGG - Intergenic
964926549 3:161964642-161964664 AGCCCAGCTGGGGAGGCCTCAGG - Intergenic
967078188 3:186024235-186024257 AGCAGAGGAGGAGCAGTCTCTGG - Intergenic
967259299 3:187626229-187626251 AGCACAGGTAAAGCAGCCTGAGG + Intergenic
968350140 3:198046732-198046754 AGCCCAGGAGGGGCAGCCCCAGG - Intergenic
968976655 4:3825598-3825620 ACCCCACGTGGCCCAGCCTCAGG - Intergenic
969534466 4:7747376-7747398 TGCCTACGTGGAGAAGCCTCCGG + Intergenic
971905116 4:32716163-32716185 AGCCCCGGTGCAGGAGCCACTGG - Intergenic
973601283 4:52545263-52545285 AAGCCAGGAGGAGCAGACTCAGG - Intergenic
973872921 4:55184752-55184774 AGCCCAGGTGTTGCACCCACAGG - Intergenic
974484710 4:62491835-62491857 AGCCCAGGTGCAGGATCCACTGG - Intergenic
977564344 4:98566526-98566548 AGCCCAGCTGGAGCAGCCATGGG + Intronic
978620349 4:110630747-110630769 AGGACAGGTGGAGAAGCCTACGG - Intronic
978656149 4:111067824-111067846 AGCCCAGGAGCTACAGCCTCAGG - Intergenic
978938251 4:114405240-114405262 AGCCCATGAGCAGCAACCTCTGG - Intergenic
981431345 4:144664347-144664369 AGCCCTGATGGGGAAGCCTCTGG + Intronic
983508237 4:168578523-168578545 AGCACAGCTGGGGAAGCCTCAGG - Intronic
984969893 4:185178751-185178773 AGCACAGGTGGACCAGCTTTGGG + Intronic
985988803 5:3538591-3538613 CACCCAGGTTCAGCAGCCTCAGG + Intergenic
986176145 5:5353787-5353809 AGCCCAGGTGGCACAGTCACAGG + Intergenic
986469514 5:8060207-8060229 AGCTCAGGCCCAGCAGCCTCAGG - Intergenic
987336800 5:16904426-16904448 AGCACAGGTGCAGCAACCTGCGG + Intronic
988142614 5:27263536-27263558 ATCCCAGCTGCACCAGCCTCTGG + Intergenic
992494940 5:77282717-77282739 AGCCCTGGTGGAGCAATGTCCGG + Intronic
995568745 5:113457566-113457588 AGCCCAGGTGCAGGATCCACTGG + Intronic
997632663 5:135380545-135380567 ATCCCAGGGAGCGCAGCCTCAGG + Intronic
997715718 5:136041134-136041156 AGCCCCAGTGCAGCAGCCTGTGG - Intronic
999314503 5:150575248-150575270 GGGCCAGGTGGGGCAGCCTCAGG - Intergenic
1001204945 5:169753664-169753686 ACCCCAGGTGGATAAGACTCAGG + Intronic
1001415853 5:171544522-171544544 AGCCCAGTTGGAGCAGTCTTGGG - Intergenic
1002595429 5:180318755-180318777 AGTCCACGTGCGGCAGCCTCGGG - Intronic
1002767400 6:254259-254281 AGCCCATGGTGAGCAGCATCAGG + Intergenic
1002961622 6:1920295-1920317 AGCTCTGGTGGAGAAGCCTGGGG - Intronic
1003292166 6:4788902-4788924 GTGCCAGGTGGACCAGCCTCTGG + Intronic
1003868473 6:10383592-10383614 GGCCTGGGTGGTGCAGCCTCTGG - Intergenic
1004091368 6:12505658-12505680 AGCCCATGTGGATCAGTCTGGGG - Intergenic
1004297509 6:14426968-14426990 AGCACAGGTCTTGCAGCCTCTGG - Intergenic
1005016131 6:21377060-21377082 TGCTCAGGTAGAGCAGCCTGTGG + Intergenic
1006291902 6:33144439-33144461 AGCCCAGGAGGTGCAGGCTATGG - Intergenic
1007274391 6:40662770-40662792 AGCCCAGGTGGGGAGGCCCCAGG - Intergenic
1008000576 6:46355906-46355928 AGCCCAAGTGGAGCAGCATGAGG - Intronic
1008473869 6:51915218-51915240 ATCTCAGGTGGAGCAGCATCAGG - Intronic
1011192130 6:84740177-84740199 AGGCCAGGTGGAGCAGGTGCAGG - Intronic
1012872407 6:104687780-104687802 AGACCAGGCTGAGAAGCCTCTGG + Intergenic
1014044227 6:116865563-116865585 AGCATAGCTGGAGAAGCCTCAGG - Intergenic
1016457829 6:144249609-144249631 ACCCCAGGTGAATCAGCTTCAGG - Intergenic
1016939566 6:149473186-149473208 AGCCCAGATGGTCCAGCCTCAGG - Intronic
1018429895 6:163714103-163714125 AGCCCAGGAGGAGGTCCCTCCGG - Intergenic
1018470789 6:164096235-164096257 AGCCCAGCTGAGGAAGCCTCAGG + Intergenic
1019112860 6:169730996-169731018 AGCCTAGGTGGAGGAGCCTAGGG + Intergenic
1019149420 6:169994220-169994242 AGCCCAGGTGCTGAAGGCTCTGG + Intergenic
1019952130 7:4382251-4382273 AGCCCAGGAGGAGGAGGCTGTGG - Intergenic
1028023972 7:85813525-85813547 AGCATGGCTGGAGCAGCCTCAGG + Intergenic
1029106310 7:98179305-98179327 AGGCCAGGGGCAGCAGCCTGAGG - Intronic
1029124768 7:98288287-98288309 AGTCGAGGTGGGGGAGCCTCGGG - Intronic
1029514616 7:101017692-101017714 AGAGGAAGTGGAGCAGCCTCAGG - Intronic
1030729323 7:112966585-112966607 AAGCCTGGTGTAGCAGCCTCTGG + Intergenic
1030808318 7:113944796-113944818 AGTACAGGAGGAGCAGCATCAGG + Intronic
1030903841 7:115158159-115158181 CACCCAGGTGAAGCCGCCTCAGG + Intergenic
1032460721 7:132108416-132108438 AGCCCGGGTGGAGCAGTCCGTGG - Intergenic
1032511489 7:132475985-132476007 AGCCCAGCGGGAGCAGCCCCAGG + Intronic
1034383694 7:150720598-150720620 AGCCCAGGTGGAGCAGCTGCTGG + Exonic
1035026326 7:155828915-155828937 AGCCTAGCTGGAGAGGCCTCAGG + Intergenic
1035192237 7:157180957-157180979 GCCCCAGGTGGAGCAGCATGAGG + Intronic
1035314569 7:157990133-157990155 AGCCCAGGTGAAGCTGCAGCTGG + Intronic
1037553867 8:20003631-20003653 AGCCCTAGTGGAGCTGCCCCAGG - Intergenic
1038134713 8:24772858-24772880 AACCCAGCAGGTGCAGCCTCTGG - Intergenic
1039497625 8:37992944-37992966 AGCCTGGGTGGAGCTGCCTAAGG - Intergenic
1040105133 8:43537411-43537433 AGCCCAGGAGGGGCAGTCCCAGG + Intergenic
1042709426 8:71699848-71699870 CTCCCAGCTGCAGCAGCCTCAGG - Intergenic
1044527590 8:93269113-93269135 AGCCCAGGTAGAGGAGGCACAGG - Intergenic
1044927890 8:97224637-97224659 TGCACAGGTGGAGCAGCTGCAGG + Intergenic
1045059984 8:98402946-98402968 AGAAGAGGAGGAGCAGCCTCTGG + Intronic
1046367806 8:113259354-113259376 AGGCCAAGTGGATTAGCCTCAGG + Intronic
1046665127 8:116993237-116993259 AGGCAAGATGGAGCAACCTCAGG + Intronic
1047799968 8:128298598-128298620 AACCCAGGTGGAACAGACTTGGG - Intergenic
1048259842 8:132936300-132936322 AGCCCGGGAGGAGCAGCTGCTGG - Intronic
1049103514 8:140596925-140596947 AGCCCAGGGGGACCTGCCTGAGG + Intronic
1049439908 8:142604566-142604588 TGCCCAGATGTAGCAGCCACGGG - Intergenic
1052324806 9:27206189-27206211 AGCCTATGTGGGGCAGCCACAGG - Intronic
1056741191 9:89256823-89256845 ACCCCCTGTGGAGGAGCCTCTGG + Intergenic
1057134302 9:92676413-92676435 AGCCCTGATGCAGCAGCCTCAGG + Intergenic
1057292059 9:93813040-93813062 AGCCCAGGTAGGGCAGGTTCCGG + Intergenic
1060192724 9:121603263-121603285 AGCCCAGGCCAGGCAGCCTCGGG - Intronic
1060359420 9:122941029-122941051 GGCCCAGGCGGCGGAGCCTCCGG + Exonic
1060601787 9:124882877-124882899 AGCCCAGCTGGAAAAGGCTCTGG + Intronic
1061253032 9:129437607-129437629 AGCCCCGCTGGACCAGACTCGGG - Intergenic
1061392898 9:130327580-130327602 AGCCCAGGAGCAGCACCCTATGG - Intronic
1061808109 9:133147702-133147724 AGCACAGCAGCAGCAGCCTCAGG + Intronic
1061989682 9:134152257-134152279 AGCACAGGTGGAGGAGCCCCAGG - Intronic
1062088702 9:134662618-134662640 AGCCCAGATGGAAGGGCCTCTGG + Intronic
1062230377 9:135479215-135479237 AGCTCGGGTGGGGCAGCCGCGGG + Intronic
1062351514 9:136141961-136141983 AGCTGAGGGTGAGCAGCCTCCGG - Intergenic
1062357804 9:136173231-136173253 AGCCCAGGAGCAGCAGACCCAGG + Intergenic
1062375886 9:136261745-136261767 AGACCCGGGGGAGCAGCCTTTGG - Intergenic
1062450571 9:136614111-136614133 AGCCCAGGAGGTGCACCCCCTGG - Intergenic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1187639686 X:21274337-21274359 GGCCCAGGCTGTGCAGCCTCAGG - Intergenic
1189744641 X:44157501-44157523 AGCCAATGTGAAGCAGCATCAGG + Intronic
1192172520 X:68865719-68865741 AGACCAGGTGGAGCAGAGCCTGG + Intergenic
1192204751 X:69088453-69088475 AGCAGAGGAGGAGGAGCCTCAGG - Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1202171347 Y:22047955-22047977 AGTCCAGTTGGAGCAACATCTGG - Intergenic
1202220015 Y:22538417-22538439 AGTCCAGTTGGAGCAACATCTGG + Intergenic
1202323101 Y:23657249-23657271 AGTCCAGTTGGAGCAACATCTGG - Intergenic
1202547671 Y:26012805-26012827 AGTCCAGTTGGAGCAACATCTGG + Intergenic